The Flavonoid Extract of Polygonum viviparum L. Alleviates Dextran Sulfate Sodium-Induced Ulcerative Colitis by Regulating Intestinal Flora Homeostasis and Uric Acid Levels Through Inhibition of PI3K/AKT/NF-κB/IL-17 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Preparation and Identification of TFPV
2.3. Cell Culture
2.4. Cell Viability Assay and Establishment of LPS-Induced Inflammatory Model in IPEC-J2 Cells
2.5. Animals
2.6. Establishment of LPS-Induced Intestinal Inflammation Model in Mice
2.7. Network Pharmacology Analysis
2.8. Establishment of Ulcerative Colitis Model in Mice
2.9. Histopathological Evaluation
2.10. Enzyme-Linked Immunosorbent (ELISA) Assay
2.11. Immunohistochemical (IHC) Analysis
2.12. RNA Extraction and Quantitative Real-Time PCR Analysis (RT-qPCR)
2.13. Western Blotting Analysis
2.14. 16S rRNA Gene-Based Microbial Community Analysis
2.15. Metabolomic Analysis
2.16. Statistical Analysis
3. Results
3.1. Identification of Components in TFPV
3.2. TFPV Can Effectively Alleviate Inflammation of LPS-Induced IPEC-J2 Cells
3.3. TFPV Improves LPS-Induced Intestinal Inflammation in Mice by Enhancing the Intestinal Barrier Function
3.4. Targets Prediction of TFPV for UC by Network Pharmacology
3.5. TFPV Alleviates DSS-Induced UC in Mice by Regulating Intestinal Inflammatory Levels and Enhancing Intestinal Barrier Function
3.6. TFPV Enhances the Diversity of the Intestinal Microbiota and Reverses the DSS-Induced Dysbiosis in Mice
3.7. TFPV Regulates Purine Metabolism and Reduces Uric Acid Levels in Mice with DSS-Induced UC
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ADP | Adenosine Diphosphate |
| AKT | Protein Kinase B |
| BP | Biological Processes |
| CC | Cellular Components |
| DAI | Disease Activity Index |
| dGMP | 2′-Deoxyguanosine 5′-Monophosphate |
| DSS | Dextran sulfate sodium |
| ELISA | Enzyme-Linked Immunosorbent |
| FC | Fold Change |
| H&E | Hematoxylin and Eosin |
| IBD | Inflammatory Bowel Disease |
| IHC | Immunohistochemical |
| IL-6 | Interleukin-6 |
| IL-10 | Interleukin-10 |
| IL-1β | Interleukin-1 Beta |
| IL-17 | Interleukin-17 |
| LPS | Lipopolysaccharide |
| LC-MS | Liquid Chromatography-Mass Spectrometry |
| MF | Molecular Functions |
| MAPK | Mitogen-Activated Protein Kinase |
| NF-κB | Nuclear Factor-κB |
| OPLS-DA | Orthogonal Projections to Latent Structures-Discriminant Analysis |
| PI3K | Phosphatidylinositol 3-Kinase |
| RT-qPCR | RNA Extraction And Quantitative Real-Time PCR Analysis |
| TFPV | Total Flavonoids of Polygonum viviparum L. |
| TJ | Tight Junctions |
| TNF-α | Tumor Necrosis Factor Alpha |
| UA | Uric Acid |
| UC | Ulcerative Colitis |
| VIP | Variable Importance In Projection |
References
- Le Berre, C.; Honap, S.; Peyrin-Biroulet, L. Ulcerative colitis. Lancet 2023, 402, 571–584. [Google Scholar] [CrossRef] [Scilit]
- Goodman, W.A.; Erkkila, I.P.; Pizarro, T.T. Sex matters: Impact on pathogenesis, presentation and treatment of inflammatory bowel disease. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 740–754. [Google Scholar] [CrossRef] [Scilit]
- Danpanichkul, P.; Duangsonk, K.; Ho, A.H.Y.; Laoveeravat, P.; Vuthithammee, C.; Dejvajara, D.; Prasitsumrit, V.; Auttapracha, T.; Songtanin, B.; Wetwittayakhlang, P.; et al. Disproportionately Increasing Incidence of Inflammatory Bowel Disease in Female Patients and the Elderly: An Update Analysis from the Global Burden of Disease Study 2021. Am. J. Gastroenterol. 2025, 120, 675–680. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.C.; Stappenbeck, T.S. Genetics and Pathogenesis of Inflammatory Bowel Disease. Annu. Rev. Pathol. 2016, 23, 127–148. [Google Scholar] [CrossRef] [Scilit]
- Poma, P. NF-κB and Disease. Int. J. Mol. Sci. 2020, 21, 9181. [Google Scholar] [CrossRef] [Scilit]
- Brembilla, N.C.; Senra, L.; Boehncke, W.H. The IL-17 Family of Cytokines in Psoriasis: IL-17A and Beyond. Front. Immunol. 2018, 9, 1682. [Google Scholar] [CrossRef] [Scilit]
- Gros, B.; Kaplan, G.G. Ulcerative Colitis in Adults: A Review. JAMA 2023, 330, 951–965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dorrington, A.M.; Selinger, C.P.; Parkes, G.C.; Smith, M.; Pollok, R.C.; Raine, T. The Historical Role and Contemporary Use of Corticosteroids in Inflammatory Bowel Disease. J. Crohns Colitis. 2020, 14, 1316–1329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lavelle, A.; Sokol, H. Gut microbiota-derived metabolites as key actors in inflammatory bowel disease. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 223–237. [Google Scholar] [CrossRef] [Scilit]
- Vestergaard, M.V.; Allin, K.H.; Eriksen, C.; Zakerska-Banaszak, O.; Arasaradnam, R.P.; Alam, M.T.; Kristiansen, K.; Brix, S.; Jess, T. Gut microbiota signatures in inflammatory bowel disease. United Eur. Gastroenterol. J. 2024, 12, 22–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Y.; Chen, Z.; Xu, C.; Kan, S.; Chen, D. Disturbances of the Gut Microbiota and Microbiota-Derived Metabolites in Inflammatory Bowel Disease. Nutrients 2022, 14, 5140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, R.; Xiong, R.; Li, Y.; Chen, J.; Yan, R. Gut microbiome, metabolome, host immunity associated with inflammatory bowel disease and intervention of fecal microbiota transplantation. J. Autoimmun. 2023, 141, 103062. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Zhou, S.; Han, Z.; Yu, B.; Xu, Y.; Lin, Y.; Chen, Y.; Jin, Z.; Li, Y.; Cao, Q.; et al. From gut to brain: Understanding the role of microbiota in inflammatory bowel disease. Front. Immunol. 2024, 15, 1384270. [Google Scholar] [CrossRef] [Scilit]
- Zhu, S.; Han, M.; Liu, S.; Fan, L.; Shi, H.; Li, P. Composition and diverse differences of intestinal microbiota in ulcerative colitis patients. Front. Cell Infect. Microbiol. 2022, 12, 953962. [Google Scholar] [CrossRef] [Scilit]
- Dong, L.N.; Wang, M.; Guo, J.; Wang, J.P. Role of intestinal microbiota and metabolites in inflammatory bowel disease. Chin. Med. J. 2019, 132, 1610–1614. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.; Zhang, X.; Zhu, X.; Jiao, J.; Wu, Y.; Li, Y.; Zhao, L. Fusobacterium nucleatum aggravates ulcerative colitis through promoting gut microbiota dysbiosis and dysmetabolism. J. Periodontol. 2023, 94, 405–418. [Google Scholar] [CrossRef] [Scilit]
- Hamid, O.; Alsabbagh Alchirazi, K.; Eltelbany, A.; Nanah, R.; Regueiro, M. Increased prevalence of gout in patients with inflammatory bowel disease: A population-based study. JGH Open 2023, 7, 640–644. [Google Scholar] [CrossRef] [Scilit]
- Zu, M.; Liu, G.; Xu, H.; Zhu, Z.; Zhen, J.; Li, B.; Shi, X.; Shahbazi, M.A.; Reis, R.L.; Kundu, S.C.; et al. Extracellular Vesicles from Nanomedicine-Trained Intestinal Microbiota Substitute for Fecal Microbiota Transplant in Treating Ulcerative Colitis. Adv. Mater. 2024, 36, e2409138. [Google Scholar] [CrossRef] [Scilit]
- Tie, Y.; Huang, Y.; Chen, R.; Li, L.; Chen, M.; Zhang, S. Current insights on the roles of gut microbiota in inflammatory bowel disease-associated extra-intestinal manifestations: Pathophysiology and therapeutic targets. Gut Microbes 2023, 15, 2265028. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Wang, L.; Gu, Y.; Hou, H.; Liu, T.; Ding, Y.; Cao, H. Dietary Patterns and Gut Microbiota Changes in Inflammatory Bowel Disease: Current Insights and Future Challenges. Nutrients 2022, 14, 4003. [Google Scholar] [CrossRef] [Scilit]
- Rifat-uz-Zaman; Akhtar, M.S.; Khan, M.S. Protective effects of Polygonum viviparum L. root and its extracts against lipid-peroxidation induced by indomethacin in rats. Int. J. Pharmacol. 2005, 1, 324–328. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Hu, F. Analysis and Evalution of Nutritional Components in Fruits of Polygonum viviparum L. Nat. Product. R. D 2005, 17, 614–616. [Google Scholar]
- Shi, L.; Fang, B.; Yong, Y.; Li, X.; Gong, D.; Li, J.; Yu, T.; Gooneratne, R.; Gao, Z.; Li, S.; et al. Chitosan oligosaccharide-mediated attenuation of LPS-induced inflammation in IPEC-J2 cells is related to the TLR4/NF-κB signaling pathway. Carbohydr. Polym. 2019, 219, 269–279. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Yang, C.L.; Sha, Y.K.; Wu, Y.; Liu, Z.Y.; Yuan, Z.H.; Sun, Z.L. Koumine Alleviates Lipopolysaccharide-Induced Intestinal Barrier Dysfunction in IPEC-J2 Cells by Regulating Nrf2/NF-κB Pathway. Am. J. Chin. Med. 2020, 48, 127–142. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhang, X.; Su, J.; Chu, X. Acanthopanax senticosus total flavonoids alleviate lipopolysaccharide-induced intestinal inflammation and modulate the gut microbiota in mice. Biosci. Rep. 2022, 42, BSR20212670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.Q.; Lv, X.Y.; Liu, S.J. Baitouweng decoction alleviates dextran sulfate sodium-induced ulcerative colitis by regulating intestinal microbiota and the IL-6/STAT3 signaling pathway. J. Ethnopharmacol. 2021, 265, 113357. [Google Scholar]
- Li, L.; Cui, H.; Zhang, Y.; Xie, W.; Lin, Y.; Guo, Y.; Huang, T.; Xue, B.; Guo, W.; Huang, Z.; et al. Baicalin ameliorates multidrug-resistant Pseudomonas aeruginosa induced pulmonary inflammation in rat via arginine biosynthesis. Biomed. Pharmacother. 2023, 162, 114660. [Google Scholar] [CrossRef] [Scilit]
- Li, M.X.; Li, M.Y.; Lei, J.X.; Wu, Y.Z.; Li, Z.H.; Chen, L.M.; Zhou, C.L.; Su, J.Y.; Huang, G.X.; Huang, X.Q.; et al. Huangqin decoction ameliorates DSS-induced ulcerative colitis: Role of gut microbiota and amino acid metabolism, mTOR pathway and intestinal epithelial barrier. Phytomedicine 2022, 100, 154052. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Geng, T.; Sun, K.; Su, S.; Zhao, Y.; Bao, N.; Pan, L.; Sun, H.; Li, M. Proteomic analysis reveals the molecular mechanism of Hippophae rhamnoides polysaccharide intervention in LPS-induced inflammation of IPEC-J2 cells in piglets. Int. J. Biol. Macromol. 2020, 164, 3294–3304. [Google Scholar] [CrossRef] [Scilit]
- Abdulfatai, U.; Uzairu, A.; Uba, S. Quantitative structure-activity relationship and molecular docking studies of a series of quinazolinonyl analogues as inhibitors of gamma amino butyric acid aminotransferase. J. Adv. Res. 2017, 8, 33–43. [Google Scholar] [CrossRef] [Scilit]
- Hu, Q.; Xie, J.; Jiang, T.; Gao, P.; Chen, Y.; Zhang, W.; Yan, J.; Zeng, J.; Ma, X.; Zhao, Y. Paeoniflorin alleviates DSS-induced ulcerative colitis by suppressing inflammation, oxidative stress, and apoptosis via regulating serum metabolites and inhibiting CDC42/JNK signaling pathway. Int. Immunopharmacol. 2024, 142 Pt A, 113039. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Jiang, W.; Yu, B.; Liang, H.; Mao, S.; Hu, X.; Feng, Y.; Xu, J.; Chu, L. Quercetin improves cerebral ischemia/reperfusion injury by promoting microglia/macrophages M2 polarization via regulating PI3K/Akt/NF-κB signaling pathway. Biomed. Pharmacother. 2023, 168, 115653. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.W.J.; Plichta, D.; Hogstrom, L.; Borren, N.Z.; Lau, H.; Gregory, S.M.; Tan, W.; Khalili, H.; Clish, C.; Vlamakis, H.; et al. Multi-omics reveal microbial determinants impacting responses to biologic therapies in inflammatory bowel disease. Cell Host Microbe 2021, 29, 1294–1304.e4. [Google Scholar] [CrossRef] [Scilit]
- Cui, L.; Guan, X.; Ding, W.; Luo, Y.; Wang, W.; Bu, W.; Song, J.; Tan, X.; Sun, E.; Ning, Q.; et al. Scutellaria baicalensis Georgi polysaccharide ameliorates DSS-induced ulcerative colitis by improving intestinal barrier function and modulating gut microbiota. Int. J. Biol. Macromol. 2021, 166, 1035–1045. [Google Scholar] [CrossRef] [Scilit]
- He, H.; Tang, C.; Cao, Z.; Wang, T.; He, M.; Xiao, M.; Xiao, L.; Li, Y.; Li, X. Revealing Medicinal Constituents of Bistorta vivipara Based on Non-Targeted Metabolomics and 16S rDNA Gene Sequencing Technology. Molecules 2024, 29, 860. [Google Scholar] [CrossRef] [Scilit]
- Qian, Z.M.; Cheng, X.J.; Wang, Q.; Huang, Q.; Jin, L.L.; Ma, Y.F.; Xie, J.S.; Li, D.Q. On-line pre-column FRAP-based antioxidant reaction coupled with HPLC-DAD-TOF/MS for rapid screening of natural antioxidants from different parts of Polygonum viviparum. RSC Adv. 2023, 13, 9585–9594. [Google Scholar] [CrossRef] [Scilit]
- Niu, X.; Wang, Y.; Li, W.; Zhang, H.; Wang, X.; Mu, Q.; He, Z.; Yao, H. Esculin exhibited anti-inflammatory activities in vivo and regulated TNF-α and IL-6 production in LPS-stimulated mouse peritoneal macrophages in vitro through MAPK pathway. Int. Immunopharmacol. 2015, 29, 779–786. [Google Scholar] [CrossRef] [Scilit]
- Yu, R.Y.; Zhou, Q.L.Y.; Liu, T.L.; Liu, P.; Li, H.; Bian, Y.F.; Liu, Z.J. Kaempferol relieves the DSS-induced chronic colitis in C57BL/6J mice, alleviates intestinal angiogenesis, and regulates colonic microflora structure. J. Funct. Foods. 2023, 107, 105646. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Du, P.; Du, Y.; Zhao, D.; Cai, Y.; Yang, Q.; Guo, Z. Luteolin alleviates inflammation and modulates gut microbiota in ulcerative colitis rats. Life Sci. 2021, 269, 119008. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Xie, X.; Li, Y.; Xie, X.; Huang, S.; Pan, S.; Zou, Y.; Pan, Z.; Wang, Q.; Chen, J.; et al. Quercetin ameliorates ulcerative colitis by activating aryl hydrocarbon receptor to improve intestinal barrier integrity. Phytother. Res. 2024, 38, 253–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajendra, S.; Nasiruddin, N.; Sateesh, A.; Vinoth, R.; Mahesh, K.J.; Ramakrishna, S. Protective effect of galangin against dextran sulfate sodium (DSS)-induced ulcerative colitis in Balb/c mice. Inflamm. Res. 2019, 68, 691–704. [Google Scholar]
- Granica, S.; Czerwinska, M.E.; Zyzynska-Granica, B.; Kiss, A.K. Antioxidant and anti-inflammatory flavonol glucuronides from Polygonum aviculare L. Fitoterapia 2013, 91, 180–188. Fitoterapia 2013, 91, 180–188. [Google Scholar] [CrossRef] [Scilit]
- Bencsics, M.; Bányai, B.; Ke, H.; Csépányi-Kömi, R.; Sasvári, P.; Dantzer, F.; Hanini, N.; Benkő, R.; Horváth, E.M. PARP2 downregulation in T cells ameliorates lipopolysaccharide-induced inflammation of the large intestine. Front. Immunol. 2023, 14, 1135410. [Google Scholar] [CrossRef] [Scilit]
- Cheng, H.W.; Lee, K.C.; Cheah, K.P.; Chang, M.L.; Lin, C.W.; Li, J.S.; Yu, W.Y.; Liu, E.T.; Hu, C.M. Polygonum viviparum L. inhibits the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages through haem oxygenase-1 induction and activation of the Nrf2 pathway. J. Sci. Food Agric. 2013, 93, 491–497. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Chen, X.; Cai, R.; Chen, X.; Zhang, J.; Xie, J.; Shen, M. Sulfated Chinese Yam Polysaccharides Alleviate LPS-Induced Acute Inflammation in Mice through Modulating Intestinal Microbiota. Foods 2023, 12, 1772. [Google Scholar] [CrossRef] [Scilit]
- Papenkort, S.; Borsdorf, M.; Böl, M.; Siebert, T. A geometry model of the porcine stomach featuring mucosa and muscle layer thicknesses. J. Mech. Behav. Biomed. Mater. 2023, 142, 105801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.L.; Li, Q.Q.; Xiong, B.; Chen, H.L.; Wang, X.C.; Zhang, D.K. Discoidin domain receptor 1(DDR1) promote intestinal barrier disruption in Ulcerative Colitis through tight junction proteins degradation and epithelium apoptosis. Pharmacol. Res. 2022, 183, 106368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, L.; Xie, J.; Wang, Y.; Jiang, H.; Chen, K.; Li, D.; Wang, J.; Liu, Y.; He, J.; Zhou, J.; et al. Mannose ameliorates experimental colitis by protecting intestinal barrier integrity. Nat. Commun. 2022, 13, 4804. [Google Scholar] [CrossRef] [Scilit]
- Zhu, F.; Zhi, Y.; Li, Y.; Niu, H.; Ren, S. The Mechanism of Polygonum Hydropiper L-Coptis Chinensis in the Treatment of Ulcerative Colitis Based on Network Pharmacology and Experimental Validation. Front. Biosci. 2024, 29, 93. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Wang, Q.; Wang, M.; Liu, Y.; Chen, L.; Wang, F.; Chen, H. Integrated metabolomics and network pharmacology revealed the key active ingredients for the treatment of ulcerative colitis in the Citrus reticulata ‘Dahongpao’ peel. J. Pharm. Biomed. Anal. 2024, 239, 115887. [Google Scholar] [CrossRef] [Scilit]
- Hu, C.H.; Chen, Y.; Jin, T.Y.; Wang, Z.; Jin, B.; Liao, J.; Ding, C.Y.; Zhang, A.; Tang, W.Y.; Zhang, L.X.; et al. A derivative of tanshinone IIA and salviadione, 15a, inhibits inflammation and alleviates DSS-induced colitis in mice by direct binding and inhibition of RIPK2. Acta Pharmacol. Sin. 2025, 46, 672–686. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.H.; Zeng, Y.W.; Wen, Y.L.; Huang, X.G.; Liu, Y. Natural Products Modulate Cell Apoptosis: A Promising Way for the Treatment of Ulcerative Colitis. Front. Pharmacol. 2022, 13, 806148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, S.; Sun, Y.Q.; Huo, J.X.; Xu, W.Y.; Yang, Y.N.; Yang, J.B.; Wu, W.J.; Liu, Y.X.; Wu, C.M.; Li, Y.G. The gut microbiota-aromatic hydrocarbon receptor (AhR) axis mediates the anticolitic effect of polyphenol-rich extracts from Sanghuangporus. Imeta 2024, 3, e180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bischoff, S.C.; Barbara, G.; Buurman, W.; Ockhuizen, T.; Schulzke, J.D.; Serino, M.; Tilg, H.; Watson, A.; Wells, J.M. Intestinal permeability--a new target for disease prevention and therapy. BMC Gastroenterol. 2014, 14, 189. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhang, F.; Li, Y.; Fan, N.; Zhao, K.; Zhang, A.; Kang, J.; Lin, Y.; Xue, X.; Jiang, X. Blockade of PI3K/AKT signaling pathway by Astragaloside IV attenuates ulcerative colitis via improving the intestinal epithelial barrier. J. Transl. Med. 2024, 22, 406. [Google Scholar] [CrossRef] [Scilit]
- Cole, P.A.; Chu, N.; Salguero, A.L.; Bae, H. AKTivation mechanisms. Curr. Opin. Struct. Biol. 2019, 59, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Arab, H.H.; Al-Shorbagy, M.Y.; Saad, M.A. Activation of autophagy and suppression of apoptosis by dapagliflozin attenuates experimental inflammatory bowel disease in rats: Targeting AMPK/mTOR, HMGB1/RAGE and Nrf2/HO-1 pathways. Chem. Biol. Interact. 2021, 335, 109368. [Google Scholar] [CrossRef] [Scilit]
- Li, N.; Zhao, L.; Geng, X.; Liu, J.; Zhang, X.; Hu, Y.; Qi, J.; Chen, H.; Qiu, J.; Zhang, X.; et al. Stimulation by exosomes from hypoxia-preconditioned hair follicle mesenchymal stem cells facilitates mitophagy by inhibiting the PI3K/AKT/mTOR signaling pathway to alleviate ulcerative colitis. Theranostics 2024, 14, 4278–4296. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Wang, L.; Zhao, J.; Wei, Y.; Zhai, S.; Tan, M.; Guan, K.; Huang, Z.; Chen, C. Lonicera rupicola Hook.f.et Thoms flavonoids ameliorated dysregulated inflammatory responses, intestinal barrier, and gut microbiome in ulcerative colitis via PI3K/AKT pathway. Phytomedicine 2022, 104, 154284. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Liu, H.; Li, Z.; Yang, Q.; Wang, Q.; Yang, T.; Tang, D.; Wang, C.; Liu, J. Oleanolic acid 28-O-β-D-glucopyranoside: A novel therapeutic agent against ulcerative colitis via anti-inflammatory, barrier-preservation, and gut microbiota-modulation. Biomed. Pharmacother. 2024, 180, 117534. [Google Scholar] [CrossRef] [Scilit]
- Do, K.H.; Ko, S.H.; Kim, K.B.; Seo, K.; Lee, W.K. Comparative Study of Intestinal Microbiome in Patients with Ulcerative Colitis and Healthy Controls in Korea. Microorganisms 2023, 11, 2750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barberio, B.; Bertazzo, E.; Marinelli, C.; Massimi, D.; Ghisa, M.; Gubbiotti, A.; Casadei, C.; Lorenzon, G.; Zingone, F.; D’Incà, R.; et al. Intestinal microbiota changes according to disease activity in patients with ulcerative colitis. J. Crohns Colitis. 2020, 14, S651–S652. [Google Scholar] [CrossRef] [Scilit]
- van de Guchte, M.; Mondot, S.; Doré, J. Dynamic Properties of the Intestinal Ecosystem Call for Combination Therapies, Targeting Inflammation and Microbiota, in Ulcerative Colitis. Gastroenterology 2021, 161, 1969–1981.e12. [Google Scholar] [CrossRef] [Scilit]
- Kayama, H.; Okumura, R.; Takeda, K. Interaction Between the Microbiota, Epithelia, and Immune Cells in the Intestine. Annu. Rev. Immunol. 2020, 38, 23–48. [Google Scholar] [CrossRef] [Scilit]
- Gu, K.; Wu, A.; Yu, B.; Zhang, T.; Lai, X.; Chen, J.; Yan, H.; Zheng, P.; Luo, Y.; Luo, J.; et al. Iron overload induces colitis by modulating ferroptosis and interfering gut microbiota in mice. Sci. Total Environ. 2023, 905, 167043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wan, F.; Han, H.; Zhong, R.; Wang, M.; Tang, S.; Zhang, S.; Hou, F.; Yi, B.; Zhang, H. Dihydroquercetin supplement alleviates colonic inflammation potentially through improved gut microbiota community in mice. Food Funct. 2021, 12, 11420–11434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.C.; Yang, S.Q.; Fan, L.J.; Luo, L.; Lei, W.Z.; Tan, P.; Yue, T.; Gao, Z. Investigating the contribution of mulberry leaf Fu tea to ameliorating metabolic disorders and remodeling gut microbiota in diabetic mice. Food Front. 2023, 4, 1496–1510. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Tu, S.; Ji, X.; Wu, J.; Meng, J.; Gao, J.; Shao, X.; Shi, S.; Wang, G.; Qiu, J.; et al. Dubosiella newyorkensis modulates immune tolerance in colitis via the L-lysine-activated AhR-IDO1-Kyn pathway. Nat. Commun. 2024, 15, 1333. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.Y.; Cevallos, S.A.; Byndloss, M.X.; Tiffany, C.R.; Olsan, E.E.; Butler, B.P.; Young, B.M.; Rogers, A.W.L.; Nguyen, H.; Kim, K.; et al. High-Fat Diet and Antibiotics Cooperatively Impair Mitochondrial Bioenergetics to Trigger Dysbiosis that Exacerbates Pre-inflammatory Bowel Disease. Cell Host Microbe 2020, 28, 273–284.e6. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Wang, H.; Hong, T.; Huang, X.; Xia, S.; Zhang, Y.; Chen, X.; Zhong, Y.; Nie, S. Effects of tea polysaccharides in combination with polyphenols on dextran sodium sulfate-induced colitis in mice. Food Chem. X 2021, 13, 100190. [Google Scholar] [CrossRef] [Scilit]
- Khorsand, B.; Aghdaei, H.A.; Nazemalhosseini-Mojarad, E.; Nadalian, B.; Nadalian, B.; Houri, H. Overrepresentation of Enterobacteriaceae and Escherichia coli is the major gut microbiome signature in Crohn’s disease and ulcerative colitis; a comprehensive metagenomic analysis of IBDMDB datasets. Front. Cell Infect. Microbiol. 2022, 12, 1015890. [Google Scholar] [CrossRef] [Scilit]
- Crittenden, S.; Cheyne, A.; Adams, A.; Forster, T.; Robb, C.T.; Felton, J.; Ho, G.T.; Ruckerl, D.; Rossi, A.G.; Anderton, S.M.; et al. Purine metabolism controls innate lymphoid cell function and protects against intestinal injury. Immunol. Cell Biol. 2018, 96, 1049–1059. [Google Scholar] [CrossRef] [Scilit]
- Linden, J.; Koch-Nolte, F.; Dahl, G. Purine Release, Metabolism, and Signaling in the Inflammatory Response. Annu. Rev. Immunol. 2019, 37, 325–347. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Wei, Z.; Cheng, P.; Qian, C.; Xu, F.; Yang, Y.; Wang, A.; Chen, W.; Sun, Z.; Lu, Y. Rhein modulates host purine metabolism in intestine through gut microbiota and ameliorates experimental colitis. Theranostics 2020, 10, 10665–10679. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Tao, W.; Zhou, W.; Xing, J.; Luo, M.; Lu, S.; Yang, Y. Dendrobium officinale polysaccharides alleviated DSS-induced ulcerative colitis in mice through remolding gut microbiota to regulate purine metabolism. J. Funct. Foods 2024, 119, 106336. [Google Scholar] [CrossRef] [Scilit]
- Kasahara, K.; Kerby, R.L.; Zhang, Q.; Pradhan, M.; Mehrabian, M.; Lusis, A.J.; Bergström, G.; Bäckhed, F.; Rey, F.E. Gut bacterial metabolism contributes to host global purine homeostasis. Cell Host Microbe 2023, 31, 1038–1053.e10. [Google Scholar] [CrossRef] [Scilit]











| Gene | Primer Sequences (5′ to 3′) | Fragment Size (bp) | |
|---|---|---|---|
| β-actin | Forward | TTCTAGGCGGACTTGCAGC | 128 |
| Reverse | GCTTCTCAGCAGACAGGAGG | ||
| Claudin-1 | Forward | TCTTTCTTATTTCAGGTCTGGCT | 91 |
| Reverse | ACTGGGGTCATGGGGTCATA | ||
| Occludin | Forward | CAGGTGCACCCTCCAGATTG | 111 |
| Reverse | TGGACTTTCAAGAGGCCTGG | ||
| ZO-1 | Forward | GAAATACCTGACGGTGCTGC | 99 |
| Reverse | GAGGATGGCGTTACCCACAG | ||
| IL-6 | Forward | AAGCTGCAGTCACAGAACGA | 136 |
| Reverse | TGGACGGCATCAATCTCAGG | ||
| IL-10 | Forward | CGGCCCAGTGAAGAGTTTCT | 98 |
| Reverse | GGCAACCCAGGTAACCCTTA | ||
| IL-1β | Forward | CCAATTCAGGGACCCTACCC | 174 |
| Reverse | GTTTTGGGTGCAGCACTTCAT | ||
| TNF-α | Forward | GGCCCAAGGACTCAGATCAT | 82 |
| Reverse | CTGTCCCTCGGCTTTGACAT | ||
| NO | Name | Formula | Mass (Da) | [M-H]- | Error (ppm) | Rt (min) |
|---|---|---|---|---|---|---|
| 1 | DTXSID601174808 | C16H23NO9S2 | 437.49 | 436.07 | 1.18 | 0.645 |
| 2 | N2-(1-Deoxy-I(2)-D-fructopyranos-1-yl)-L-arginine | C12H24N4O7 | 336.34 | 335.15 | 1.6 | 0.662 |
| 3 | Cotinine N-glucuronide | C16H20N2O7 | 352.34 | 351.12 | 2.6 | 1.062 |
| 4 | beta-Glucogallin | C13H16O10 | 332.26 | 331.06 | 0.9 | 1.508 |
| 5 | Erioflorin methacrylate | C25H22FNO3 | 403.45 | 402.15 | 1 | 1.913 |
| 6 | Esculin * | C15H16O9 | 340.28 | 339.07 | 1.18 | 2.551 |
| 7 | Pentoxifylline | C13H18N4O3 | 278.31 | 277.13 | 0.6 | 3.36 |
| 8 | Kaempferin * | C21H20O10 | 432.38 | 431.09 | 0.7 | 4.201 |
| 9 | Gallic acid | C7H6O5 | 170.12 | 169.01 | 0.5 | 5.273 |
| 10 | Luteolin * | C15H10O6 | 286.23 | 285.04 | 0.71 | 5.146 |
| 11 | Bispyribac | C19H18N4O8 | 430.37 | 429.10 | 0.79 | 5.991 |
| 12 | Procodazole | C10H10N2O2 | 190.2 | 189.07 | 0.8 | 6.285 |
| 13 | Galangin * | C15H10O5 | 270.24 | 269.05 | 0.8 | 6.514 |
| 14 | Querciturone * | C21H18O13 | 478.36 | 477.07 | 0.08 | 7.635 |
| 15 | Paucin | C23H32O10 | 468.49 | 467.19 | 0.1 | 9.163 |
| 16 | Melanoxetin * | C15H10O7 | 302.24 | 301.03 | 0.18 | 9.878 |
| 17 | Tetradecanoic acid | C14H28O2 | 228.37 | 227.20 | 0.3 | 10.49 |
| 18 | DTXSID401101613 | C44H64O16 | 848.97 | 847.41 | 0.32 | 11.529 |
| 19 | Hexadecanamide | C16H33NO | 255.44 | 254.25 | 0.5 | 12.169 |
| 20 | Furanodiene | C15H20O | 216.32 | 215.14 | 0.2 | 14.889 |
| 21 | Acrovestone | C32H42O8 | 554.67 | 553.28 | 0.22 | 15.832 |
| 22 | 10-Gingerol | C21H34O4 | 350.49 | 349.28 | 0.25 | 16.734 |
| 23 | L-Ascorbyl 6-Stearate | C24H42O7 | 442.59 | 441.28 | 0.27 | 18.252 |
| 24 | Stearyl citrate | C24H46O8 | 462.62 | 461.31 | 0.63 | 19.631 |
| 25 | Misoprostol acid | C21H36O5 | 368.51 | 367.25 | 0.45 | 21.257 |
| 26 | (6S,7R)-2-azaspiro [5.5] undecan-7-ol | C10H19NO | 169.26 | 168.14 | 0.68 | 21.635 |
| 27 | Phorbol 12-tiglate 13-decanoate | C35H52O8 | 600.78 | 599.36 | 0.4 | 22.949 |
| 28 | Irehine | C23H39NO | 345.56 | 344.29 | 0.69 | 23.265 |
| 29 | beta-Sitosterol | C29H50O | 414.73 | 413.38 | 0.27 | 25.321 |
| 30 | 1,1′-(1,4-Dihydro-4-nonyl-3,5-pyridinediyl) bis [1-decanone] | C34H61NO2 | 515.85 | 514.46 | 0.31 | 25.739 |
| 31 | Uvaricin | C39H68O7 | 648.95 | 647.49 | 1 | 27.043 |
| 32 | 1,2-Di-O-palmitoyl-3-O-(6-sulfoquinovopyranosyl) glycerol | C41H78O12S | 795.12 | 793.51 | 0.32 | 27.13 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Yang, Z.; Chen, Q.; Zhang, H.; Liu, Y.; Wu, D.; Shao, D.; Wang, S.; Hao, B. The Flavonoid Extract of Polygonum viviparum L. Alleviates Dextran Sulfate Sodium-Induced Ulcerative Colitis by Regulating Intestinal Flora Homeostasis and Uric Acid Levels Through Inhibition of PI3K/AKT/NF-κB/IL-17 Signaling Pathway. Antioxidants 2025, 14, 1206. https://doi.org/10.3390/antiox14101206
Liu H, Yang Z, Chen Q, Zhang H, Liu Y, Wu D, Shao D, Wang S, Hao B. The Flavonoid Extract of Polygonum viviparum L. Alleviates Dextran Sulfate Sodium-Induced Ulcerative Colitis by Regulating Intestinal Flora Homeostasis and Uric Acid Levels Through Inhibition of PI3K/AKT/NF-κB/IL-17 Signaling Pathway. Antioxidants. 2025; 14(10):1206. https://doi.org/10.3390/antiox14101206
Chicago/Turabian StyleLiu, Haoyu, Zhen Yang, Qian Chen, Hongjuan Zhang, Yu Liu, Di Wu, Dan Shao, Shengyi Wang, and Baocheng Hao. 2025. "The Flavonoid Extract of Polygonum viviparum L. Alleviates Dextran Sulfate Sodium-Induced Ulcerative Colitis by Regulating Intestinal Flora Homeostasis and Uric Acid Levels Through Inhibition of PI3K/AKT/NF-κB/IL-17 Signaling Pathway" Antioxidants 14, no. 10: 1206. https://doi.org/10.3390/antiox14101206
APA StyleLiu, H., Yang, Z., Chen, Q., Zhang, H., Liu, Y., Wu, D., Shao, D., Wang, S., & Hao, B. (2025). The Flavonoid Extract of Polygonum viviparum L. Alleviates Dextran Sulfate Sodium-Induced Ulcerative Colitis by Regulating Intestinal Flora Homeostasis and Uric Acid Levels Through Inhibition of PI3K/AKT/NF-κB/IL-17 Signaling Pathway. Antioxidants, 14(10), 1206. https://doi.org/10.3390/antiox14101206

