Next Article in Journal
Effects of Lysolecithin on Growth Performance, Antioxidant Capacity, and Lipid Metabolism of Litopenaeus vannamei
Previous Article in Journal
The Flavonoid Extract of Polygonum viviparum L. Alleviates Dextran Sulfate Sodium-Induced Ulcerative Colitis by Regulating Intestinal Flora Homeostasis and Uric Acid Levels Through Inhibition of PI3K/AKT/NF-κB/IL-17 Signaling Pathway
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Schizochytrium Supplementation in Compound Feed: Effects on Growth, Metamorphosis, Intermediate Metabolism, and Intestinal Health of Bullfrogs (Lithobates catesbeianus)

1
College of Marine Sciences, South China Agricultural University, Guangzhou 510642, China
2
Zhongshan Innovation Center, South China Agricultural University, Zhongshan 528400, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Antioxidants 2025, 14(10), 1208; https://doi.org/10.3390/antiox14101208
Submission received: 27 August 2025 / Revised: 1 October 2025 / Accepted: 3 October 2025 / Published: 5 October 2025

Abstract

Schizochytrium is often added to feed to enhance the growth and health of farmed animals, yet research on its effects on amphibians remains relatively scarce. Here, this study investigated the effects of dietary Schizochytrium meal on growth, metamorphosis, intermediate metabolism, and intestinal health of bullfrogs. Six compound feeds (S0–S5) containing different gradients of Schizochytrium meal (0.00, 2.00, 5.00, 10.00, 15.00, and 20.00 g/kg diets) were formulated. After 90 days, the S4 group (15.00 g/kg) exhibited significantly superior growth performance, with the weight gain rate (WGR) increasing by up to 23.78% compared to the control (S0). Metamorphosis rate (MR) peaked at 23.33% in the S4 group. The enzyme activities of digestion (amylase (AMS), lipase (LPS), protease), brush border membrane (Na+, K+-ATPase, alkaline phosphatase (AKP), γ-glutamyl transferase (γ-GT), creatine kinase (CK), and antioxidation (superoxide dismutase (SOD), catalase (CAT)), as well as microvilli length and mucosal epithelial cell height in the intestine were the highest in the S4 group. Intestinal microbial diversity (Ace index) significantly increased by 41.28% in the S4 group, which also promoted beneficial bacteria. Key genes related to the GH-IGF-1 axis, metabolism, and intestinal barrier function were significantly upregulated with increasing Schizochytrium levels up to 15.00 g/kg, whereas pro-inflammatory genes showed an opposite trend. Overall, dietary supplementation with Schizochytrium meal at 15.00 g/kg promotes growth, metamorphosis, and intestinal health in bullfrog tadpoles by modulating the GH-IGF-1 axis, enhancing digestion and absorption, and improving intestinal integrity. Optimal Schizochytrium meal levels were identified as 13.27 g/kg.

1. Introduction

With the increasing demand of consumers for healthy white meat products, bullfrog (Lithobates catesbeianus) farming has great market potential. A critical stage in bullfrog production is tadpole rearing, as it directly influences the health and growth performance of subsequent juvenile frogs [1]. This phase is characterized by metamorphosis, a complex developmental process involving the transformation of aquatic tadpoles into amphibious frogs, marked by fundamental remodeling of tissues and organs such as the development of limbs and lungs [2,3,4]. Therefore, the efficiency of this metamorphic process is a key determinant of overall breeding success, highlighting the need for nutritional strategies to support tadpole development.
Food nutrition is a key factor to guarantee high breeding efficiency of farmed animals. The marine microalgae Schizochytrium has emerged as a promising aquafeed ingredient, renowned for its high content of polyunsaturated fatty acids (PUFAs), particularly docosahexaenoic acid (DHA) [5]. This microalga is commonly used as a live food source for the larval and juvenile stages of aquatic animals due to its high nutritional value and suitable cell size [6]. Its nutritional value has been well-documented in various fish species, where dietary supplementation has been shown to improve growth performance, feed utilization, stress tolerance, and disease resistance [7,8]. Specifically, dietary supplementation with Schizochytrium significantly reduced the feed conversion ratio to 1.20% in golden pompano (Trachinotus ovatus) and zebrafish (Danio rerio), while also improving non-specific immunity and increasing the abundance of beneficial intestinal bacteria [9,10]. In Nile tilapia (Oreochromis niloticus), Schizochytrium completely replaced fish oil in feed, enhancing weight gain, feed efficiency, protein efficiency, and optimizing the DHA:EPA ratio in filets, demonstrating that Schizochytrium modulates growth performance and fatty acid metabolism in aquatic species [11]. Furthermore, Schizochytrium upregulates the expression of antioxidant and immune-related genes in rainbow trout (Oncorhynchus mykiss) [12]. However, the existing body of evidence is predominantly derived from fish, and direct evidence for its application in amphibians is currently lacking.
The role of DHA in amphibian development, particularly during the critical window of metamorphosis, warrants greater attention. As in other vertebrates, DHA is recognized for its crucial role in neural development and visual function in amphibians [13,14,15]. Adequate lipid nutrition, including a balanced provision of essential fatty acids, is vital to support the extensive tissue remodeling and high energy demands characteristic of metamorphosis [16], but the specific requirements and optimal levels of fatty acids for amphibians are not well-defined. Most existing inferences are drawn from fish or general vertebrate models [17].
Beyond systemic growth, intestinal health is paramount for nutrient acquisition and overall development. A well-functioning intestine, supported by a balanced interaction between the gut microbiota, epithelial barrier, and immune system, is essential for efficient digestion and absorption [18,19,20,21]. In addition, the enzyme activity in the intestine is the reliable indicator for evaluating intestinal absorption and digestion capacity, due to the fact that these enzymes affect the ability of animals to obtain and utilize nutrients in food [22,23]. While the positive impacts of Schizochytrium on intestinal health have been observed in fish, its influence on the gut function of amphibian tadpoles, particularly during the metabolically demanding period of metamorphosis, remains uninvestigated.
To address these research gaps, the present study was designed to systematically evaluate the effects of dietary Schizochytrium meal supplementation on growth, metamorphosis, intermediary metabolism, and intestinal health in bullfrog tadpoles over a 90-day feeding trial. We hypothesized that dietary Schizochytrium meals would promote tadpole growth and metamorphosis by enhancing digestive function, modulating key metabolic pathways, and improving intestinal health. The findings are expected to provide novel insights into the application of Schizochytrium in amphibian aquaculture and contribute to developing effective nutritional strategies for improving bullfrog breeding efficiency.

2. Materials and Methods

2.1. Ethics Statement

The Animal Care and Use Committee in South China Agricultural University have approved the present study (Permit No.: 2017D006).

2.2. Diets, Bullfrog, and Sampling

Schizochytrium meal was obtained from Guanxing Agricultural Technology Co., Ltd. (Guangzhou, China). Graded doses of Schizochytrium meal (0, 2.00, 5.00, 10.00, 15.00, and 20.00 g/kg) were added to the basal diet (Table 1). Schizochytrium meal doses were selected according to the research on Ictalurus punctatus and Lateolabrax maculatus [24,25]. The diets were made by a granulation machine (Beijing Modern Yanggong Machinery Sand Development Co., Ltd., Beijing, China).
Bullfrog tadpoles were obtained from Guanxing Agricultural Technology Co., Ltd. (Guangzhou, China). A total of 720 tadpoles (0.04 ± 0.00 g) were dispersed into 18 indoor tanks (40 L) with equal individuals (40/tank). Temperature, dissolved oxygen, pH, and ammonia–nitrogen were monitored daily and maintained within optimal ranges for bullfrog tadpole farming [26]. Six compound feeds (S0–S5) were fed to tadpoles four times a day (08:30, 12:00, 17:30, and 22:00). After 90 days, total number, weight, and body length of bullfrogs in each tank were recorded for the analysis of weight gain rate, specific growth rate, and condition factor. Number of tadpoles with hind limb buds was recorded for the analysis of post-premetamorphosis rate (PPR) and metamorphosis rate (MMR). A total of 10 tadpoles from each tank were sampled for the analysis of proximate composition. Four tadpoles per tank were anesthetized via MS-222 at 100 mg/L, and brain, liver, and intestine samples were obtained for PCR and biochemical analysis. In addition, four tadpoles from each tank were anesthetized to collect intestine samples for the analysis of intestinal microbiota and hematoxylin–eosin (HE) staining.

2.3. Analytic Procedures

2.3.1. Analysis of Proximate Composition and Intestinal Histomorphometry

The proximate composition of compound feeds and tadpoles were determined by AOAC protocols [15]. Intestinal HE staining was carried out via the methods of Xu et al. [16]. In short, middle intestine samples were sectioned using a slicing machine (RD-2230, Shenyang Roundfin Technology, Co., Ltd., Shenyang, China) and were then stained by hematoxylin and eosin (HE) staining kit (NO. S20202-2×100, Shanghai Shangbao Biotechnology Co., Ltd., Shanghai, China). The images were obtained via a light-polarizing microscope (BX53P, Olympus, Tokyo, Japan).

2.3.2. Analysis of Intestinal Biochemical Indicators and Microbiota

Intestinal amylase (AMS, C016-1-1), lipase (LPS, A054-2-1), protease (A080-1-1), Na+, K+-ATPase (A070-2), alkaline phosphatase (AKP, A059-2), γ-glutamyl transferase (γ-GT, C017-2-1), creatine kinase (CK, A032-1-1), superoxide dismutase (SOD, A001-3), catalase (CAT, A007-1-1), total antioxidant capacity (T-AOC, A015-3-1), and malondialdehyde (MDA, A003-1) were detected using commercial kits (Jiancheng Biotech, Co., Ltd., Nanjing, China).
Bacterial DNA was extracted from intestine via the QiAamp DNA stool Mini Kit (Qiagen, Dusseldorf, NRW, Germany). DNA quality and concentration were assessed with a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The V3-V4 regions of the bacterial 16S rRNA gene were amplified using primers 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). PCR was performed with denaturation at 94 °C for 2 min, followed by 30 cycles (98 °C for 10 s, 55 °C for 30 s, 68 °C for 30 s) and a final extension at 68 °C for 5 min. Purified amplicons were sequenced using a 2 × 300 bp paired-end format on the Illumina MiSeq platform (Illumina, San Diego, CA, USA). The sequence data have been deposited at NCBI GenBank database under accession number PRJNA1335207.
The qualified raw sequence data was split based on barcodes and the primer and adapter sequences were removed using the cutadapt plugin in QIIME2 (version 2024). Paired-end reads were merged based on their overlap relationship to obtain optimized data after quality control. Chimera sequences were removed and clustered into amplicon sequence variants (ASVs) using DADA2 (version 2024). A total of 1,286,881 raw sequences were obtained from bacterial samples, and subsequent processing of high-quality reads identified 2491 bacterial ASVs. Species annotation was performed using the classifier-sklearn plugin with the Silva-138 reference database (https://www.arb-silva.de/, accessed on 15 August 2025). Community structure at both the phylum and genus levels was analyzed using Python software (version 2.7). Alpha diversity indices were calculated using QIIME2. Beta diversity was analyzed with principal coordinate analysis (PCoA) and non-metric multidimensional scaling (NMDS) based on Bray–Curtis dissimilarity using Vegan package (version 2.5-3), with significance tested through permutation multivariate analysis of variance (Adonis).

2.3.3. Analysis of Polymerase Chain Reaction (PCR)

PCR analysis was also performed following the methods previously described by Xu et al. [16]. Briefly, total RNA was extracted from brain, liver, and intestine samples by Total RNA Isolation Kit (Vazyme Biotech Co., Ltd., Nanjing, China). The cDNA was synthesized using the HiScript IV 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) and T100 thermal cycler (Bio-rad, Hercules, CA, USA). RT-qPCR assays were carried out on a CFX Duet RT-PCR System (Bio-rad, Hercules, CA, USA) using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). The primers of the target genes are presented in Table 2. β-actin was used as the internal reference gene, and the relative expression levels of the target gene were determined using the 2−ΔΔCT method [27].

2.4. Statistical Analysis

All statistical analyses were performed through SPSS program (version 22.0). The normality of the data was confirmed using the Shapiro–Wilk test, and the homogeneity of variances was confirmed using Levene’s test. One-way ANOVA (SPSS program version 22.0) followed by Tukey’s multiple comparison test was used to identify differences among all experimental groups. Data are presented as mean ± standard error (mean ± S.E.M) of the mean, and p < 0.05 is significantly different.

3. Results

3.1. Growth Performance, Feed Utilization, and Metamorphosis Rate

The condition factor, whole-body moisture, and ash contents showed no significant differences (p > 0.05) among all groups (Table 3). Final weight, weight gain rate (WGR) (Figure 1), specific growth rate (SGR), feed intake (FI), PPR, and MR increased significantly (p < 0.05) as the Schizochytrium levels increased to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels. Feed conversion ratio (FCR) declined obviously (p < 0.05) as Schizochytrium levels increased to 15.00 g/kg diet but increased with further increasing Schizochytrium levels. The highest contents of whole-body crude protein and lipids were observed in diets S5 and S3, respectively. Based on the quadratic regression analysis of SGR against Schizochytrium levels, optimal Schizochytrium levels for bullfrog tadpoles were estimated to be 13.27 g/kg diet (Figure 2).

3.2. Intestinal Biochemical Indicators and Histomorphometry

Total antioxidant capacity showed no significant differences (p > 0.05) among all groups (Table 4). The activities of AMS, LPS, PES, Na+, K+-ATPase, AKP, γ-GT, CK, SOD, and CAT, as well as microvilli length and mucosal epithelial cell height in the intestine increased obviously (p < 0.05) as the Schizochytrium levels increased to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels. Malondialdehyde contents and connective tissue thickness in the intestine declined obviously (p < 0.05) as Schizochytrium levels increased to 15.00 g/kg diet but increased with further increasing Schizochytrium levels (Figure 3).

3.3. Analyses of Intestinal Microbiota

Diversity analysis indicated that both α-diversity and β-diversity were higher in the S4 group. The values of Shannon, Simpson, Shannoneven, Simpsoneven, and phylogenetic diversity showed no significant differences (p > 0.05) among all groups (Table 5 and Figure 4). The values of ASV, Ace, and Chao1 increased obviously (p < 0.05) as the Schizochytrium levels raised to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels.
Intestinal bacterial composition at the phylum, genus, and species levels is presented in Figure 5. On the phyla level (Figure 5A), Fusobacteriota, Firmicutes, Verrucomicrobiota, and Bacteroidota in tadpoles fed diets with Schizochytrium were all more abundant than those of the S0 group, but the opposite trend was found in Proteobacteria, Actinobacteriota, Chloroflexi, Patescibacteria, Planctomycetota, and Bdellovibrionota. The abundances of Firmicutes increased as the Schizochytrium levels increased to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels. Meanwhile, fish fed the S4 diet have the highest values of Verrucomicrobiota.
On the genus level (Figure 5B), the abundances of Cetobacterium, Anaerorhabdus furcosa, Epulopiscium, and Clostridium sensu stricto 1 in tadpoles fed diets with Schizochytrium were higher than those of the S0 group, but the opposite trend was found in Legionella. As for the supplementation of Schizochytrium, the abundances of Anaerorhabdus furcosa and Clostridium sensu stricto 1 increased with the increasing levels up to 15.00 g/kg. The lowest values of Hyphomicrobium were seen in the S4 group.
On the species level (Figure 5C,D), the abundances of Clostridium magunm, Tsukubamonas globosa, Candidatus Protochlamydia naegleriophila, Thermooactinomyces vulgaris, Trachydiscus minutus, and Chelatococcus asaccharovorans of the S0 group were relatively higher than those of Schizochytrium treatments, but the opposite trend was found in Akkermansia glycanispila, Clostridium butyricum, Cetobacterium somerae, Niameybacter massiliensis, Anaerorhabdus furcosa, and Dietzia timorensis. As for the supplementation of Schizochytrium, the abundances of Clostridium magunm and Thermooactinomyces vulgaris declined obviously (p < 0.05) with the levels rising up to 20.00 g/kg. The abundances of Akkermansia glycanispila, Clostridium butyricum, Cetobacterium somerae, Niameybacter massiliensis, Anaerorhabdus furcosa, and Dietzia timorensis increased obviously (p < 0.05) as the Schizochytrium levels raised to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels.

3.4. The Expression of Genes Related to Growth Performance, Energy Metabolism, and Immune Response

3.4.1. Expression of the Genes Involved in GH-IGF-1 Axes

The expression of GH, IGF-1, IGF-1R, and IGF-2 increased obviously (p < 0.05) as Schizochytrium levels raised to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels (Figure 6A).

3.4.2. Expression of the AMPK Gene

The expression of AMPK in the liver and intestine increased obviously (p < 0.05) as the Schizochytrium levels increased to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels (Figure 6B,C).

3.4.3. Expression of the Genes Involved in Glycolipid Metabolism

The expression of PK, GK, G6PC2, PYGL, SREBP1, ACC1, FAS, PPARα, CPT1α, and ACAA2 in the liver increased obviously (p < 0.05) as the Schizochytrium levels increased to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels (Figure 6D,E).

3.4.4. Expression of the Genes Involved in Intestinal Barrier Function

The expression of TJP1, TJP2, CLDN1, OCLN, RPL17, and LYZ1 in the intestine increased obviously (p < 0.05) as Schizochytrium levels raised to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels (Figure 6F).

3.4.5. Expression of the Genes Involved in Inflammation

The expression of NF-KB, TLR4, TNF-α, NLRP3, IL-1β, IL-8, and IL-17 in the intestine declined obviously (p < 0.05) as Schizochytrium levels increased to 15.00 g/kg diet but increased with further increasing Schizochytrium levels. The expression of IL-10 in intestine rose obviously (p < 0.05) as the Schizochytrium levels increased to 15.00 g/kg diet but decreased with further increasing Schizochytrium levels (Figure 6G).

4. Discussion

In the present study, the highest values of final weight, WGR, SGR, FI, PPR, and MR were observed in the S4 group. Additionally, the higher contents of whole-body crude protein and lipids were also observed in S4 group. The results indicated that 15.00 g/kg Schizochytrium supplementation could effectively improve the growth performance, metamorphosis, feed utilization, and protein and lipid contents of tadpoles. A key contributing factor appears to be the significantly increased enzyme activities of digestion (e.g., AMS, LPS, PES) and brush border membrane (e.g., Na+, K+-ATPase, AKP, γ-GT, and CK) in the intestines of the S4 group. These enzymes are crucial for the digestion and absorption of carbohydrates, lipids, and proteins [28,29,30,31].The increased enzyme activities could improve the digestive and absorptive capacity of the intestine, thereby benefitting growth and nutrition utilization and subsequent metamorphosis of tadpoles [32,33]. Moreover, the improvement of intestinal morphology by Schizochytrium supplementation should not be neglected. Previous studies displayed that the increase in intestinal microvilli length and mucosal epithelial cell height can improve the digestive and absorptive capacity of the intestine, thereby directly affecting nutrient utilization [22,34,35].
Additionally, intestinal microbial diversity and abundance of bullfrog tadpoles were also significantly modulated by Schizochytrium levels. The supplementation of Schizochytrium exhibited higher values of ASV, Ace, and Chao1 compared with the S0 group, and the highest levels were observed in the S4 group. The findings indicated that 15.00 g/kg Schizochytrium supplementation could increase the intestinal microbial diversity of bullfrogs. Previous studies have shown that the increased microbial diversity is beneficial to the enhancement of immune function in the host [36,37,38]. These findings were further supported by the results of intestinal microbial abundance, where the supplementation of Schizochytrium increased the levels of the phyla Fusobacteriota, Firmicutes, Verrucomicrobiotam and Bacteroidota, and the S4 diet-fed tadpoles had the highest abundances of Firmicutes. A previous study has confirmed that Fusobacteriota can improve the integrity of the intestinal barrier, thus enhancing the host’s immune function [39]. Firmicutes and Bacteroidota are both involved in converting complex carbohydrates into beneficial metabolites such as short chain fatty acids (SCFAs), thereby providing energy for host resistance to pathogens [40]. Verrucomicrobiota members can produce antibiotic like substances, which are beneficial for inhibiting the growth and colonization of pathogenic bacteria in the host’s intestine [41]. Meanwhile, Firmicutes was also regarded as a sensitive indicator in the change in host weight, since the increased Firmicutes abundance is often found in hosts who have gained weight [42,43,44]. This result corresponds to the fact that S4-fed bullfrog tadpoles have relatively high growth performance. In addition, the results on the genus and species levels also showed that supplementation of Schizochytrium could increase the abundance of beneficial microbiota, such as Akkermansia glycanispila, Clostridium butyricum, and Cetobacterium somerae. Accumulating evidence suggested that all of them can improve intestinal barrier function by degrading mucin to produce SCFAs, thus leading to the enhancement of the host’s immune function [45,46,47,48].
The GH-IGF-1 axis plays an important role in the regulation of growth and feed utilization of aquatic animals. In this study, the highest expression of GH, IGF-1, IGF-1R, and IGF-2 were observed in the S4 group, which is in line with the results of growth performance. This may be attributed to the fact that DHA-abundant Schizochytrium can stimulate the generation of GH, thus leading to an increase in GH expression [49]. Then, the increase in GH induces the release of IGF-1 [50], thereby improving the growth performance of tadpoles.
At the metabolic level, the expression of genes related to energy metabolism (AMPK, PK, GK, G6PC2, PYGL, SREBP1, ACC1, FAS, PPARα, CPT1α, and ACAA2) in the liver upregulated obviously as the Schizochytrium levels increased to 15.00 g/kg diet. The results indicated that the S4 diets significantly enhance glycolysis, gluconeogenesis, glycogenolysis, lipogenesis, and lipolysis of tadpoles. According to a previous study, AMP-activated protein kinase (AMPK) is a highly conserved sensor of cellular energy status that can regulate the energy metabolism of organisms [51], and DHA-rich food can activate the AMPK [52]. The activation of AMPK can participate in a series of physiological consequences concerning glycolipid metabolism, such as (1) the enhancement of glycolysis and glycogenolysis by upregulating GK and PYGL activities, respectively [53,54]; and (2) the increase in lipolysis by activating PPARα and PPARα-downstream target genes (CPT1α and ACAA2) [55]. In addition, DHA has been demonstrated to upregulate expression of lipogenesis-related genes, thereby resulting in an increase in lipid contents [56]. For gluconeogenesis, this may be attributed to the enhanced glycolysis that could result in an increase in pyruvate content, which in turn stimulates gluconeogenesis characterized by the upregulation of G6PC2 expression [57].
Intestinal health partly depends on intestinal barrier function which is associated with the activities of tight junction proteins, such as claudins and occlusions [58]. In this study, the mRNA levels of AMPK and tight junction proteins (e.g., TJP1, TJP2, CLDN1, OCLN, RPL17, and LYZ1) in the intestine increased significantly as the Schizochytrium levels increased to 15.00 g/kg diet, indicating that the S4 diet significantly enhanced the intestinal barrier function of tadpoles. The results may be due to the fact that the activation of AMPK could promote tight junction-related protein synthesis, thereby leading to the enhancement of intestinal barrier function characterized by the upregulation of tight junction proteins expression [59,60]. According to previous research, the enhanced intestinal barrier function can enhance the immunity of aquatic animals [61]. Consistent with an enhanced barrier and AMPK’s role in modulating redox and inflammatory states, the S4 group exhibited significantly elevated activities of antioxidant enzymes (SOD, CAT) and a marked down-regulation of pro-inflammatory genes (NF-KB, TLR4, TNF-α, NLRP3, IL-1β, IL-8, IL-17). AMPK can activate the Nrf2-mediated antioxidant pathway and inhibit NF-kB signaling by deacetylating the p65 subunit [62,63,64], thereby collectively reducing intestinal inflammation and oxidative stress.

5. Conclusions

In conclusion, dietary supplementation of Schizochytrium significantly enhanced bullfrog tadpole growth and metamorphosis by simultaneously improving digestive function, intestinal barrier integrity, and intermediate metabolism, while attenuating intestinal inflammation. Optimal Schizochytrium levels for bullfrog tadpoles were estimated to be 13.27 g/kg diet. This study provided a practical nutritional strategy for sustainable bullfrog aquaculture. A limitation of this work was that the precise causal relationships between the reshaped gut microbiota and the observed metabolic benefits warrant further investigation. Future studies should focus on validating these findings under commercial farming conditions and elucidating the underlying molecular mechanisms in greater detail.

Author Contributions

H.D.: formal analysis; software; investigation; visualization; writing—original draft; writing—review and editing. Y.H.: data curation; conceptualization; writing—review and editing; supervision. Y.S.: investigation; visualization. J.L.: software. W.L.: validation. C.X.: conceptualization; writing—original draft; writing—review and editing; supervision. H.Y.: conceptualization; funding acquisition; project administration; supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Guangdong Forestry Science and Technology Innovation Project (2021KJCX012, 2022KJCX019); Provincial Science and Technology Special Fund Project for Zhongshan City (Major Special Project + Task List Management Mode) (2021SDR003, 2022SDR001, 2023SDR006); Agricultural Product Quality and Safety Risk Assessment Project Ministry of Agriculture and Rural Affairs of the People’s Republic of China (20244088); The second round of rural science and technology special correspondent project of the Hundred-Thousand-Ten-Thousand Project (KTP20240658); Natural Science Foundation of Guangdong Province (2025A1515010649); Special Fund Project for Marine Economic Development (Six Marine Industries) of Guangdong Province (GDNRC [2022]50); Key-Area Research and Development Program of Guangdong Province (2021B0202030002).

Institutional Review Board Statement

The study was conducted according to the guidelines of the National Institute of Health guide for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978, and approved by the Institutional Animal Care and Use Committee of South China Agricultural University (Approved protocol no# 2017D006 on 18 July 2017).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors would like to express sincere thanks to the personnel of the Guangdong Xingwa Agricultural Science and Technology Co., Ltd., for their kind assistance.

Conflicts of Interest

The authors declare that there is no conflict of interest that could be perceived as prejudice against the impartiality of the research reported.

Abbreviations

The following abbreviations are used in this manuscript:
GHGrowth hormone
AMPKAmp-activated protein kinase
IGF-1Insulin-like growth factor 1
IGF-1RInsulin-like growth factor 1 receptor
IGF-2Insulin-like growth factor 2
PKPyruvate kinase
G6PC2Glucose-6-phosphatase catalytic, 2
PYGLGlycogen phosphorylase, liver
GKGlycerol kinase
SREBP1Sterol-regulatory element binding protein 1
ACC1Acetyl-coa carboxylase 1
FASFatty acid synthase
PPARαPeroxisome proliferator-activated receptor alpha
CPT1αCarnitine palmitoyl transferase 1α
ACAA2Acetyl-coa acyltransferase 2
LYZ1Lysozyme 1
TJP1Tight junction protein 1
TJP2Tight junction protein 2
CLDN1Claudin 1
OCLNOccluding
RPL17Ribosomal protein L17
NF-KBNuclear factor kappa B
TLR4Toll-like receptor 4
NLRP3NACHT, LRR, and PYD domains-containing protein 3
TNF-αTumor necrosis factor alpha
IL-1βInterleukin 1β
IL-8Interleukin 8
IL-10Interleukin 10
IL-17Interleukin 17
WGRWeight gain rate
SGRSpecific growth rate
FCR Feed conversion ratio
FIFeed intake
CFCondition factor
PPRPost-premetamorphosis rate
MRMetamorphosis rate
Na+, K+-ATPaseSodium-potassium adenosine triphosphatase
AKPAlkaline phosphatase
γ-GTγ-glutamyl transferase
CKCreatine kinase
SODSuperoxide dismutase
CATCatalase
T-AOCTotal antioxidant capacity
MDAMalondialdehyde
ASVAmplicon sequence variant
CTConnective tissue
MEMucosal epithelial cells
MMicrovilli
NCell nucleus
PCoAPrincipal co-ordinates analysis
NMDSNon-metric multidimensional scaling

References

  1. Mansano, C.F.M.; Stéfani, M.V.D.; Pereira, M.M.; Macente, B.I. Non-linear growth models for bullfrog tadpoles. Cienc. Agrotecnol. 2012, 36, 454–462. [Google Scholar] [CrossRef] [Scilit]
  2. Scott, D.E.; Casey, E.D.; Donovan, M.F.; Lynch, T.K. Amphibian lipid levels at metamorphosis correlate to post-metamorphic terrestrial survival. Oecologia 2007, 153, 521–532. [Google Scholar] [CrossRef] [Scilit]
  3. Stamper, C.; Downie, J.; Stevens, D.; Monaghan, P. The effects of perceived predation risk on pre-and post-metamorphic phenotypes in the common frog. J. Zool. 2009, 277, 205–213. [Google Scholar] [CrossRef] [Scilit]
  4. Alvarez, R.; Real, M. Significance of initial weight of post-metamorphosis froglets for growth and fattening of Rana perezi Seoane, 1885, raised in captivity. Aquaculture 2006, 255, 429–435. [Google Scholar] [CrossRef] [Scilit]
  5. Cheng, R.B.; Ma, R.J.; Li, K.; Rong, H.; Lin, X.Z.; Wang, Z.K.; Yang, S.J.; Ma, Y. Agrobacterium tumefaciens mediated transformation of marine microalgae Schizochytrium. Microbiol. Res. 2012, 167, 179–186. [Google Scholar] [CrossRef] [Scilit]
  6. Shields, R.; Bell, G. Evaluation of a DHA-rich microalga (Schizochytruim sp.) as a diet enrichment for larval Atlantic halibut (Hippoglossus hippoglossus L.). Spec. Publ. Eur. Aquac. Soc. 1995, 24, 188–191. [Google Scholar]
  7. Wang, Y.; Li, M.; Filer, K.; Xue, Y.; Ai, Q.; Mai, K. Replacement of fish oil with a DHA-rich Schizochytrium meal on growth performance, activities of digestive enzyme and fatty acid profile of Pacific white shrimp (Litopenaeus vannamei) larvae. Aquacult. Nutr. 2017, 23, 1113–1120. [Google Scholar] [CrossRef] [Scilit]
  8. Xie, S.W.; Wei, D.; Tan, B.P.; Liu, Y.J.; Tian, L.X.; Niu, J. Schizochytrium limacinum supplementation in a low fish-meal diet improved immune response and intestinal health of juvenile Penaeus monodon. Front. Physiol. 2020, 11, 613. [Google Scholar] [CrossRef] [Scilit]
  9. Xie, J.; Fang, H.; Liao, S.; Guo, T.; Yin, P.; Liu, Y.; Tian, L.; Niu, J. Study on Schizochytrium sp. improving the growth performance and non-specific immunity of golden pompano (Trachinotus ovatus) while not affecting the antioxidant capacity. Fish Shellfish Immunol. 2019, 95, 617–623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Ma, K.; Chen, S.; Wu, Y.; Ma, Y.; Qiao, H.; Fan, J.; Wu, H. Dietary supplementation with microalgae enhances the zebrafish growth performance by modulating immune status and gut microbiota. Appl. Microbiol. Biotechnol. 2022, 106, 773–788. [Google Scholar] [CrossRef] [Scilit]
  11. Sarker, P.K.; Kapuscinski, A.R.; Lanois, A.J.; Livesey, E.D.; Bernhard, K.P.; Coley, M.L. Towards sustainable aquafeeds: Complete substitution of fish oil with marine microalga Schizochytrium sp. improves growth and fatty acid deposition in juvenile nile tilapia (Oreochromis niloticus). PLoS ONE 2016, 11, e0156684. [Google Scholar] [CrossRef] [Scilit]
  12. Karataş, B. Effects of Chlorella sp. and Schizochytrium sp. extracts on growth indices, body composition, and gene expression profiles in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2025, 276, 111047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Chen, H.; Anderson, R.E. Metabolism in frog retinal pigment epithelium of docosahexaenoic and arachidonic acids derived from rod outer segment membranes. Exp. Eye Res. 1993, 57, 369–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Igarashi, M.; Santos, R.A.; Cohen-Cory, S. Impact of maternal n-3 polyunsaturated fatty acid deficiency on dendritic arbor morphology and connectivity of developing Xenopus laevis central neurons In Vivo. J. Neurosci. 2015, 35, 6079–6092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Chen, H.; Anderson, R.E. Differential incorporation of docosahexaenoic and arachidonic acids in frog retinal pigment epithelium. J. Lipid Res. 1993, 34, 1943–1955. [Google Scholar] [CrossRef] [Scilit]
  16. Hamasaki, K.; Suprayudi, M.A.; Takeuchi, T. Effects of dietary N-3HUFA on larval morphogenesis and metamorphosis to megalops in the seed production of the mud crab, Scylla serrata (Brachyura: Portunidae). Aquac. Sci. 2002, 50, 333–340. [Google Scholar] [CrossRef] [Scilit]
  17. Hamre, K.; Moren, M.; Solbakken, J.; Opstad, I.; Pittman, K. The impact of nutrition on metamorphosis in Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 2005, 250, 555–565. [Google Scholar] [CrossRef] [Scilit]
  18. Gatesoupe, F. Live yeasts in the gut: Natural occurrence, dietary introduction, and their effects on fish health and development. Aquaculture 2007, 267, 20–30. [Google Scholar] [CrossRef] [Scilit]
  19. Kayama, H.; Okumura, R.; Takeda, K. Interaction between the microbiota, epithelia, and immune cells in the intestine. Annu. Rev. Immunol. 2020, 38, 23–48. [Google Scholar] [CrossRef] [Scilit]
  20. Hooper, L.V.; Littman, D.R.; Macpherson, A.J. Interactions between the microbiota and the immune system. Science 2012, 336, 1268–1273. [Google Scholar] [CrossRef] [Scilit]
  21. Wang, C.; Liu, Z.; Zhou, T.; Wu, J.; Feng, F.; Wang, S.; Chi, Q.; Sha, Y.; Zha, S.; Shu, S.; et al. Gut microbiota-derived butyric acid regulates calcific aortic valve disease pathogenesis by modulating GAPDH lactylation and butyrylation. iMeta 2025, 4, e70048. [Google Scholar] [CrossRef] [Scilit]
  22. Wu, Y.; Liu, W.B.; Li, H.Y.; Xu, W.N.; He, J.X.; Li, X.F.; Jiang, G.Z. Effects of dietary supplementation of fructooligosaccharide on growth performance, body composition, intestinal enzymes activities and histology of blunt snout bream (Megalobrama amblycephala) fingerlings. Aquacult. Nutr. 2013, 19, 886–894. [Google Scholar] [CrossRef] [Scilit]
  23. Li, X.; Rahimnejad, S.; Wang, L.; Lu, K.L.; Song, K.; Zhang, C.X. Substituting fish meal with housefly (Musca domestica) maggot meal in diets for bullfrog Rana (Lithobates) catesbeiana: Effects on growth, digestive enzymes activity, antioxidant capacity and gut health. Aquaculture 2019, 499, 295–305. [Google Scholar] [CrossRef] [Scilit]
  24. Li, M.H.; Robinson, E.H.; Tucker, C.S.; Manning, B.B.; Khoo, L. Effects of dried algae Schizochytrium sp., a rich source of docosahexaenoic acid, on growth, fatty acid composition, and sensory quality of channel catfish Ictalurus punctatus. Aquaculture 2009, 292, 232–236. [Google Scholar] [CrossRef] [Scilit]
  25. Liu, X.C.; Xiong, Y.; Zhong, H.C.; Zhang, C.X.; Wang, L.; Song, K.; Ma, R.J.; Li, X.S.; Lu, K.L. Effects of dietary supplementation with schizochytrium meal on growth performance, non-specific immunity and antioxidant capacity of Lateolabrax maculatus. Chin. J. Anim. Nutr. 2025, 37, 2576–2586. [Google Scholar]
  26. Mansano, C.; Macente, B.I.; Khan, K.U.; Fernandes, J.B.K.; Vanzela, L.S.; Américo-Pinheiro, J.H.P.; Frias, D.F.R.; De Stéfani, M.V. Importance of optimum water quality indices in successful frog culture practices. In Limnology—Some New Aspects of Inland Water Ecology; Gokce, D., Ed.; IntechOpen: London, UK, 2018. [Google Scholar]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  28. Rhoads, J.M.; Chen, W.; Chu, P.; Berschneider, H.M.; Argenzio, R.A.; Paradiso, A.M. L-glutamine and L-asparagine stimulate Na+-H+ exchange in porcine jejunal enterocytes. Am. J. Physiol.-Gastrointest. Liver Physiol. 1994, 266, G828–G838. [Google Scholar] [CrossRef] [Scilit]
  29. Villanueva, J.; Vanacore, R.; Goicoechea, O.; Amthauer, R. Intestinal alkaline phosphatase of the fish Cyprinus carpio: Regional distribution and membrane association. J. Exp. Zool. 1997, 279, 347–355. [Google Scholar] [CrossRef] [Scilit]
  30. Wallimann, T.; Hemmer, W. Creatine kinase in non-muscle tissues and cells. Cell. Bioenerg. Role Coupled Creat. Kinases 1994, 133, 193–220. [Google Scholar] [CrossRef] [Scilit]
  31. Suzer, C.; Çoban, D.; Kamaci, H.O.; Saka, Ş.; Firat, K.; Otgucuoğlu, Ö.; Küçüksari, H. Lactobacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.) larvae: Effects on growth performance and digestive enzyme activities. Aquaculture 2008, 280, 140–145. [Google Scholar] [CrossRef] [Scilit]
  32. Zhou, Y.Q.; Chen, Y.Q.; Fisher, J.H.; Wang, M.H. Activation of the RON receptor tyrosine kinase by macrophage-stimulating protein inhibits inducible cyclooxygenase-2 expression in murine macrophages. J. Biol. Chem. 2002, 277, 38104–38110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Phan-Chan-Du, A.; Hemmerlin, C.; Krikorian, D.; Sakarellos-Daitsiotis, M.; Tsikaris, V.; Sakarellos, C.; Marinou, M.; Thureau, A.; Cung, M.T.; Tzartos, S.J. Solution conformation of the antibody-bound tyrosine phosphorylation site of the nicotinic acetylcholine receptor β-subunit in its phosphorylated and nonphosphorylated states. Biochemistry 2003, 42, 7371–7380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Zhou, X.Q.; Zhao, C.R.; Lin, Y. Compare the effect of diet supplementation with uncoated or coated lysine on juvenile Jian Carp (Cyprinus carpio Var. Jian). Aquacult. Nutr. 2010, 13, 457–461. [Google Scholar] [CrossRef] [Scilit]
  35. Shu, Y.L.; Jiang, H.L.; Yuen, C.N.T.; Wang, W.C.; He, J.; Zhang, H.J.; Liu, G.X.; Wei, L.T.; Chen, L.G.; Wu, H.L. Microcystin-leucine arginine induces skin barrier damage and reduces resistance to pathogenic bacteria in Lithobates catesbeianus tadpoles. Ecotoxicol. Environ. Saf. 2022, 238, 113584. [Google Scholar] [CrossRef] [Scilit]
  36. Zhang, Y.; Zhang, X.; Cao, D.; Yang, J.; Mao, H.; Sun, L.; Wang, C. Integrated multi-omics reveals the relationship between growth performance, rumen microbes and metabolic status of Hu sheep with different residual feed intakes. Anim. Nutr. 2024, 18, 284–295. [Google Scholar] [CrossRef] [Scilit]
  37. Kar, N.; Ghosh, K. Enzyme producing bacteria in the gastrointestinal tracts of Labeo rohita (Hamilton) and Channa punctatus (Bloch). Turk. J. Fish. Aquat. Sci. 2008, 8, 115–120. [Google Scholar] [CrossRef] [Scilit]
  38. Ramirez, R.F.; Dixon, B.A. Enzyme production by obligate intestinal anaerobic bacteria isolated from oscars (Astronotus ocellatus), angelfish (Pterophyllum scalare) and southern flounder (Paralichthys lethostigma). Aquaculture 2003, 227, 417–426. [Google Scholar] [CrossRef] [Scilit]
  39. Yu, C.X.; Zhang, P.; Liu, S.J.; Niu, Y.M.; Fu, L. SESN2 ablation weakens exercise benefits on resilience of gut microbiota following high-fat diet consumption in mice. Food Sci. Hum. Wellness 2023, 12, 1961–1968. [Google Scholar] [CrossRef] [Scilit]
  40. Zhang, J.H.; Meng, H.; Kong, X.C.; Cheng, X.Y.; Ma, T.; He, H.; Du, W.C.; Yang, S.G.; Li, S.Y.; Zhang, L.M. Combined effects of polyethylene and organic contaminant on zebrafish (Danio rerio): Accumulation of 9-Nitroanthracene, biomarkers and intestinal microbiota. Environ. Pollut. 2021, 277, 116767. [Google Scholar] [CrossRef] [Scilit]
  41. Orellana, L.H.; Francis, T.B.; Ferraro, M.A.; Hehemann, J.H.; Fuchs, B.M.; Amann, R.I. Verrucomicrobiota are specialist consumers of sulfated methyl pentoses during diatom blooms. ISME J. 2021, 16, 630–641. [Google Scholar] [CrossRef] [Scilit]
  42. Koliada, A.; Syzenko, G.; Moseiko, V.; Budovska, L.; Puchkov, K.; Perederiy, V.; Gavalko, Y.; Dorofeyev, A.; Romanenko, M.; Tkach, S.; et al. Association between body mass index and Firmicutes/Bacteroidetes ratio in an adult Ukrainian population. BMC Microbiol. 2017, 17, 120. [Google Scholar] [CrossRef] [Scilit]
  43. Sweeney, T.E.; Morton, J.M. The Human Gut Microbiome: A Review of the Effect of Obesity and Surgically Induced Weight Loss. JAMA Surg. 2013, 148, 563–569. [Google Scholar] [CrossRef] [Scilit]
  44. Mathur, R.; Barlow, G.M. Obesity and the microbiome. Expert Rev. Gastroenterol. Hepatol. 2015, 9, 1087–1099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Chen, F.; Wang, Y.; Wang, K.; Chen, J.; Jin, K.; Peng, K.; Chen, X.; Liu, Z.; Ouyang, J.; Wang, Y.; et al. Effects of Litsea cubeba essential oil on growth performance, blood antioxidation, immune function, apparent digestibility of nutrients, and fecal microflora of pigs. Front. Pharmacol. 2023, 14, 1166022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Iwaza, R.; Wasfy, R.M.; Dubourg, G.; Raoult, D.; Lagier, J.-C. Akkermansia muciniphila: The state of the art, 18 years after its first discovery. Front. Gastroenterol. 2022, 1, 1024393. [Google Scholar] [CrossRef] [Scilit]
  47. Meng, X.L.; Wu, S.K.; Hu, W.P.; Zhu, Z.X.; Yang, G.K.; Zhang, Y.M.; Qin, C.B.; Yang, L.P.; Nie, G.X. Clostridium butyricum improves immune responses and remodels the intestinal microbiota of common carp (Cyprinus carpio L.). Aquaculture 2021, 530, 735753. [Google Scholar] [CrossRef] [Scilit]
  48. Liang, H.; Li, M.; Chen, J.; Zhou, W.H.; Xia, D.M.; Ding, Q.W.; Yang, Y.L.; Zhang, Z.; Ran, C.; Zhou, Z.G. The intestinal microbiome and Cetobacterium somerae inhibit viral infection through TLR2-type I IFN signaling axis in zebrafish. Microbiome 2024, 12, 244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Turgut, S.; Erken, H.A.; Erken, G.; Ayada, C.; Genc, O.; Turgut, G. The effects of docosahexaenoic acid supplementation and exercise on growth hormone and insulin-like growth factor I serum levels during chronic hypoxia in rats. J. Basic. Clin. Physiol. Pharmacol. 2011, 22, 103–107. [Google Scholar] [CrossRef] [Scilit]
  50. Butler, A.A.; Roith, D.L. Control of growth by the somatropic axis: Growth hormone and the insulin-like growth factors have related and independent roles. Annu. Rev. Physiol. 2001, 63, 141–164. [Google Scholar] [CrossRef] [Scilit]
  51. Xu, C.; Liu, W.B.; Zhang, D.D.; Wang, K.Z.; Xia, S.L.; Li, X.F. Molecular characterization of AMP-activated protein kinase α2 from herbivorous fish Megalobrama amblycephala and responsiveness to glucose loading and dietary carbohydrate levels. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2017, 208, 24–34. [Google Scholar] [CrossRef] [Scilit]
  52. Manzi, L.; Costantini, L.; Molinari, R.; Merendino, N. Effect of dietary ω-3 polyunsaturated fatty acid DHA on glycolytic enzymes and Warburg phenotypes in cancer. Biomed. Res. Int. 2015, 2015, 137097. [Google Scholar] [CrossRef] [Scilit]
  53. Choi, S.H.; Kim, Y.W.; Kim, S.G. AMPK-mediated GSK3β inhibition by isoliquiritigenin contributes to protecting mitochondria against iron-catalyzed oxidative stress. Biochem. Pharmacol. 2010, 79, 1352–1362. [Google Scholar] [CrossRef] [Scilit]
  54. Xu, C.; Liu, W.B.; Zhang, D.D.; Cao, X.F.; Shi, H.J.; Li, X.F. Interactions between dietary carbohydrate and metformin: Implications on energy sensing, insulin signaling pathway, glycolipid metabolism and glucose tolerance in blunt snout bream Megalobrama amblycephala. Aquaculture 2018, 483, 183–195. [Google Scholar] [CrossRef] [Scilit]
  55. Lee, W.J.; Kim, M.; Park, H.-S.; Kim, H.S.; Jeon, M.J.; Oh, K.S.; Koh, E.H.; Won, J.C.; Kim, M.-S.; Oh, G.T.; et al. AMPK activation increases fatty acid oxidation in skeletal muscle by activating PPARα and PGC-1. Biochem. Biophys. Res. Commun. 2006, 340, 291–295. [Google Scholar] [CrossRef] [Scilit]
  56. Huang, C.W.; Chen, Y.J.; Mersmann, H.; Ding, S.-T. DHA up-regulated expression of lipogenic and endoplasmic reticulum stress related genes in pig adipose tissues. FASEB J. 2015, 29, 568.520. [Google Scholar] [CrossRef] [Scilit]
  57. Harmon, R.C.; Terneus, M.V.; Kiningham, K.K.; Valentovic, M. Time-dependent effect of p-aminophenol (PAP) toxicity in renal slices and development of oxidative stress. Toxicol. Appl. Pharmacol. 2005, 209, 86–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Niklasson, L. Intestinal Mucosal Immunology of Salmonids Response to Stress and Infection and Crosstalk with the Physical Barrier. Doctoral Thesis, Gothenburg University, Gothenburg, Sweden, 2013. [Google Scholar]
  59. Yang, W.R.; Liao, T.T.; Bao, Z.Q.; Zhou, C.Q.; Luo, H.Y.; Lu, C.; Pan, M.H.; Wang, X.Z. Role of AMPK in the expression of tight junction proteins in heat-treated porcine Sertoli cells. Theriogenology 2018, 121, 42–52. [Google Scholar] [CrossRef] [Scilit]
  60. Chen, L.; Wang, J.; You, Q.; He, S.; Meng, Q.Q.; Gao, J.; Wu, X.D.; Shen, Y.; Sun, Y.; Wu, X.F. Activating AMPK to restore tight junction assembly in intestinal epithelium and to attenuate experimental colitis by metformin. Front. Pharmacol. 2018, 9, 761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Wen, H.L.; Feng, L.; Jiang, W.D.; Liu, Y.; Jiang, J.; Li, S.H.; Tang, L.; Zhang, Y.A.; Kuang, S.Y.; Zhou, X.Q. Dietary tryptophan modulates intestinal immune response, barrier function, antioxidant status and gene expression of TOR and Nrf2 in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2014, 40, 275–287. [Google Scholar] [CrossRef] [Scilit]
  62. Zeng, M.; Zou, Y.; Shi, Z.; Wang, J.; Yang, Y.; Bai, Y.; Ping, A.; Zhang, P.; Chen, Y.; Tao, H.; et al. A broad-spectrum broth rapidly and completely repairing the sublethal injuries of Escherichia coli caused by freezing and lactic acid alone or in combination for accurate enumeration. LWT 2024, 201, 116219. [Google Scholar] [CrossRef] [Scilit]
  63. Salminen, A.; Hyttinen, J.M.; Kaarniranta, K. AMP-activated protein kinase inhibits NF-κB signaling and inflammation: Impact on healthspan and lifespan. J. Mol. Med. 2011, 89, 667–676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Chen, J.; Lai, J.; Yang, L.; Ruan, G.; Chaugai, S.; Ning, Q.; Chen, C.; Wang, D.W. Trimetazidine prevents macrophage-mediated septic myocardial dysfunction via activation of the histone deacetylase sirtuin 1. Br. J. Pharmacol. 2016, 173, 545–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. The photographs of bullfrog tadpoles after 90 days.
Figure 1. The photographs of bullfrog tadpoles after 90 days.
Antioxidants 14 01208 g001
Figure 2. Optimal levels for bullfrog tadpoles based on specific growth rate (SGR) as determined by the broken line model.
Figure 2. Optimal levels for bullfrog tadpoles based on specific growth rate (SGR) as determined by the broken line model.
Antioxidants 14 01208 g002
Figure 3. Longitudinal sections of the intestine of bullfrog tadpoles subjected to different treatments. (A) S0; (B) S1; (C) S2; (D) S3; (E) S4; (F) S5; (G) microvilli length; (H) mucosal epithelial cells height; (I) connective tissue thickness; CT, connective tissue; ME, mucosal epithelial cells; M, microvilli; N, cell nucleus. Scale bars = 50 μm. Values are mean ± S.E.M of three replications (n = 8). Values with the different superscript letters are significantly different among groups (p < 0.05).
Figure 3. Longitudinal sections of the intestine of bullfrog tadpoles subjected to different treatments. (A) S0; (B) S1; (C) S2; (D) S3; (E) S4; (F) S5; (G) microvilli length; (H) mucosal epithelial cells height; (I) connective tissue thickness; CT, connective tissue; ME, mucosal epithelial cells; M, microvilli; N, cell nucleus. Scale bars = 50 μm. Values are mean ± S.E.M of three replications (n = 8). Values with the different superscript letters are significantly different among groups (p < 0.05).
Antioxidants 14 01208 g003
Figure 4. The beta diversity of intestinal microbiota of bullfrog tadpoles subjected to different treatments (Adonis, R2 = 0.5580, p = 0.001). (A), Principal co-ordinates analysis (PCoA). (B), Non-metric multidimensional scaling (NMDS). (C), Beta diversity heatmap; the smaller coefficient means the top-left sample was more similar with the top-right sample.
Figure 4. The beta diversity of intestinal microbiota of bullfrog tadpoles subjected to different treatments (Adonis, R2 = 0.5580, p = 0.001). (A), Principal co-ordinates analysis (PCoA). (B), Non-metric multidimensional scaling (NMDS). (C), Beta diversity heatmap; the smaller coefficient means the top-left sample was more similar with the top-right sample.
Antioxidants 14 01208 g004
Figure 5. Taxonomy classification of reads at phylum (A) and genus (B) taxonomic levels of bullfrog tadpoles subjected to different treatments. Only top 10 most abundant (based on relative abundance) bacterial phyla and genera are shown in the figures. Other phyla and genera were all assigned as ‘Others’. (C), The upregulated abundance in species; (D), The down-regulated abundance in species. Values are mean ± S.E.M of three replications (n = 3). Values with the different superscript letters are significantly different among groups (p < 0.05).
Figure 5. Taxonomy classification of reads at phylum (A) and genus (B) taxonomic levels of bullfrog tadpoles subjected to different treatments. Only top 10 most abundant (based on relative abundance) bacterial phyla and genera are shown in the figures. Other phyla and genera were all assigned as ‘Others’. (C), The upregulated abundance in species; (D), The down-regulated abundance in species. Values are mean ± S.E.M of three replications (n = 3). Values with the different superscript letters are significantly different among groups (p < 0.05).
Antioxidants 14 01208 g005aAntioxidants 14 01208 g005b
Figure 6. (A) Transcriptional levels of GH-IGF axes-related genes in brain and liver of bullfrog tadpoles subjected to different treatments. (B,C) Transcriptional levels of AMPK gene in liver and intestine of bullfrog tadpoles subjected to different treatments. (D) Transcriptional levels of glucose metabolism-related genes in liver of bullfrog tadpoles subjected to different treatments. (E) Transcriptional levels of lipid metabolism-related genes in liver of bullfrog tadpoles subjected to different treatments. (F) Transcriptional levels of intestinal barrier function-related genes in intestines of bullfrog tadpoles subjected to different treatments. (G) Transcriptional levels of inflammation-related genes in intestines of bullfrog tadpoles subjected to different treatments. GH, growth hormone; IGF-1, insulin-like growth factor 1; IGF-1R, insulin-like growth factor 1 receptor; IGF-2, insulin-like growth factor 2; AMPK, amp-activated protein kinase; PK, pyruvate kinase; GK, glycerol kinase; G6PC2, glucose-6-phosphatase catalytic, 2; PYGL, glycogen phosphorylase, liver; SREBP1, sterol-regulatory element binding protein 1; ACC1, acetyl-coa carboxylase 1; FAS, fatty acid synthase; PPARα, peroxisome proliferator-activated receptor alpha; CPT1α, carnitine palmitoyl transferase 1α; ACAA2, acetyl-coa acyltransferase 2; TJP1, tight junction protein 1; TJP2, tight junction protein 2; CLDN1, claudin 1; OCLN, occludin; RPL17, ribosomal protein L17; LYZ1, lysozyme 1; NF-KB, nuclear factor kappa B; TLR4, toll-like receptor 4; TNF-α, tumor necrosis factor alpha; NLRP3, NACHT, LRR, and PYD domains containing protein 3; IL-1β, Interleukin 1β; IL-8, Interleukin 8; IL-17, Interleukin 17; IL-10, Interleukin 10. Values are mean ± S.E.M of three replications (n = 3). Values with the different superscript letters are significantly different among groups (p < 0.05).
Figure 6. (A) Transcriptional levels of GH-IGF axes-related genes in brain and liver of bullfrog tadpoles subjected to different treatments. (B,C) Transcriptional levels of AMPK gene in liver and intestine of bullfrog tadpoles subjected to different treatments. (D) Transcriptional levels of glucose metabolism-related genes in liver of bullfrog tadpoles subjected to different treatments. (E) Transcriptional levels of lipid metabolism-related genes in liver of bullfrog tadpoles subjected to different treatments. (F) Transcriptional levels of intestinal barrier function-related genes in intestines of bullfrog tadpoles subjected to different treatments. (G) Transcriptional levels of inflammation-related genes in intestines of bullfrog tadpoles subjected to different treatments. GH, growth hormone; IGF-1, insulin-like growth factor 1; IGF-1R, insulin-like growth factor 1 receptor; IGF-2, insulin-like growth factor 2; AMPK, amp-activated protein kinase; PK, pyruvate kinase; GK, glycerol kinase; G6PC2, glucose-6-phosphatase catalytic, 2; PYGL, glycogen phosphorylase, liver; SREBP1, sterol-regulatory element binding protein 1; ACC1, acetyl-coa carboxylase 1; FAS, fatty acid synthase; PPARα, peroxisome proliferator-activated receptor alpha; CPT1α, carnitine palmitoyl transferase 1α; ACAA2, acetyl-coa acyltransferase 2; TJP1, tight junction protein 1; TJP2, tight junction protein 2; CLDN1, claudin 1; OCLN, occludin; RPL17, ribosomal protein L17; LYZ1, lysozyme 1; NF-KB, nuclear factor kappa B; TLR4, toll-like receptor 4; TNF-α, tumor necrosis factor alpha; NLRP3, NACHT, LRR, and PYD domains containing protein 3; IL-1β, Interleukin 1β; IL-8, Interleukin 8; IL-17, Interleukin 17; IL-10, Interleukin 10. Values are mean ± S.E.M of three replications (n = 3). Values with the different superscript letters are significantly different among groups (p < 0.05).
Antioxidants 14 01208 g006aAntioxidants 14 01208 g006b
Table 1. Formulation and proximate composition of the different experimental diets (% dry matter basis).
Table 1. Formulation and proximate composition of the different experimental diets (% dry matter basis).
Groups
ItemsS0S1S2S3S4S5
Formulation (%)
Fish meal10.010.010.010.010.010.0
Chicken meal8.08.08.08.08.08.0
Dephenolized cottonseed protein15.015.015.015.015.015.0
Rapeseed meal16.016.016.016.016.016.0
Soybean meal30.030.030.030.030.030.0
Corn starch14.514.514.514.514.514.5
Schizochytrium (g/kg)-2.05.010.015.020.0
Fish oil1.51.51.51.51.51.5
Soybean oil1.51.51.51.51.51.5
Calcium biphosphate1.01.01.01.01.01.0
Choline chloride0.50.50.50.50.50.5
Premix *1.01.01.01.01.01.0
DL-lysine0.50.50.50.50.50.5
DL-methionine0.50.50.50.50.50.5
Proximate analysis (% dry matter basis)
Moisture8.147.878.037.938.017.90
Crude protein29.1728.1428.929.1628.7729.13
Crude lipid4.234.534.514.434.494.52
Ash15.5315.0114.9514.9015.1715.01
* Notes: vitamin premix (mg/kg) [vitamin A 500,000 IU, vitamin D3 50,000 IU, vitamin E2 500 mg, vitamin K3 1000 mg, vitamin B1 5000 mg, vitamin B2 5000 mg, vitamin B6 5000 mg. vitamin B12 5000 ug, inositol 25,000 mg, pantothenic acid 10,000 mg, choline 100,000 mg. Niacin 25,000 mg, folic acid 1000 mg, biotin 250 mg, vitamin C 10,000 mg]; mixed minerals (g/kg) contains CaCO3 314.0 g, KH2PO4 469.3 g, MgSO4·7H2O 147.4 g, NaC1 49.8 g, Fe(II)gluconate 10.9 g, MnSO4·7H2O 3.12 g, ZnSO4-7H2O 4.67 g, CuSO4-5H2O 0.62 g, KI 0.16 g, CoCl2-6H2O 0.08 g, NH4 molybdate 0.06 g, NaSeO3 0.02 g.
Table 2. Primer sequences for qPCR.
Table 2. Primer sequences for qPCR.
Target
Genes
Forward (5′-3)Reverse (5′-3)Accession
Numbers or References
GHTAGACCTCCTCCGCTTCTCCACCGTAGTTCCGGACGTTTCAY251538.1
AMPKGGAGGTGCTCAGCTGCTTGTAATGAATCGGGCGGGCTTGTPIO34006.1
IGF-1CAGTTTGTATGTGGAGACAGAGGCTCAGTACATCTCTAGCCTCCTCAGAXM040344286.1
IGF-1RTCCGTCTGTTAGGCGTTGTAGGGTTGTTCTCGGCATCTKF819507
IGF-2TGCCACTGCATTGCCATCTCTTCTATTTGCCTCACCCACCGCXM040328472.1
PKTCCTTCATTCGCAAGGCAGCTGATATTCTTTCCTTTCTCCCCGAXM040343042.1
G6PC2CTGCTCCAGTCATTGAACAGTTTCCCCCATAGCGTGACCTGAAGLH203031
PYGLCTCGAGTGCTCTATCCCAATGATACCACAAAGTACTCCTGCTTCAGALH181312
GKAACGCTTTGAGCCACAGATTAATCTGCTTTTTTCCATCGAGCATLH193866
SREBP1CCACCGCCTGCACCAACACTCAGCGCCATGTTGATGLH362962
ACC1GTTAAAGCTGCCATCCTCACTGTTGTCCGTCTGGCTAAGATGGTLH212450
FASCCTCCACGCCAGAACAAGATGATATTTTTATGAGTGGACATTGTATCGALH228595
PPARαCCCGACATTCGATGTTTAGAGATTCCAGCCCATCTTCTATCACCTTLH193621
CPT1αTGATTGGCAAAATCAAAGAACATCAATGCTCTGACCCTGGTGAGALH022414
ACAA2TGTTAGCAGGAGGTAAAAGGAAAGTCATGCGTTCAACAGTTTTTGGAALH119205
LYZ1ATGGAAAGACAGCAGGAGTCCAGAAGTATACGATCC[25]
TJP1TACGAGAAAGTGGTGCTCCCTCACTCACAAGACTTG[25]
TJP2GACCGTAGAAGTGCATACCCTGATCTCTTCCATAGC[25]
CLDN1TTGTCCCTCCTGTCTGTCATCTACTGGAGAGGTGAAGTAGTGGXM040320982.1
OCLNTGCAACGATCGTGTACACGTGAATAGAACTGGTTGC[25]
RPL17CAAACAGTGGGACTGGACACATTCTTCAGCATGTGCAGGAGGAATXM040336449.1
NF-KBAGGAACAAGATCATCATAGAGGACTCAGAAAGAGGGGCCAAGTGXM040329914.1
TLR4ACACCTTCAAGGCTCGCTACATGATGGGTCGCCATCTTCCXM040322748.1
NLRP3ATCACCACAAGGTCACTGGCTGATTGGCCAGAGCACACAGCXM040352091.1
TNF-αACAGACTTGATGGACCTCAGTTCCAGCTTCGATGTG[25]
IL-1βTCATTCGGGACAGCAGGCAGAAGCTTCACTGGCACGGTTGTTCT[14]
IL-8ACCCTTACCCTCTTCCTGCTTCAGCTTCACACACTGGCAXM040335899.1
IL-10GGAAGTTGTCAGCGGGCTATGCCCTCTTGTGCATGTGGTAXM040339663.1
IL-17TGATAGTCACGCACTGAGTCCGATGTTCACCAGCCAGTCAATGC[14]
β-actinCATCCTTCTTGGGTATGGAATCATGGCATACAGGTCCTTACGGATAAB094353
GH, growth hormone; AMPK, amp-activated protein kinase; IGF-1, insulin-like growth factor 1; IGF-1R, insulin-like growth factor 1 receptor; IGF-2, insulin-like growth factor 2; PK, pyruvate kinase; G6PC2, glucose-6-phosphatase catalytic, 2; PYGL, glycogen phosphorylase, liver; GK, glycerol kinase; SREBP1, sterol-regulatory element binding protein 1; ACC1, acetyl-coa carboxylase 1; FAS, fatty acid synthase; PPARα, peroxisome proliferator-activated receptor alpha; CPT1α, carnitine palmitoyl transferase 1α; ACAA2, acetyl-coa acyltransferase 2; LYZ1, lysozyme 1; TJP1, tight junction protein 1; TJP2, tight junction protein 2; CLDN1, claudin 1; OCLN, occluding; RPL17, ribosomal protein L17; NF-KB, nuclear factor kappa B; TLR4, toll-like receptor 4; NLRP3, NACHT, LRR, and PYD domains containing protein 3; TNF-α, tumor necrosis factor alpha; IL-1β, Interleukin 1β; IL-8, Interleukin 8; IL-10, Interleukin 10; IL-17, Interleukin 17.
Table 3. Growth performance and proximate composition of bullfrog tadpoles subjected to different treatments.
Table 3. Growth performance and proximate composition of bullfrog tadpoles subjected to different treatments.
Groups Polynomial Contrasts (p, R2)
ItemsS0S1S2S3S4S5LinearQuadratic
Initial weight (g)0.04 ± 0.000.04 ± 0.000.04 ± 0.000.04 ± 0.000.04 ± 0.000.04 ± 0.000.524, 0.0260.707, 0.045
Final weight (g)4.69 ± 0.02 e5.34 ± 0.03 d5.41 ± 0.05 c,d5.66 ± 0.06 b6.15 ± 0.06 a5.58 ± 0.05 b,c0.001, 0.5220.000, 0.826
WGR † (%)13,066.15 ± 148.16 c15,028.36 ± 197.53 b15,127.35 ± 85.10 b15,469.35 ± 64.80 b16,173.45 ± 202.30 a15,405.86 ± 83.80 b0.002, 0.4740.000, 0.775
SGR § (%/day)5.42 ± 0.01 c5.58 ± 0.01 b5.58 ± 0.01 b5.61 ± 0.00 a,b5.66 ± 0.01 a5.60 ± 0.01 b0.002, 0.4670.000, 0.768
FCR ¶2.55 ± 0.04 a2.51 ± 0.05 a2.47 ± 0.04 a,b2.44 ± 0.03 a,b2.24 ± 0.05 c2.31 ± 0.02 b,c0.000, 0.6540.000, 0.670
FI (g/bullfrog tadpoles/d) #0.13 ± 0.00 c0.15 ± 0.00 a,b0.15 ± 0.00 a,b0.15 ± 0.00 a0.15 ± 0.00 a0.14 ± 0.00 b0.151, 0.1240.000, 0.697
CF ∫0.96 ± 0.020.97 ± 0.030.92 ± 0.030.98 ± 0.020.98 ± 0.040.91 ± 0.030.725, 0.0080.195, 0.196
PPR (%)79.17 ± 2.20 b80.83 ± 3.00 a,b82.50 ± 3.82 a,b86.67 ± 3.33 a,b93.33 ± 1.67 a85.00 ± 1.44 a,b0.017, 0.3070.011, 0.452
MR1 ↑ (%)8.33 ± 2.20 b10.00 ± 1.44 b13.33 ± 0.83 b17.50 ± 2.89 a,b23.33 ± 1.67 a17.50 ± 2.50 a,b0.001, 0.5330.000, 0.679
Proximate analysis (% dry matter basis)
Moisture80.16 ± 2.6476.69 ± 2.9077.02 ± 1.6475.23 ± 2.4976.62 ± 1.5379.15 ± 1.880.882, 0.0010.224, 0.181
Crude protein76.53 ± 0.91 c81.84 ± 0.21 a,b80.68 ± 1.03 b,c84.02 ± 0.08 a,b84.56 ± 1.46 a,b85.19 ± 0.78 a0.000, 0.6270.000, 0.712
Crude lipid14.56 ± 0.14 a,b14.4 ± 0.22 b14.51 ± 0.21 b15.91 ± 0.33 a15.03 ± 0.15 a,b15.5 ± 0.52 a,b0.015, 0.3170.034, 0.362
Ash12.37 ± 0.5112.08 ± 0.8512.98 ± 0.3911.9 ± 1.5412.3 ± 1.3412.93 ± 1.630.783, 0.0050.907, 0.013
Values are mean ± S.E.M of three replications (n = 3). Means in the same line with different superscripts are significantly different (p < 0.05). † Weight gain rate (WGR, %) = (Wt − W0) × 100/W0. §: Specific growth rate (SGR, %/day) = (LnWt − LnW0) × 100/T, where W0 and Wt are the initial and final body weights, and T is the culture period in days. ¶: Feed conversion ratio (FCR) = feed consumption (g)/bullfrog tadpole weight gain (g). #: Feed intake (FI) (g/bullfrog tadpoles/d) = total feed intake (g)/[total number of bullfrog tadpoles× days reared]. ∫: Condition factor (CF) = body weight(g) × 100/total body length (cm)3. : Post-premetamorphosis rate (PPR) = number of bullfrog tadpoles with hind limb buds at 90 days/number of bullfrog tadpoles at the start of the experiment. ↑: Metamorphosis rate (MR) = number of metamorphosed bullfrog tadpoles/initial number of tadpoles × 100.
Table 4. Intestinal enzymes activities and antioxidant parameters of bullfrog tadpoles subjected to different treatments.
Table 4. Intestinal enzymes activities and antioxidant parameters of bullfrog tadpoles subjected to different treatments.
Groups Polynomial Contrasts (p, R2)
ItemsS0S1S2S3S4S5Linear Quadratic
Amylase (U/mg protein)0.24 ± 0.01 d0.27 ± 0.00 c,d0.28 ± 0.01 c0.29 ± 0.01 c0.38 ± 0.01 a0.33 ± 0.01 b0.000, 0.5630.000, 0.601
Lipase (U/g protein)8.20 ± 0.30 e11.17 ± 0.39 d11.65 ± 0.12 d13.38 ± 0.14 c19.6 ± 0.25 a15.8 ± 0.34 b0.000, 0.8520.000, 0.806
Protease (U/mg protein)1.03 ± 0.03 e1.36 ± 0.04 d1.72 ± 0.03 c1.99 ± 0.03 b2.46 ± 0.03 a2.01 ± 0.02 b0.000, 0.6860.000, 0.919
Na+, K+-ATPase (U/g protein)44.89 ± 1.81 d59.55 ± 2.78 cd78.19 ± 2.77 c121.00 ± 5.03 b159.59 ± 12.80 a143.56 ± 3.67 a,b0.000, 0.7670.000, 0.827
AKP (U/g protein)55.28 ± 0.18 c54.10 ± 0.78 b,c60.34 ± 0.75 b,c63.28 ± 0.91 a,b68.83 ± 0.57 a60.34 ± 0.85 b,c0.002, 0.4460.000, 0.766
γ-GT (U/g protein)79.18 ± 4.85 c76.79 ± 1.66 c99.78 ± 3.53 b122.77 ± 4.97 a140.00 ± 5.37 a73.09 ± 3.04 c0.251, 0.0810.000, 0.709
CK (U/mg protein)1.47 ± 0.08 c1.85 ± 0.02 b1.95 ± 0.03 a,b1.99 ± 0.02 a,b2.12 ± 0.03 a2.06 ± 0.04 a0.000, 0.4760.000, 0.638
SOD (U/mg protein)555.75 ± 5.33 c576.85 ± 17.78 b,c600.13 ± 15.64 b,c629.39 ± 9.12 a,b669.74 ± 11.9 a580.32 ± 7.12 b,c0.064, 0.2020.000, 0.666
CAT (U/mg protein)10.35 ± 0.17 d11.32 ± 0.35 c11.89 ± 0.16 c12.92 ± 0.16 b14.01 ± 0.07 a11.35 ± 0.07 c0.000, 0.2150.000, 0.703
T-AOC (mmol/g protein)0.03 ± 0.000.03 ± 0.000.03 ± 0.000.03 ± 0.000.03 ± 0.000.03 ± 0.000.703, 0.0090.762, 0.036
MDA (nmol/mg protein)4.59 ± 0.05 a4.39 ± 0.08 a,b4.28 ± 0.04 b,c4.17 ± 0.07 b,c3.68 ± 0.05 d4.10 ± 0.06 c0.000, 0.4610.000, 0.765
Na+, K+-ATPase, sodium–potassium adenosine triphosphatase; AKP, alkaline phosphatase; γ-GT, γ-glutamyl transferase; CK, creatine kinase; SOD, superoxide dismutase; CAT, catalase; T-AOC, total antioxidant capacity; MDA, malondialdehyde. Values are mean ± S.E.M of three replications (n = 3). Means in the same line with different superscripts are significantly different (p < 0.05).
Table 5. The alpha diversity indices of intestinal microbiota of bullfrog tadpoles subjected to different treatments.
Table 5. The alpha diversity indices of intestinal microbiota of bullfrog tadpoles subjected to different treatments.
Groups Polynomial Contrasts (p, R2)
ItemsS0S1S2S3S4S5LinearQuadratic
ASV248.67 ± 3.84 a,b271.33 ± 38.92 a,b182.00 ± 25.32 b216.67 ± 19.97 a,b352.00 ± 31.34 a234.00 ± 41.14 a,b0.457, 0.0350.761, 0.036
Ace250.33 ± 3.18 a,b274.33 ± 39.96 a,b182.33 ± 25.12 b216.67 ± 19.97 a,b353.67 ± 31.86 a235.00 ± 41.04 a,b0.474, 0.0330.774, 0.034
Chao1250.33 ± 3.18 a,b274.33 ± 39.96 a,b182.33 ± 25.12 b216.67 ± 19.97 a,b353.67 ± 31.86 a235.00 ± 41.04 a,b0.474, 0.0330.774, 0.034
Shannon2.98 ± 0.122.34 ± 0.312.21 ± 0.342.46 ± 0.183.31 ± 0.132.62 ± 0.550.483, 0.0310.699, 0.047
Simpson0.14 ± 0.040.28 ± 0.070.28 ± 0.070.18 ± 0.010.10 ± 0.020.22 ± 0.130.600, 0.0180.874, 0.018
Shannoneven0.54 ± 0.020.42 ± 0.040.42 ± 0.05 b0.46 ± 0.030.56 ± 0.02 a0.48 ± 0.090.541, 0.0240.730, 0.041
Simpsoneven0.03 ± 0.010.01 ± 0.000.02 ± 0.000.03 ± 0.000.03 ± 0.010.03 ± 0.010.387, 0.0470.527, 0.082
Phylogenetic diversity28.64 ± 0.1131.04 ± 5.40 21.61 ± 2.3225.54 ± 1.5235.86 ± 3.0326.28 ± 3.720.719, 0.0080.918, 0.011
ASV, Amplicon sequence variant. Values are mean ± S.E.M of three replications (n = 3). Means in the same line with different superscripts are significantly different (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ding, H.; He, Y.; Song, Y.; Liang, J.; Li, W.; Xu, C.; Yang, H. Schizochytrium Supplementation in Compound Feed: Effects on Growth, Metamorphosis, Intermediate Metabolism, and Intestinal Health of Bullfrogs (Lithobates catesbeianus). Antioxidants 2025, 14, 1208. https://doi.org/10.3390/antiox14101208

AMA Style

Ding H, He Y, Song Y, Liang J, Li W, Xu C, Yang H. Schizochytrium Supplementation in Compound Feed: Effects on Growth, Metamorphosis, Intermediate Metabolism, and Intestinal Health of Bullfrogs (Lithobates catesbeianus). Antioxidants. 2025; 14(10):1208. https://doi.org/10.3390/antiox14101208

Chicago/Turabian Style

Ding, Hao, Yinglin He, Yujian Song, Jingjing Liang, Woxing Li, Chao Xu, and Huirong Yang. 2025. "Schizochytrium Supplementation in Compound Feed: Effects on Growth, Metamorphosis, Intermediate Metabolism, and Intestinal Health of Bullfrogs (Lithobates catesbeianus)" Antioxidants 14, no. 10: 1208. https://doi.org/10.3390/antiox14101208

APA Style

Ding, H., He, Y., Song, Y., Liang, J., Li, W., Xu, C., & Yang, H. (2025). Schizochytrium Supplementation in Compound Feed: Effects on Growth, Metamorphosis, Intermediate Metabolism, and Intestinal Health of Bullfrogs (Lithobates catesbeianus). Antioxidants, 14(10), 1208. https://doi.org/10.3390/antiox14101208

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop