Next Article in Journal
The Preparation and Evaluation of Carvacrol-Added Hyaluronic Acid for Early Osteoarthritis Treatment
Next Article in Special Issue
Physiological Responses and Serum Metabolite Alterations in Grass Carp (Ctenopharyngodon idellus) Under Chronic Salinity Exposure
Previous Article in Journal
Oxidative Stress Related to Mechanical Heart Valves: A Pilot Cross-Sectional Study
Previous Article in Special Issue
Effect of Vitamin C on the Antioxidant and Immune Response of Male White Shrimp (Penaeus vannamei) Broodstock
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Physiology and Molecular Response Mechanisms in the Gills of Macrobrachium rosenbergii Under Acute NaHCO3 Alkaline Stress

1
Key Laboratory of Healthy Freshwater Aquaculture, Ministry of Agriculture and Rural Affairs, Key Laboratory of Fish Health and Nutrition of Zhejiang Province, Zhejiang Institute of Freshwater Fisheries, Huzhou 313000, China
2
College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China
*
Author to whom correspondence should be addressed.
Antioxidants 2025, 14(10), 1266; https://doi.org/10.3390/antiox14101266
Submission received: 16 September 2025 / Revised: 9 October 2025 / Accepted: 18 October 2025 / Published: 21 October 2025
(This article belongs to the Special Issue Antioxidant Response in Aquatic Animals)

Abstract

As an important freshwater economic shrimp, Macrobrachium rosenbergii (M. rosenbergii) possesses a certain tolerance to saline/alkaline conditions. Analyzing the damage mechanism and stress response of M. rosenbergii in saline/alkaline environments will provide a scientific basis for promoting ecological restoration through the utilization of saline/alkaline water resources for aquaculture. In the first experiment, the 96 h median lethal concentration (LC50) of NaHCO3 was determined for juvenile M. rosenbergii. A second experiment then exposed the shrimp to a control group and an alkaline water group set at 60% of the established LC50. After 96 h of exposure, gill tissue samples were collected from both groups for analysis. The aim was to clarify both the damage mechanisms induced by NaHCO3 and the response mechanisms. The current results indicated that acute NaHCO3 exposure reduced antioxidant enzyme activity and induced gill tissue damage in M. rosenbergii. In response to the stress caused by NaHCO3, M. rosenbergii activated immune-related enzymes as well as immune-related differentially expressed genes involved in endocytosis, autophagy, and the toll-like receptor signaling pathway. In summary, the current research provided reference information for understanding the adverse effects caused by saline/alkaline water stress and for the breeding of M. rosenbergii in saline/alkaline water environments.

1. Introduction

In the context of global climate change, abiotic stresses such as strong winds, drought, soil salinization, and extreme temperatures (including heat stress and cold stress) pose major challenges to the growth of organisms. Among these, soil salinization is indeed a key environmental constraint that severely limits the functionality of agricultural soil ecosystems globally [1]. Once established, soil salinization constitutes a significant environmental challenge generating substantial adverse impacts, including primarily ecological degradation, loss of land productivity, exacerbated desertification, potential water contamination, and economic losses [2,3,4]. Saline/alkaline land resulting from soil salinization is an outcome of the combined influence of specific environmental conditions (aridity/scarce rainfall, saline groundwater) and human activities (primarily improper irrigation practices), representing a global ecological threat [5]. Saline/alkaline lands represent vital ‘dormant resources’ and highly valuable ‘potential granaries’. Particularly regarding saline/alkaline water bodies, they are extensively distributed worldwide, with China alone containing approximately 4.6 million hectares of such waters. The development of aquaculture in saline/alkaline lands can not only effectively expand fisheries’ production capacity to better meet public demand for premium aquatic products but also boost economic growth in affected regions. Crucially, it carries significant potential for mitigating water scarcity crises and rehabilitating degraded saline soil/water ecosystems. In China, the predominant types of saline/alkaline water are chloride-type, sulfate-type, and carbonate-type. Compared to chloride-type and sulfate-type waters, carbonate-type saline/alkaline water poses more severe detrimental effects on aquatic animals [6,7]. Carbonate alkalinity stress has been identified as one of the primary factors affecting the survival of aquatic animals in saline/alkaline aquatic environments. Previous studies have demonstrated that exposure to elevated carbonate concentrations induces significant alterations in biochemical parameters and histopathological damages of aral barbel (Luciobarbus capito) [8] and oriental river prawn (Macrobrachium nipponense) [9].
Selecting and cultivating dominant species with alkali-tolerant traits represent a pivotal strategy for optimizing the utilization of saline/alkaline water resources in aquaculture. Crustaceans exhibit varying degrees of carbonate alkalinity tolerance, as evidenced by species such as the pacific white shrimp (Litopenaeus vannamei) [10], ridgetail white prawn (Exopalaemon carinicauda) [11], and Chinese mitten crab (Eriocheir sinensis) [12]. As an economically important freshwater shrimp in China, the giant freshwater prawn (Macrobrachium rosenbergii) was introduced in 1976. After four decades of development, it has become a significant aquaculture species, and China’s M. rosenbergii production reached 196,374 tonnes in 2023. Possessing a certain level of tolerance, M. rosenbergii shows promise as an emerging species for cultivation in saline/alkaline waters. However, saline/alkaline water bodies, particularly alkaline environments characterized primarily by high carbonate alkalinity, impose multiple stressors on the physiological metabolism of aquatic animals. It has been reported in studies on shrimp and crabs that carbonate alkalinity stress could impair the organism’s antioxidant defense system, manifested as a reduction in antioxidant enzyme activities (such as superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), and total antioxidant capacity (T-AOC)) [10,13], and even inducing oxidative damage in tissues. This leads to critical bottlenecks constraining industrial development, such as inhibited growth and decreased survival rates. Therefore, elucidating the damage mechanisms and molecular response mechanisms of M. rosenbergii under alkaline exposure was of considerable significance. Chen et al. [7] conducted transcriptomic sequencing on M. rosenbergii larvae exposed to carbonate/alkali stress. However, differences in size, morphology, and sampled tissues between larvae and juveniles may lead to divergent stress response mechanisms. Furthermore, pathological damage to M. rosenbergii tissues under carbonate/alkali stress remains poorly documented.
Gills are important respiratory organs of shrimps, changes in physiological indicators, histomorphological alterations, and pathological damage in gills can serve as critical evidence for assessing injuries induced by carbonate/alkali stress [14]. And gills play critical roles in defending against saline/alkaline stress conditions; when exposed to external environmental stimuli, crustaceans elicit stress responses characterized by an increase in immune-related enzyme activities (such as alkaline phosphatase (ALP), acid phosphatase (ACP), nitric oxide (NO), and nitric oxide synthase (T-NOS)) within a specific range, reflecting a protective mechanism activated by the organism [15]. In addition, the gill tissue molecules of crustaceans will also respond to cope with the carbonate alkalinity stress [16], and transcriptomics has emerged as a powerful tool for elucidating the molecular response mechanisms of crustaceans to carbonate/alkali stress [12,14]. Therefore, focusing on gill tissue and building upon our prior findings [17], the current research mainly focused on the morphological changes in gill tissues and the changes in the response mechanisms of enzyme activities and molecules in gill tissues of M. rosenbergii after 96 h of acute sodium bicarbonate (NaHCO3) alkali stress. The current study revealed the physiological mechanism by which M. rosenbergii responds to alkaline carbonate stress and the damage characteristics it causes. And it provided a crucial scientific basis for utilizing saline/alkaline water resources for shrimp farming, as well as for promoting the ecological restoration and environmental governance of saline/alkaline lands.

2. Materials and Methods

2.1. Ethics Statement

In the present study, the treatment method of M. rosenbergii strictly followed the Zhejiang Institute of Freshwater Fisheries Animal Experimentation Ethics Committee (ZJIFF20210302); approval date: 2 March 2021.

2.2. Experimental Design

For Experiment 1, a total of 360 healthy and similar juvenile M. rosenbergii (average weight of 1.30 ± 0.02 g and average body length of 3.50 ± 0.02 cm) were randomly selected and divided into 18 white plastic farming boxes (45 L), and 6 groups were set with 3 parallel in each group, and 20 shrimp in each parallel. They were temporarily raised in an exposed water environment for 7 days to adapt to the farming environment. According to the acute NaHCO3 alkali stress experiment conducted by Chen et al. on M. rosenbergii larvae (0.010 ± 0.001 g), a semi-lethal concentration (LC50) of NaHCO3 at 96 h was determined to be 5.69 mmol/L [7]. In the current study, tap water was used as the control group, and NaHCO3 was used to prepare alkaline water as the experimental group, with NaHCO3 gradients set at 10 mmol/L, 12 mmol/L, 14 mmol/L, 16 mmol/L, 18 mmol/L, and 20 mmol/L, and the formal experiment was conducted after NaHCO3 was fully dissolved and stabilized in the water for 24 h. We recorded the number of deaths of juvenile M. rosenbergii in each parallel after 24 h, 48 h, 72 h, and 96 h of acute stress on M. rosenbergii in NaHCO3 water.
For Experiment 2, a total of 150 healthy and similar juvenile M. rosenbergii (average weight of 1.29 ± 0.02 g and average body length of 3.46 ± 0.03 cm) were randomly selected and divided into 6 white plastic farming boxes (45 L), and 2 groups were set with 3 parallel in each group, and 25 shrimp in each parallel. The 60% concentration of the LC50 of NaHCO3 alkalinity (6.4 mmol/L) obtained after 96 h in Experiment 1 was taken as the experimental group, and tap water was used as the control group. During the above two experiments, the water temperature was 28 ± 1 °C, and the dissolved oxygen was not allowed to be lower than 6 mg/L.

2.3. Sample Collection

After 96 h of NaHCO3 alkalinity stress on M. rosenbergii in Experiment 2, the tissues of the M. Rosenbergii in the control group and the experimental group were collected. Firstly, the gill tissues of 6 shrimp (18 shrimp were sampled from the control group, and another 18 from the experimental group) were collected from each parallel for the determination of antioxidant and immune-related enzyme activities and the relative gene expression levels. Secondly, the gill tissues of 6 shrimp in each parallel (18 shrimp were sampled from the control group, and another 18 from the experimental group) were collected for transcriptomic analysis. To mitigate the effects of individual variation and limited sample size, we pooled gill tissues from 6 randomly selected shrimp per replicate to form a single composite sample for subsequent transcriptomic analysis. The collected gills were immediately frozen in liquid nitrogen and then transferred to a refrigerator at −80 °C for storage. Finally, the gill tissues of 1 shrimp (3 shrimp in each group) were collected from each parallel and placed in 4% paraformaldehyde and 2.5% glutaraldehyde, separately, for the detection of gill tissues and ultrastructure observation.

2.4. Histological Examination of Gills (HE)

Collected samples were fixed in 4% paraformaldehyde. After adequate fixation, the following procedures were performed: (1) Fixation and dewaxing: Tissue samples were paraffin-embedded using an embedding machine (JB-P5, Wuhan Junjie Electronics Co., Ltd., Wuhan, China), and sections were prepared using a cryostat (CRYOSTAR NX50, Thermo Fisher Scientific Co., Ltd., Shanghai, China); (2) Hematoxylin staining: Sections were stained with hematoxylin for 3–5 min and washed with tap water; (3) Eosin staining: Sections were dehydrated in 95% ethanol for 1 min and stained with eosin for 15 s; (4) Dehydration and mounting: Sections were sequentially dehydrated in anhydrous ethanol I (2 min), anhydrous ethanol II (2 min), anhydrous ethanol III (2 min), n-butanol I (2 min), n-butanol II (2 min), xylene I (2 min), and xylene II (2 min) for transparency, followed by neutral resin mounting; (5) Microscopy and imaging: Sections were examined under a bright-field microscope (NIKON ECLIPSE E100, Nikon Corporation, Tokyo, Japan), and images were captured and analyzed using an imaging system (NIKON DS-U3, Nikon, Japan).

2.5. Ultrastructure Observation

(1) Tissue fixation: Tissue fragments (1 mm3) were fixed in electron microscopy fixative (G1102, Wuhan Saiweier Biotechnology Co., Ltd., Wuhan, China), followed by three washes (15 min each) with 0.1 M phosphate buffer (PB, pH 7.4). (2) Dehydration: Tissues were dehydrated at room temperature in a graded ethanol series (30%, 50%, 70%, 80%, 95%, 100%, and 100%; 20 min each) and 100% acetone (twice, 15 min each). (3) Infiltration and embedding: Pure 812 embedding resin (product no. 90529-77-4, SPI) was poured into embedding molds. Samples were inserted into the molds and incubated overnight in a 37 °C oven. (4) Polymerization: Molds were transferred to a 60 °C oven for 48 h to polymerize the resin blocks. (5) Orientation: Resin blocks were sectioned using an ultramicrotome (Leica UC7, Leica Microsystems GmbH, Wetzlar, Germany). Semi-thin sections were stained with toluidine blue and examined under a light microscope to locate target regions. (6) Ultra-thin sectioning: Selected resin blocks were ultra-thin-sectioned using an ultramicrotome (Leica UC7), and sections were collected on 150-mesh copper grids. (7) Staining: Grids were stained with 2% uranyl acetate in ethanol (8 min, protected from light), rinsed three times with 70% ethanol, washed three times with ultrapure water, counterstained with 2.6% lead citrate (8 min), and rinsed three times with ultrapure water. Excess liquid was blotted with filter paper, and grids were air-dried overnight at room temperature. (8) Imaging: Sections were observed under a transmission electron microscope (HT7800/HT7700, Hitachi High-Technologies Corporation, Tokyo, Japan), and images were acquired for analysis.

2.6. Determination of Antioxidant and Immune-Related Enzyme Activities

All antioxidant (superoxide dismutase (SOD), anti-superoxide anion free radical (ASAFR), glutathione peroxidase (GSH-Px), catalase (CAT), total antioxidant capacity (T-AOC), glutathione s-transferase (GST)), and immune indices (alkaline phosphatase (ALP), acid phosphatase (ACP), nitric oxide synthase (T-NOS), and nitric oxide (NO)) were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s protocols. Enzyme activities were quantified using specified instruments as per the kit instructions.

2.7. RNA Extraction, Library Preparation, and Library Quality Inspection

(1) RNA extraction: Total RNA was isolated from tissue samples using TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). (2) Library preparation: Ribosomal RNA (rRNA) was depleted using a standard rRNA removal kit. Enriched mRNA was reverse-transcribed into double-stranded cDNA. cDNA ends were repaired, adapters were ligated, and libraries were amplified by PCR. Qualified libraries were subjected to sequencing. (3) RNA quality control: RNA integrity and DNA contamination were assessed by agarose gel electrophoresis (1.5% agarose in 1× TAE buffer(Thermo Fisher Scientific Inc., Waltham, MA, USA)). RNA purity was evaluated using a NanoPhotometer spectrophotometer (Implen GmbH, Munich, Germany).

2.8. Quality Assessment of Transcriptome Sequencing Data

To ensure data quality, raw reads were subjected to preprocessing to eliminate interference from low-quality or irrelevant data prior to bioinformatic analysis. First, raw sequencing data were processed using fastp for quality control [18]. Low-quality reads were filtered based on the following criteria: (1) removal of reads containing adapter sequences; (2) exclusion of reads composed entirely of poly A sequences; (3) discarding reads with low-quality bases (Q ≤ 20) constituting > 50% of the read length. The resulting clean reads were subsequently aligned to a species-specific ribosomal RNA (rRNA) database to remove residual rRNA-derived sequences [19]. Unmapped reads were retained for transcriptomic analysis. Finally, for reference genome-based alignment, HISAT2 was employed to map clean reads to the reference genome. After StringTie-based transcript assembly, RSEM [20] was employed to quantify gene expression levels. Differential gene expression analysis was performed using DESeq2 [21], with significance thresholds defined as a false discovery rate (FDR) < 0.05 and |log2(fold change)| > log2(2). Genes meeting these criteria were identified as significantly differentially expressed.

2.9. Quantitative Real-Time PCR (qPCR)

Tissues were ground in liquid nitrogen, and total RNA was extracted using FreeZol Reagent (R711-01, Vazyme, Nanjing, China). qPCR was conducted using HiScript® II One Step qRT-PCR SYBR Green Kit (Q221-01, Vazyme, Nanjing, China) on a 7500 Real-time PCR system (Thermo Fisher Scientific Inc., Waltham, MA, USA). Primers were designed based on transcriptome sequences and validated using Primer Premier 6 software, and the primers were synthesized by Sangon Biotech (Shanghai, China) (Table 1). Beta-actin (β-actin) was used as the housekeeping gene, and relative gene expression was normalized to the housekeeping gene and analyzed using the 2−ΔΔCT method [22].

2.10. Statistical Analysis

All data were tested by the software SPSS 20.0 for homogeneity of variance, the Tukey method in one-way variance was used to compare data between multiple groups, and an independent sample T-test was used for the two groups of data (p < 0.05). The LC50 of 24 h, 48 h, 72 h, and 96 h alkalinity for juvenile M. rosenbergii was determined using SPSS 20.0 software, and the LC50 was calculated through Probit regression. The safe concentration was calculated by 48 h LC50 × 0.3/(24 h LC50/48 h LC50)2. The results were expressed as the mean ± standard error, with different superscript letters representing significant differences (p < 0.05).

3. Results

3.1. Determination of LC50 of NaHCO3 Alkalinity

As shown in Figure 1, with the increase in NaHCO3 alkalinity, the mortality rate of M. rosenbergii also gradually increased. The LC50 of NaHCO3 of M. rosenbergii at 24 h, 48 h, 72 h, and 96 h was 26.45 mmol/L (Figure 1A), 18.50 mmol/L (Figure 1B), 13.51 mmol/L (Figure 1C), and 10.62 mmol/L (Figure 1D), respectively. The 95% confidence intervals for the LC50 of NaHCO3 of M. rosenbergii at 24 h, 48 h, 72 h, and 96 h were 21.67 to 44.91 mmol/L, 16.74 to 22.10 mmol/L, 12.19 to 14.67 mmol/L, and 8.82 to 11.79 mmol/L, respectively. The safe concentration was 2.71 mmol/L.

3.2. Determination of Antioxidant and Immune-Related Indicators

As shown in Figure 2, compared with the control group, antioxidant-related indicators such as the SOD (Figure 2A), GSH-Px (Figure 2C), and T-AOC (Figure 2E) activities were significantly decreased in the NaHCO3-exposed group (6.4 mmol/L), and immune-related indicators, including the ALP (Figure 2G), ACP (Figure 2H), and NO (Figure 2J) contents were significantly increased (p < 0.05). There were no significant differences in the ASAFR (Figure 2B), CAT (Figure 2D), GST (Figure 2F), and T-NOS (Figure 2I) contents between the control group and the NaHCO3-exposed group (6.4 mmol/L) (p > 0.05).

3.3. Histological Examination of Gills

As shown in Figure 3, in the control group, the gill filaments of M. rosenbergii were neatly arranged without fractures (blue arrows, Figure 3A). The gill lamellae exhibited intact structures (orange arrows, Figure 3A). The epithelial cells (black arrows, Figure 3B) were regularly aligned, and no significant hyperplasia was observed in the connective tissue (yellow arrows, Figure 3B). No apparent abnormalities were detected. The black square box indicates a magnified field of view (Figure 3A). In the NaHCO3-exposed group, the gill filaments of the M. rosenbergii exhibited significant thinning accompanied by structural disorganization and tortuous deformities (Figure 3C, circled area). The gill lamellae underwent complete disintegration, rendering their original morphology unrecognizable. The epithelial cells displayed a disordered arrangement, with partial detachment from the gill membrane (purple arrows, Figure 3D). Notably, pronounced vacuolization was observed in the gill cells (green arrows, Figure 3D). The black square box denotes the location of the magnified view (Figure 3C).

3.4. Ultrastructure Observation of Gills

As shown in Figure 4, compared to the control group, the gill cells of M. rosenbergii in the NaHCO3-exposed group exhibited severe edema and disintegration, with extensive dissolution of cell membranes. The nuclei (N) appeared irregularly shaped, accompanied by incomplete cell membranes and dissolution of the cytoplasmic matrix. Mitochondria (M) displayed marked swelling and disintegration, characterized by membrane rupture and extensive dissolution/loss of cristae.

3.5. Transcriptomic Library Sequencing Quality

As shown in Table 2, the percentage of high-quality reads was more than 99.58%, that of low-quality reads was less than 0.32%, that of adapter was less than 0.13%, and that of poly A was 0.00%. It was obvious that the sequencing quality was qualified and could be used for subsequent analysis of differentially expressed genes (DEGs).

3.6. Reference Alignment

As shown in Table 3, the proportion of unique mapped reads was no less than 84.26%, while the multiple mapped ratio reached a maximum of 6.24%, and the percentage of unmapped reads was no more than 11.51%. The total mapped ratio was at least 88.49%. The high unique mapping rate indicated that the sequencing data were of high quality and suitable for downstream analysis. The unmapped reads were largely composed of sequencing adapters and low-quality bases, which were filtered out.

3.7. DEG Analysis

In this study, principal component analysis (PCA) demonstrated that triplicate samples within each experimental group clustered closely (Figure 5A), indicating minimal intra-group variation and significant inter-group divergence. Volcano plots visualized the distribution of DEGs between comparison groups, with genes positioned toward the extremes of the plot exhibiting greater magnitude of differential expression (Figure 5B). Among the identified DEGs, 671 DEGs were upregulated and 334 DEGs were downregulated (Figure 5C). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed the signaling pathways related to immunity and the percentage of DEGs (Figure 5D). The statistical information on immune-related DEGs in the gills of M. rosenbergii in the NaHCO3-exposed group compared to the control group are shown in Table 4. Log2FC stands for log2-fold change, a metric that quantifies the difference in gene expression between experimental and control groups on a logarithmic scale. |log2FC| > 1 was used as the threshold to identify upregulated DEGs. The q-value was the corrected p-value, and a p-value < 0.05 indicated a statistically significant difference between groups.

3.8. qPCR Assay

The visualization heat maps of samples and DEGs in the RNA-seq and qPCR results are shown in Figure 6A,B, respectively. The transcriptome results showed that cathepsin D, cytochrome c, ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), heat shock protein 70 (hsp70), NF-kappa B inhibitor alpha (iκbα), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), and ras-related protein Rab-1A (rab-1a) were significantly upregulated in the NaHCO3-exposed group compared with the control group. The qPCR results were consistent with the RNA-seq results, confirming the reliability of the RNA-seq results, which could be used for the subsequent analysis (Figure 6C).

3.9. Correlation Analysis Between DEGs and Immune Parameters

The correlation analysis among DEGs and between DEGs and immune-related enzymes (ALP, ACP, and NO) is shown in Figure 7A,B, respectively. There was no significant correlation between ACP and DEGs (p > 0.05). No significant correlation was found between hsp70 and ALP and NO, but other DEGs showed significant correlations with ALP and NO (p < 0.05), among which arf6 showed a significant negative correlation with ALP and NO, and other DEGs were based on a significant positive correlation with ALP and NO.

4. Discussion

4.1. The Gills of M. rosenbergii Were Damaged Under NaHCO3 Stress

In the current study, the transcriptomic analysis revealed a significant upregulation of apoptosis-related genes (cathepsin D and cytochrome c) in the gill tissues of M. rosenbergii under NaHCO3 stress. The release and enzymatic activation of cathepsin D enable this protease to mediate apoptosis upstream of the caspase cascade [23]. Experimental studies have demonstrated that microinjection of cathepsin D triggers cytochrome c release from mitochondria, subsequently inducing caspase-dependent apoptosis [24]. These findings suggested that NaHCO3 stress may initiate apoptotic pathways in gill tissues. Consistent with this, recent studies on pacific white shrimp have documented similar apoptosis in gill tissues under carbonate/alkaline stress [14,25]. Alkaline stress-induced apoptosis disrupts immune homeostasis and exacerbates tissue damage [26]. Meanwhile, combined with the observation results of transmission electron microscopy, the apoptotic characteristics in the gills of M. rosenbergii exposed to NaHCO3 conditions, including mitochondrial (M) swelling, disintegration, membrane rupture, and extensive dissolution/loss of cristae, suggested that NaHCO3 stress may cause gill tissue damage in M. rosenbergii through the apoptotic pathway.
Under mild environmental stress, the upregulation of antioxidant enzyme activity contributes to the efficient clearance of excess reactive oxygen species, but, once the stress exceeds the capacity of the antioxidant system, the defensive function is compromised, leading to a marked decline in the activity of antioxidant enzymes [27,28,29]. SOD and GSH-Px are two of the most critical core enzymes in the cellular antioxidant defense system, and they work synergistically to eliminate harmful reactive oxygen species (ROS) and protect cells from oxidative damage. The current findings indicated that in the NaHCO3-exposed group, the levels of SOD and GSH-Px in the gill tissues of M. rosenbergii were significantly decreased, along with a notable reduction in T-AOC. This suggested that a NaHCO3 concentration of 6.4 mmol/L exceeded the antioxidant defense capacity of M. rosenbergii, thereby impairing its antioxidant system. When the production of free radicals exceeds the body’s clearance capacity, the balance is disrupted, leading to oxidative stress which in turn triggers cell apoptosis [30]. Investigations in zebrafish have revealed that oxidative stress subsequently triggers the process of apoptosis [31]. Therefore, we speculated that alkaline stress might disrupt the antioxidant system of M. rosenbergii, thereby inducing oxidative stress and ultimately triggering apoptosis; this mechanism still requires further investigation.

4.2. Molecular Response Mechanism in Gills of M. rosenbergii Under NaHCO3 Stress

The KEGG enrichment results also showed that DEGs were mostly enriched in immune-related metabolic pathways, such as endocytosis, autophagy, and the toll-like receptor signaling pathway. Recent studies have revealed that common carp exposed to high alkalinity stress exhibit significant enrichment of DEGs in the endocytosis pathway [32]. Endocytosis, a critical mechanism for immune defense, is mediated by the activation of ADP-ribosylation factor 4 (arf4) and ADP-ribosylation factor 6 (arf6) [33,34]. In alignment with these findings, our current research demonstrated a marked upregulation of arf4 and arf6 expression in the gill tissues of M. rosenbergii under NaHCO3 stress. This corroborates earlier work on Chinese white shrimp (Fenneropenaeus chinensis), where endocytosis was identified as a key adaptive strategy to counteract hyperalkaline environments [35]. In an acute NaHCO3 exposure experiment on oriental river prawn, transcriptomic analysis revealed that both gills and hepatopancreas tissues responded through activation of the endocytosis pathway, underscoring the critical role of endocytosis in combating NaHCO3 stress [9,16]. Notably, heat shock protein 70 (hsp70) enriched in the endocytosis pathway in the gills was significantly upregulated [16]. These findings aligned with our current results, where hsp70 expression levels were also markedly elevated in M. rosenbergii exposed to NaHCO3 conditions. The heat shock protein (HSP) family plays a pivotal role in cellular stress responses, with prior studies establishing Hsp70 as a key regulator in counteracting environmental stressors [36,37]. For instance, the Chinese mitten crab upregulates hsp70 expression to mitigate saline/alkaline stress, highlighting its conserved protective function across crustaceans [12]. Building on this, our findings demonstrated that M. rosenbergii activated the endocytosis pathway in response to NaHCO3 stress by upregulating the expressions of arf4, arf6, and hsp70 in gill tissues.
In the current study, the relative expression of NF-kappa B inhibitor alpha (iκbα) was significantly upregulated, with enrichment observed in the toll-like receptor (TLR) signaling pathway. This upregulation of IκBα reflects an adaptive mechanism to counteract adverse environmental stimuli [15]. The TLR pathway, a cornerstone of innate immunity, is pivotal in pathogen recognition and elimination [38,39]. For instance, in the Chinese mitten crab, toll-like receptor 2 (tlr2) expression is elevated to mitigate saline/alkaline stress [12]. Our findings align with this, demonstrating a significant increase in tlr2 expression in the gill tissues of M. rosenbergii under NaHCO3 stress. Notably, recent studies on crucian carp (Carassius auratus) and Pacific whiteleg shrimp have also reported marked enrichment of DEGs in the TLR pathway following carbonate/alkaline stress [40,41].
Autophagy is a dynamic and continuous intracellular degradation process used to remove proteins or damaged organelles due to misfolding and is essential for maintaining homeostasis in the intracellular environment [42,43]. Research indicates that under normal conditions, autophagy operates at a basal level to sustain protein and organelle turnover, but its activity significantly increases in response to diverse physiological and pathological stressors [44]. Enhanced autophagy alleviates ammonia-induced oxidative stress, inflammation, and apoptosis in yellow catfish (Pelteobagrus fulvidraco) [45]. In our study, DEGs associated with autophagy—autophagy 3 (atg3), autophagy 7 (atg7), and ras-related protein Rab-1A (rab-1a)—were significantly upregulated in the NaHCO3-exposed group. Autophagy 7 [46] and Rab-1A [47] play a crucial role in stress-induced autophagy. These results were consistent with findings in Chinese mitten crab, where carbonate/alkaline stress triggered upregulated expression of autophagy-related mRNAs in hepatopancreatic tissues [15]. Collectively, these data indicated that M. rosenbergii activated autophagy pathways to combat NaHCO3 stress.
A study has demonstrated that environmental stress significantly increases nitric oxide (NO) levels in M. rosenbergii [48]. In the current study, NaHCO3 stress individuals showed a marked rise in NO content within gill tissues. Meanwhile, we also found a significant increase in alkaline phosphatase (ALP) and acid phosphatase (ACP) levels in the gill tissues of M. rosenbergii under NaHCO3 stress. As critical immune parameters in crustaceans, ACP and ALP reflect the host’s immune status under environmental challenges. For instance, during acute carbonate stress, the mud crab (Scylla paramamosain) upregulates ACP and ALP activities to counteract external pressures [49]. Similarly, Zhang et al. [10] demonstrated that the Chinese mitten crab enhances ACP and ALP activities to adapt to saline/alkaline stress. Collectively, these findings suggested that M. rosenbergii employs an immune strategy by elevating enzymatic activities—including NO, ACP, and ALP—to bolster immunity and mitigate the adverse effects of NaHCO3 stress.
The results of KEGG enrichment analysis showed that DEGs were closely related to immune function, and except for hsp70 and arf6, other DEGs had a positive correlation with immune-related enzymes (ALP and NO). The increase in the contents of ALP and NO is an important sign of the improvement of the body’s immune capacity. These results indicated that the immune-related DEGs and immune enzyme activities of M. rosenbergii work synergistically to cope with NaHCO3 stress, but the specific mechanism by which DEGs interact with ALP and NO still require further research and clarification.

5. Conclusions

Acute NaHCO3 stress induced a reduction in antioxidant enzyme activity and gill tissue damage in M. rosenbergii. In response to the stress caused by NaHCO3, M. rosenbergii activated immune-related enzymes (ALP, ACP, and NO) as well as immune-related DEGs involved in endocytosis, autophagy, and the toll-like receptor signaling pathway (Figure 8). The current study revealed the physiological mechanism by which M. rosenbergii responds to NaHCO3 stress and the damage characteristics it causes. And it provided a crucial scientific basis for utilizing saline/alkaline water resources for shrimp farming, as well as for promoting the ecological restoration and environmental governance of saline/alkaline lands.

Author Contributions

Conceptualization, methodology, H.Y. (Heng Yu) and J.Y.; validation, H.Y. (Huwei Yuan), S.Z. and M.N.; resources, supervision, M.L.; data curation, writing—original draft preparation, H.Y. (Heng Yu); writing—review and editing, H.Y. (Huwei Yuan); visualization, S.Z.; project administration, funding acquisition, J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Key R&D Program of Ningxia Hui Autonomous Region (2025BBF02016) and the Zhejiang Provincial Institute Special Project (2025YSZX01 and 2025YSZX04).

Institutional Review Board Statement

The treatment method of M. rosenbergii strictly followed the Zhejiang Institute of Freshwater Fisheries experimental animal management method (ZJIFF20210302), approval date: 2 March 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data of the present study have been submitted to the NCBI with the accession number PRJNA1337614. All other data are contained within the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Heng, T.; He, X.L.; Yang, L.L.; Xu, X.; Feng, Y. Mechanism of Saline–Alkali land improvement using subsurface pipe and vertical well drainage measures and its response to agricultural soil ecosystem. Environ. Pollut. 2022, 293, 118583. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, B.Q.; Wang, N. Study on the Harm of Saline Alkali Land and Its Improvement Technology in China. IOP Conf. Ser. Earth Environ. Sci. 2021, 692, 042053. [Google Scholar] [CrossRef]
  3. Xu, X.; Guo, L.; Wang, S.B.; Ren, M.; Zhao, P.J.; Huang, Z.Y.; Jia, H.J.; Wang, J.H.; Lin, A.J. Comprehensive evaluation of the risk system for heavy metals in the rehabilitated saline-alkali land. J. Environ. Manag. 2023, 347, 119117. [Google Scholar] [CrossRef]
  4. Zhu, W.; Gu, S.G.; Jiang, R.; Zhang, X.; Hatano, R. Saline–Alkali Soil Reclamation Contributes to Soil Health Improvement in China. Agriculture 2024, 14, 1210. [Google Scholar] [CrossRef]
  5. Amundson, R.; Berhe, A.A.; Hopmans, J.W.; Olson, C.; Sztein, A.E.; Sparks, D.L. Soil and human security in the 21st century. Science 2015, 348, 1261071. [Google Scholar] [CrossRef]
  6. Zhao, Y.; Li, S.S.; Tang, S.J.; Wang, Y.L.; Yao, X.L.; Xie, J.Y.; Zhao, J.L. Effects of chloride, sulfate, and bicarbonate stress on mortality rate, gill tissue morphology, and gene expression in mandarin fish (Siniperca chuatsi). Environ. Sci. Pollut. Res. 2023, 30, 99440–99453. [Google Scholar] [CrossRef]
  7. Chen, Z.Y.; Zhu, S.H.; Feng, B.B.; Zhang, M.; Gong, J.H.; Chen, H.G.; Munganga, B.P.; Tao, X.J.; Feng, J.B. Temporal Transcriptomic Profiling Reveals Dynamic Changes in Gene Expression of Giant Freshwater Prawn upon Acute Saline-Alkaline Stresses. Mar. Biotechnol. 2024, 26, 511–525. [Google Scholar] [CrossRef]
  8. Shang, X.C.; Geng, L.W.; Yang, J.; Zhang, Y.T.; Xu, W. Transcriptome analysis reveals the mechanism of alkalinity exposure on spleen oxidative stress, inflammation and immune function of Luciobarbus capito. Ecotoxicol. Environ. Saf. 2021, 225, 112748. [Google Scholar] [CrossRef]
  9. Jin, S.B.; Xu, M.J.; Gao, X.B.; Jiang, S.F.; Xiong, Y.W.; Zhang, W.Y.; Qiao, H.; Wu, Y.; Fu, H.T. Effects of Alkalinity Exposure on Antioxidant Status, Metabolic Function, and Immune Response in the Hepatopancreas of Macrobrachium nipponense. Antioxidants 2024, 13, 129. [Google Scholar] [CrossRef]
  10. Zhang, R.Q.; Shi, X.; Liu, Z.; Sun, J.; Sun, T.Z.; Lei, M.Q. Histological, physiological and transcriptomic analysis reveal the acute alkalinity stress of the gill and hepatopancreas of Litopenaeus vannamei. Mar. Biotechnol. 2023, 25, 588–602. [Google Scholar] [CrossRef]
  11. Ge, Q.Q.; Wang, J.J.; Li, J.T.; Li, J. Effect of high alkalinity on shrimp gills: Histopathological alternations and cell specific responses. Ecotoxicol. Environ. Saf. 2023, 256, 114902. [Google Scholar] [CrossRef]
  12. Zhang, R.; Zhao, Z.G.; Li, M.S.; Luo, L.; Wang, S.H.; Guo, K.; Xu, W. Metabolomics analysis reveals the response mechanism to carbonate alkalinity toxicity in the gills of Eriocheir sinensis. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2023, 263, 109487. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, M.Y.; Xu, P.; Zhou, J.; Ge, J.C.; Xu, G.C. Characterization of the molecular, cellular, and behavioral changes caused by exposure to a saline-alkali environment in the Chinese mitten crab, Eriocheir sinensis. Environ. Res. 2024, 262, 119956. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, R.Q.; Shi, X.; Guo, J.T.; Mao, X.; Fan, B.Y. Acute stress response in gill of Pacific white shrimp Litopenaeus vannamei to high alkalinity. Aquaculture 2024, 586, 740766. [Google Scholar] [CrossRef]
  15. Wang, J.Y.; Sun, L.J.; Li, X.J.; Tao, S.Q.; Wang, F.; Shi, Y.; Guan, H.K.; Yang, Y.H.; Zhao, Z.G. Alkali exposure induces autophagy through activation of the MAPK pathway by ROS and inhibition of mTOR in Eriocheir sinensis. Aquat. Toxicol. 2023, 258, 106481. [Google Scholar] [CrossRef]
  16. Jin, S.B.; Zhou, R.; Gao, X.B.; Xiong, Y.W.; Zhang, W.Y.; Qiao, H.; Wu, Y.; Jiang, S.F.; Fu, H.T. Identification of the effects of alkalinity exposure on the gills of oriental river prawns, Macrobrachium nipponense. BMC Genom. 2024, 25, 765. [Google Scholar] [CrossRef]
  17. Zhang, X.; Zou, S.B.; Gao, Q.; Zhou, D.; Ni, M.; Zhang, M.L.; Cai, K.J.; Yuan, J.L. Effects of saline-alkali stress on the survival, enzyme activity and transcriptional expression of Macrobrachium rosenbergii. J. Fish. Chin. 2024, 31, 883–896. [Google Scholar]
  18. Chen, S.F.; Zhou, Y.Q.; Chen, Y.R.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
  19. Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357. [Google Scholar] [CrossRef]
  20. Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef]
  21. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
  22. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  23. Kågedal, K.; Johansson, U.; Öllinger, K. The lysosomal protease cathepsin D mediates apoptosis induced by oxidative stress. FASEB J. 2001, 15, 1592–1594. [Google Scholar] [CrossRef] [PubMed]
  24. Johansson, A.C.; Steen, H.; Öllinger, K.; Roberg, K. Cathepsin D mediates cytochrome c release and caspase activation in human fibroblast apoptosis induced by staurosporine. Cell Death Differ. 2003, 10, 1253–1259. [Google Scholar] [CrossRef]
  25. Xiao, M.; Nan, Y.X.; Yang, Y.K.; Li, H.; Duan, Y.F. Changes in physiological homeostasis in the gills of Litopenaeus vannamei under carbonate alkalinity stress and recovery conditions. Fishes 2024, 9, 463. [Google Scholar] [CrossRef]
  26. Zhai, C.H.; Liu, X.F.; Li, Y.T.; Wang, R.Y.; Lv, W.H.; Ma, B.; Cao, D.C.; Zhang, Y. Effects of Alkalinity Stress on Amino Acid Metabolism Profiles and Oxidative-Stress-Mediated Apoptosis/Ferroptosis in Hybrid Sturgeon (Huso dauricus♀ × Acipenser schrenckii♂) Livers. Int. J. Mol. Sci. 2024, 25, 10456. [Google Scholar] [CrossRef]
  27. Pan, L.; Zhang, H. Metallothionein, antioxidant enzymes and dnastrand breaks as biomarkers of cd exposure in a marine crab, Charybdis japonica. Comp. Biochem. Phys. C 2006, 144, 67–75. [Google Scholar] [CrossRef]
  28. Paital, B.; Chainy, G. Antioxidant defenses and oxidative stress parameters in tissues of mud crab (Scylla serrata) with reference to changing salinity. Comp. Biochem. Phys. C 2009, 151, 142–151. [Google Scholar] [CrossRef]
  29. Pillet, M.; Dupont-Prinet, A.; Chabot, D.; Tremblay, R.; Audet, C. Effects of exposure to hypoxia on metabolic pathways in northern shrimp (Pandalus borealis) and Greenland halibut (Reinhardtius hippoglossoides). J. Exp. Mar. Biol. Ecol. 2016, 483, 88–96. [Google Scholar] [CrossRef]
  30. Kannan, K.; Jain, S.K. Oxidative stress and apoptosis. Pathophysiology 2000, 7, 153–163. [Google Scholar] [CrossRef]
  31. Luzio, A.; Monteiro, S.M.; Fontaínhas-Fernandes, A.A.; Pinto-Carnide, O.; Matos, M.; Coimbra, A.M. Copper induced upregulation of apoptosis related genes in zebrafish (Danio rerio) gill. Aquat. Toxicol. 2013, 128, 183–189. [Google Scholar] [CrossRef]
  32. Shang, X.C.; Geng, L.W.; Wei, H.J.; Liu, T.Q.; Che, X.H.; Li, W.; Liu, Y.H.; Shi, X.D.; Li, J.H.; Teng, X.H.; et al. Analysis revealed the molecular mechanism of oxidative stress-autophagy-induced liver injury caused by high alkalinity: Integrated whole hepatic transcriptome and metabolome. Front. Immunol. 2024, 15, 1431224. [Google Scholar] [CrossRef]
  33. Wu, J.Y.; Kuo, C.C. Pivotal role of ADP-ribosylation factor 6 in Toll-like receptor 9-mediated immune signaling. J. Biol. Chem. 2012, 287, 4323–4334. [Google Scholar] [CrossRef] [PubMed]
  34. Fernández-Boo, S.; Machado, A.; Castro, L.F.C.; Azeredo, R.; Costas, B. Unravelling the main immune repertoire of Paracentrotus lividus following Vibrio anguillarum bath challenge. Fish Shellfish Immunol. 2024, 147, 109431. [Google Scholar] [CrossRef] [PubMed]
  35. Li, Z.; Wang, J.; He, Y.; Hu, S.; Wang, Q.; Li, J. Comprehensive identification and profiling of Chinese shrimp (Fenneropenaeus chinensis) microRNAs in response to high pH stress using Hiseq2000 sequencing. Aquacult. Res. 2019, 50, 3154–3162. [Google Scholar] [CrossRef]
  36. Taghavizadeh, Y.M.E.; Amiri, M.S.; Nourbakhsh, F.; Rahnama, M.; Forouzanfar, F.; Mousavi, S.H. Bio-indicators in cadmium toxicity: Role of HSP27 and HSP70. Res. Environ. Sci. Pollut. Res. Int. 2021, 28, 26359–26379. [Google Scholar] [CrossRef]
  37. Zatsepina, O.G.; Evgen’Ev, M.B.; Garbuz, D.G. Role of a heat shock transcription factor and the Major Heat shock protein Hsp70 in memory formation and Neuroprotection. Cells 2021, 10, 1638. [Google Scholar] [CrossRef]
  38. Liu, S.; Guo, Y.; He, Q.; Shi, M.; Yang, X. You Toll protein family structure, evolution and response of the whiteleg shrimp (Litopenaeus vannamei) to exogenous iridescent virus. J. Fish Dis. 2021, 44, 1131–1145. [Google Scholar] [CrossRef]
  39. Cai, X.; Lymbery, A.J.; Armstrong, N.J.; Gao, C.; Ma, L.; Li, C. Systematic identification and characterization of lncRNAs and lncRNA-miRNA-mRNA networks in the liver of turbot (Scophthalmus maximus L.) induced with Vibrio anguillarum. Fish Shellfish Immunol. 2022, 131, 21–29. [Google Scholar] [CrossRef]
  40. Han, S.C.; Han, L.; Yuan, F.Y.; Liu, W.Z.; Wang, J.; Jin, X.F.; Sun, Y.C. Exploring Disparities in Gill Physiological Responses to NaHCO3-Induced Habitat Stress in Triploid and Diploid Crucian Carp (Carassius auratus): A Comprehensive Investigation Through Multi-Omics and Biochemical Analyses. Metabolites 2024, 15, 5. [Google Scholar] [CrossRef]
  41. Shi, X.; Zhang, R.Q.; Liu, Z.; Mao, X.; Fan, B.Y.; Guo, J.T. Specific expression profiles of lncRNAs in cis-regulatory responses to gill in Litopenaeus vannamei under high alkalinity. Int. J. Biol. Macromol. 2025, 305, 141272. [Google Scholar] [CrossRef]
  42. Yu, L.; Chen, Y.; Tooz, S.A. Autophagy pathway: Cellular and molecular mechanisms. Autophagy 2017, 14, 207–215. [Google Scholar] [CrossRef] [PubMed]
  43. Mizushima, N. A brief history of autophagy from cell biology to physiology and disease. Nat. Cell. Biol. 2018, 20, 521–527. [Google Scholar] [CrossRef] [PubMed]
  44. Singh, R.; Cuervo, A. Autophagy in the cellular energetic balance. Cell Metab. 2011, 13, 495–504. [Google Scholar] [CrossRef] [PubMed]
  45. Li, X.; Wang, S.D.; Zhang, M.Z.; Li, M. Enhancement of autophagy can alleviate oxidative stress, inflammation, and apoptosis induced by ammonia stress in yellow catfish Pelteobagrus fulvidraco. Fish Shellfish Immunol. 2024, 149, 109582. [Google Scholar] [CrossRef]
  46. Hars, E.S.; Qi, H.; Jin, S.V.; Cai, L.; Hu, C.; Liu, L.F. Autophagy Regulates Ageing in C. elegans. Autophagy 2006, 3, 93–95. [Google Scholar] [CrossRef]
  47. Gyurkovska, V.; Murtazina, R.; Zhao, S.F.; Shikano, S.; Okamoto, Y.; Segev, N. Dual function of Rab1A in secretion and autophagy: Hypervariable domain dependence. Life Sci. Alliance 2023, 6, e202201810. [Google Scholar] [CrossRef]
  48. Kaleo, I.V.; Gao, Q.; Liu, B.; Sun, C.X.; Zhou, Q.L.; Zhang, H.M.; Shan, F.; Xiong, Z.; Liu, B.; Song, C.Y. Effects of Moringa oleifera leaf extract on growth performance, physiological and immune response, and related immune gene expression of Macrobrachium rosenbergii with vibrio anguillarum and ammonia stress. Fish Shellfish Immunol. 2019, 89, 603–613. [Google Scholar] [CrossRef]
  49. Li, Y.T.; Gao, S.; Qin, K.X.; Che, C.X.; Yang, P.; Fan, Z.W.; Li, W.J.; Wang, C.L.; Mu, C.K.; Wang, H. Effects of bicarbonate on osmotic regulation, immunity, and antioxidant capacity in mud crab (Scylla paramamosain) based on transcriptomic analysis. Aquacult. Rep. 2024, 39, 102517. [Google Scholar] [CrossRef]
Figure 1. (AD) The mortality rates of M. rosenbergii at different concentrations of NaHCO3 at 24 h, 48 h, 72 h, and 96 h, respectively.
Figure 1. (AD) The mortality rates of M. rosenbergii at different concentrations of NaHCO3 at 24 h, 48 h, 72 h, and 96 h, respectively.
Antioxidants 14 01266 g001
Figure 2. The contents of (A) superoxide dismutase (SOD), (B) anti-superoxide anion free radical (ASAFR), (C) glutathione peroxidase (GSH-Px), (D) catalase (CAT), (E) total antioxidant capacity (T-AOC), (F) glutathione s-transferase (GST), (G) alkaline phosphatase (ALP), (H) acid phosphatase (ACP), (I) nitric oxide synthase (T-NOS), and (J) nitric oxide (NO) in the gill tissues of M. rosenbergii in the control group and the NaHCO3 group. CG, the gill tissues of the control group of M. rosenbergii; EG, the gill tissues of the experimental group (NaHCO3-exposed group) of M. rosenbergii. The asterisk (*) indicates a significant difference between the two groups.
Figure 2. The contents of (A) superoxide dismutase (SOD), (B) anti-superoxide anion free radical (ASAFR), (C) glutathione peroxidase (GSH-Px), (D) catalase (CAT), (E) total antioxidant capacity (T-AOC), (F) glutathione s-transferase (GST), (G) alkaline phosphatase (ALP), (H) acid phosphatase (ACP), (I) nitric oxide synthase (T-NOS), and (J) nitric oxide (NO) in the gill tissues of M. rosenbergii in the control group and the NaHCO3 group. CG, the gill tissues of the control group of M. rosenbergii; EG, the gill tissues of the experimental group (NaHCO3-exposed group) of M. rosenbergii. The asterisk (*) indicates a significant difference between the two groups.
Antioxidants 14 01266 g002
Figure 3. The analysis of gill tissues in M. rosenbergii (H&E staining): (A,B) the control group showing intact tissue architecture; (C,D) the NaHCO3-exposed group caused tissue damage. Magnification: (A,C) 40×; (B,D) 200×.
Figure 3. The analysis of gill tissues in M. rosenbergii (H&E staining): (A,B) the control group showing intact tissue architecture; (C,D) the NaHCO3-exposed group caused tissue damage. Magnification: (A,C) 40×; (B,D) 200×.
Antioxidants 14 01266 g003
Figure 4. The analysis of gill tissues in M. rosenbergii (ultrastructure observation): (A,B) the control group showing intact tissue architecture; (C,D) the NaHCO3-exposed group caused tissue damage. (A,C) bar = 5 μm; (B,D) bar = 2 μm.
Figure 4. The analysis of gill tissues in M. rosenbergii (ultrastructure observation): (A,B) the control group showing intact tissue architecture; (C,D) the NaHCO3-exposed group caused tissue damage. (A,C) bar = 5 μm; (B,D) bar = 2 μm.
Antioxidants 14 01266 g004
Figure 5. The PCA diagram shows the distribution of data in the principal component space (A); the bubble map shows the upregulated and downregulated DEGs (B); total DEGs in the gills of M. rosenbergii in the NaHCO3-exposed group compared to the control group (C); the KEGG enrichment analysis results show that some immune-related signaling pathways were involved (D).
Figure 5. The PCA diagram shows the distribution of data in the principal component space (A); the bubble map shows the upregulated and downregulated DEGs (B); total DEGs in the gills of M. rosenbergii in the NaHCO3-exposed group compared to the control group (C); the KEGG enrichment analysis results show that some immune-related signaling pathways were involved (D).
Antioxidants 14 01266 g005
Figure 6. The visualization heat maps of samples and DEGs in RNA-seq and qPCR results; each column in the figure represents a sample and each row represents a gene, and the levels of DEGs in different samples are indicated by different colors (A,B). CG, the gill tissues of the control group of M. rosenbergii; EG, the gill tissues of the experimental group (NaHCO3-exposed group) of M. rosenbergii. The qPCR results verified the validity of the transcriptome results (C). ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), NF-kappa B inhibitor alpha (iκbα), heat shock protein 70 (hsp70), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), ras-related protein Rab-1A (rab-1a).
Figure 6. The visualization heat maps of samples and DEGs in RNA-seq and qPCR results; each column in the figure represents a sample and each row represents a gene, and the levels of DEGs in different samples are indicated by different colors (A,B). CG, the gill tissues of the control group of M. rosenbergii; EG, the gill tissues of the experimental group (NaHCO3-exposed group) of M. rosenbergii. The qPCR results verified the validity of the transcriptome results (C). ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), NF-kappa B inhibitor alpha (iκbα), heat shock protein 70 (hsp70), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), ras-related protein Rab-1A (rab-1a).
Antioxidants 14 01266 g006aAntioxidants 14 01266 g006b
Figure 7. The correlation analysis between DEGs and among DEGs, as well as between DEGs and immune-related enzymes, is shown in (A) and (B), respectively. Cathepsin D, cytochrome c, ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), heat shock protein 70 (hsp70), NF-kappa B inhibitor alpha (iκbα), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), ras-related protein Rab-1A (rab-1a). Alkaline phosphatase (ALP), acid phosphatase (ACP), nitric oxide (NO).
Figure 7. The correlation analysis between DEGs and among DEGs, as well as between DEGs and immune-related enzymes, is shown in (A) and (B), respectively. Cathepsin D, cytochrome c, ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), heat shock protein 70 (hsp70), NF-kappa B inhibitor alpha (iκbα), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), ras-related protein Rab-1A (rab-1a). Alkaline phosphatase (ALP), acid phosphatase (ACP), nitric oxide (NO).
Antioxidants 14 01266 g007
Figure 8. The gill tissue damage and the potential molecular response mechanisms in the gills of M. rosenbergii under NaHCO3 stress.
Figure 8. The gill tissue damage and the potential molecular response mechanisms in the gills of M. rosenbergii under NaHCO3 stress.
Antioxidants 14 01266 g008
Table 1. Primer sequences for qPCR.
Table 1. Primer sequences for qPCR.
Gene Name SequenceEfficiency (%)Product Size (bp)Tm
(°C)
Accession
Number
beta-actinFTCCGTAAGGACCTGTATGCC109.419856.70 
RTCGGGAGGTGCGATGATTTT56.79
cathepsin DFCTGAGGATGAAGGTGTTGAT104.523151.48AMQ98967.1
RCTGAGGAGGAGTGCCAAT54.28
cytochrome cFACAGATGCTAACAAGTCCAA107.915550.69XP_063881551.1
RTCCTCAAGGTAGGCTATCAA51.90
arf4FGTCTTGATGCTGCTGGTA103.411651.79XP_064122923.1
RGCTGATGTTCTTGTATTCCA49.32
arf6FACGAAGCAAGGCAAGAAT109.819851.60KAK7082885.1
RATAGTCCATCACCTGTTGTT50.21
hsp70FAGCAGACTCAGACATTCAC108.519951.53AAS45710.1
RGACACATTCAGGATACCATTG50.52
iκbαFACCTCACTAACGCTACGA98.425252.38AET34918.1
RACACTGCCAGATGTAACG52.02
tlr2FCAACGGCAATCCTGACTT91.521952.65XP_064078749.1
RCGACGAATCACATTAGAAGAG50.18
atg3FACGATGATGATGACGATGA9325950.11QCX35196.1
RGAGAGTGGCTGACGATTC52.84
atg7FGTCATCGTCCTGGTCTTG108.111852.81QEG53818.1
RGGCATTCCACAACTGAGA52.05
rab-1aFGCTCACGGCATCATAGTT102.817952.18XP_064110114.1
RGCATATTCCTTGGCTGTCT52.04
Note: ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), NF-kappa B inhibitor alpha (iκbα), heat shock protein 70 (hsp70), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), ras-related protein Rab-1A (rab-1a).
Table 2. Quality assessment of transcriptome library sequencing.
Table 2. Quality assessment of transcriptome library sequencing.
SampleRaw DataClean Data (%)Adapter (%)Low Quality (%)Poly A (%)
CG-141,185,60241,064,878 (99.71%)6832 (0.02%)113,234 (0.27%)0 (0.00%)
CG-242,137,95442,002,718 (99.68%)39,714 (0.09%)95,212 (0.23%)0 (0.00%)
CG-341,255,78041,122,472 (99.68%)11,752 (0.03%)121,042 (0.29%)0 (0.00%)
EG-136,415,09636,303,148 (99.69%)5332 (0.01%)106,368 (0.29%)0 (0.00%)
EG-245,237,47445,092,932 (99.68%)9120 (0.02%)133,298 (0.29%)0 (0.00%)
EG-343,778,56443,593,874 (99.58%)50,534 (0.12%)134,156 (0.31%)0 (0.00%)
Note: Raw Data, number of raw reads; Clean Data, number and percentage of high-quality reads (based on raw reads); Adapter, number of reads containing adapter and percentage (based on raw reads); Low Quality, low-quality reads, that is, the number and percentage (based on raw reads) of reads with more than 50% base mass value Q ≤ 20 in single-ended read; Poly A, number and percentage of poly A reads (based on raw reads). CG, the gill tissues of the control group of M. rosenbergii; EG, the gill tissues of the experimental group (NaHCO3-exposed group) of M. rosenbergii.
Table 3. Mapping statistics against reference genome.
Table 3. Mapping statistics against reference genome.
SampleTotalUnmapped (%)Unique Mapped (%)Multiple Mapped (%)Total Mapped (%)
CG-136,311,9244,120,293 (11.35%)30,596,384 (84.26%)1,595,247 (4.39%)32,191,631 (88.65%)
CG-232,383,1022,663,419 (8.22%)27,698,895 (85.54%)2,020,788 (6.24%)29,719,683 (91.78%)
CG-337,078,6724,267,183 (11.51%)31,489,881 (84.93%)1,321,608 (3.56%)32,811,489 (88.49%)
EG-132,991,9622,993,126 (9.07%)28,867,018 (87.50%)1,131,818 (3.43%)29,998,836 (90.93%)
EG-240,401,4223,395,288 (8.40%)35,561,175 (88.02%)1,444,959 (3.58%)37,006,134 (91.60%)
EG-338,749,5903,022,772 (7.80%)34,284,339 (88.48%)1,442,479 (3.72%)35,726,818 (92.20%)
Note: Unmapped (%), number and percentage of reads not aligned to the reference genome; Unique Mapped (%), number and percentage of reads uniquely aligned to the reference genome; Multiple Mapped (%), number and percentage of reads aligned to multiple locations in the reference genome; Total Mapped (%), number and percentage of all reads successfully aligned to the reference genome. CG, the gill tissues of the control group of M. rosenbergii; EG, the gill tissues of the experimental group (NaHCO3-exposed group) of M. rosenbergii.
Table 4. Information statistics of immune-related DEGs in the gills of M. rosenbergii in the NaHCO3-exposed group compared to the control group.
Table 4. Information statistics of immune-related DEGs in the gills of M. rosenbergii in the NaHCO3-exposed group compared to the control group.
DEGsSignaling Pathway Name|log2FC|q Value
cathepsin DApoptosis2.2130.000
cytochrome c 2.1740.000
arf4Endocytosis1.1610.004
arf6 1.6500.000
hsp70 1.0930.003
iκbαToll-like receptor signaling pathway2.1770.000
tlr2 1.2760.034
atg3Autophagy1.7380.008
atg7 1.1310.033
rab-1a 1.0430.002
Note: ADP-ribosylation factor 4 (arf4), ADP-ribosylation factor 6 (arf6), NF-kappa B inhibitor alpha (iκbα), heat shock protein 70 (hsp70), toll-like receptor 2 (tlr2), autophagy 3 (atg3), autophagy 7 (atg7), ras-related protein Rab-1A (rab-1a).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, H.; Zou, S.; Yuan, H.; Liu, M.; Ni, M.; Yuan, J. Physiology and Molecular Response Mechanisms in the Gills of Macrobrachium rosenbergii Under Acute NaHCO3 Alkaline Stress. Antioxidants 2025, 14, 1266. https://doi.org/10.3390/antiox14101266

AMA Style

Yu H, Zou S, Yuan H, Liu M, Ni M, Yuan J. Physiology and Molecular Response Mechanisms in the Gills of Macrobrachium rosenbergii Under Acute NaHCO3 Alkaline Stress. Antioxidants. 2025; 14(10):1266. https://doi.org/10.3390/antiox14101266

Chicago/Turabian Style

Yu, Heng, Songbao Zou, Huwei Yuan, Mei Liu, Meng Ni, and Julin Yuan. 2025. "Physiology and Molecular Response Mechanisms in the Gills of Macrobrachium rosenbergii Under Acute NaHCO3 Alkaline Stress" Antioxidants 14, no. 10: 1266. https://doi.org/10.3390/antiox14101266

APA Style

Yu, H., Zou, S., Yuan, H., Liu, M., Ni, M., & Yuan, J. (2025). Physiology and Molecular Response Mechanisms in the Gills of Macrobrachium rosenbergii Under Acute NaHCO3 Alkaline Stress. Antioxidants, 14(10), 1266. https://doi.org/10.3390/antiox14101266

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop