Figure 1.
Reactive oxygen species production of the rotenone and 6-OHDA-induced differentiated SH-SY5Y cells. ROS was measured using a Fluorometric Intracellular ROS kit and was expressed as a percentage of the control cells’ production. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was four in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 1.
Reactive oxygen species production of the rotenone and 6-OHDA-induced differentiated SH-SY5Y cells. ROS was measured using a Fluorometric Intracellular ROS kit and was expressed as a percentage of the control cells’ production. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was four in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g001 Antioxidants 13 00917 g001]()
Figure 2.
Small-molecule antioxidant capacity of the treated cells. The antioxidant capacity was measured using a Total Antioxidant Capacity Assay kit and Protein Mask and was expressed as nmol/μL. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. There were three technical replicates in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 2.
Small-molecule antioxidant capacity of the treated cells. The antioxidant capacity was measured using a Total Antioxidant Capacity Assay kit and Protein Mask and was expressed as nmol/μL. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. There were three technical replicates in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g002 Antioxidants 13 00917 g002]()
Figure 3.
Concentration determination of the protein antioxidants in the treated cells. The protein antioxidant capacity was calculated from the total antioxidant capacity minus the small-molecule antioxidant capacity using the Total Antioxidant Capacity Assay kit and was expressed as nmol/μL. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA + Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 3.
Concentration determination of the protein antioxidants in the treated cells. The protein antioxidant capacity was calculated from the total antioxidant capacity minus the small-molecule antioxidant capacity using the Total Antioxidant Capacity Assay kit and was expressed as nmol/μL. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA + Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g003 Antioxidants 13 00917 g003]()
Figure 4.
Secretion measurements of IL-6 pro-inflammatory cytokine from the treated SH-SY5Y cells. The IL-6 cytokine concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 4.
Secretion measurements of IL-6 pro-inflammatory cytokine from the treated SH-SY5Y cells. The IL-6 cytokine concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g004 Antioxidants 13 00917 g004]()
Figure 5.
Secretion measurements of IL-1β pro-inflammatory cytokine from the treated SH-SY5Y cells. The IL-1β cytokine concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments.
Figure 5.
Secretion measurements of IL-1β pro-inflammatory cytokine from the treated SH-SY5Y cells. The IL-1β cytokine concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments.
![Antioxidants 13 00917 g005 Antioxidants 13 00917 g005]()
Figure 6.
Secretion measurements of IL-8 from the treated SH-SY5Y cells. The IL-8 cytokine concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments.
Figure 6.
Secretion measurements of IL-8 from the treated SH-SY5Y cells. The IL-8 cytokine concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments.
![Antioxidants 13 00917 g006 Antioxidants 13 00917 g006]()
Figure 7.
Secretion measurements of fractalkine from the treated SH-SY5Y cells. The FKN concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 7.
Secretion measurements of fractalkine from the treated SH-SY5Y cells. The FKN concentration was determined from the cell culture supernatants using a human IL-6 ELISA Kit. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g007 Antioxidants 13 00917 g007]()
Figure 8.
ATP concentration measurements from the treated cells. The ATP concentration was determined using an ATP assay kit according to the manufacturer’s protocol. The values were expressed as ng/μL. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 8.
ATP concentration measurements from the treated cells. The ATP concentration was determined using an ATP assay kit according to the manufacturer’s protocol. The values were expressed as ng/μL. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g008 Antioxidants 13 00917 g008]()
Figure 9.
The total iron content of the variously treated differentiated SH-SY5Y cells. The total iron content was determined from the whole-cell lysate by a ferrozine-based colorimetric method. For normalization, the protein concentration of the samples was used. The iron content was expressed as μM iron/mg protein. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 9.
The total iron content of the variously treated differentiated SH-SY5Y cells. The total iron content was determined from the whole-cell lysate by a ferrozine-based colorimetric method. For normalization, the protein concentration of the samples was used. The iron content was expressed as μM iron/mg protein. (A) The cells were treated with rotenone for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and 6-OHDA), linalool (6-OHDA + Lin), geraniol (6-OHDA + Ger), and rasagiline (6-OHDA +Ras) for 24 h. (C) The cells were treated with ferric ammonium citrate (FAC) together with rotenone for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (D) The cells were treated with ferric ammonium citrate (FAC) together with 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. (E) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (F) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + 6-OHDA), linalool (FAC + 6-OHDA + Lin), geraniol (FAC + 6-OHDA + Ger), and rasagiline (FAC + 6-OHDA + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g009 Antioxidants 13 00917 g009]()
Figure 10.
Real-time PCR analysis of the FTH gene of the treated cells. The real-time PCR was performed using a SYBR Green protocol. GAPDH was used as a normalization gene. The relative mRNA expression of the control cells was considered 1 (grey horizontal line). (A) The cells were treated with rotenone or 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with ferric ammonium citrate (FAC) together with rotenone or 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (C) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone or 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments.
Figure 10.
Real-time PCR analysis of the FTH gene of the treated cells. The real-time PCR was performed using a SYBR Green protocol. GAPDH was used as a normalization gene. The relative mRNA expression of the control cells was considered 1 (grey horizontal line). (A) The cells were treated with rotenone or 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with ferric ammonium citrate (FAC) together with rotenone or 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. (C) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone or 6-OHDA for an additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments.
![Antioxidants 13 00917 g010 Antioxidants 13 00917 g010]()
Figure 11.
Real-time PCR analysis of the heme-oxygenase-1 (HO-1), transferrin receptor 1 (TfR1), and ferroportin (FP) genes of the treated cells. The real-time PCR was performed using a SYBR Green protocol. GAPDH was used as a housekeeping gene. The relative mRNA expression of the control cells was considered 1 (grey horizontal line). (A) The cells were treated with rotenone or 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with ferric ammonium citrate (FAC) together with rotenone or 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h (C) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone or 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 11.
Real-time PCR analysis of the heme-oxygenase-1 (HO-1), transferrin receptor 1 (TfR1), and ferroportin (FP) genes of the treated cells. The real-time PCR was performed using a SYBR Green protocol. GAPDH was used as a housekeeping gene. The relative mRNA expression of the control cells was considered 1 (grey horizontal line). (A) The cells were treated with rotenone or 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with ferric ammonium citrate (FAC) together with rotenone or 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h (C) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone or 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g011 Antioxidants 13 00917 g011]()
Figure 12.
Real-time PCR analysis of the α-Synuclein gene of the treated cells. The real-time PCR was performed using a SYBR Green protocol. GAPDH was used as a normalization gene. The relative mRNA expression of the control cells was considered 1 (grey horizontal line). (A) The cells were treated with rotenone or 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with ferric ammonium citrate (FAC) together with rotenone or 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h (C) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone or 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
Figure 12.
Real-time PCR analysis of the α-Synuclein gene of the treated cells. The real-time PCR was performed using a SYBR Green protocol. GAPDH was used as a normalization gene. The relative mRNA expression of the control cells was considered 1 (grey horizontal line). (A) The cells were treated with rotenone or 6-OHDA for 24 h, followed by DMSO (in the case of Ctrl and Rot), linalool (Rot + Lin), geraniol (Rot + Ger), and rasagiline (Rot + Ras) for 24 h. (B) The cells were treated with ferric ammonium citrate (FAC) together with rotenone or 6-OHDA for 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h (C) The cells were pretreated with ferric ammonium citrate (FAC) for 24 h and then were treated with rotenone or 6-OHDA for additional 24 h, which was followed by DMSO (in the case of Ctrl, FAC, and FAC + Rot), linalool (FAC + Rot + Lin), geraniol (FAC + Rot + Ger), and rasagiline (FAC + Rot + Ras) for 24 h. The columns represent the mean value ± SD of three independent experiments. The number of technical replicates was three in each experiment. The asterisk shows p < 0.05 compared to the control. The cross indicates p < 0.05 compared to the rotenone or 6-OHDA treatments. The double cross signs indicate p < 0.05 compared to linalool and/or geraniol treatments.
![Antioxidants 13 00917 g012 Antioxidants 13 00917 g012]()
Table 1.
Real-time PCR primer list.
Table 1.
Real-time PCR primer list.
Primer | Sequence 5′→3′ |
---|
α-synuclein forward | TTCTGGAAGATATGCCTGTG |
α-synuclein reverse | AGTCTTGATACCCTTCCTCA |
FTH forward | GAGGTGGCCGAATCTTCCTTC |
FTH reverse | TCAGTGGCCAGTTTGTGCAG |
FP forward | AAAGGAGGCTGTTTCCATAG |
FP reverse | TTCCTTCTCTACCTTGGTCA |
TfR1 forward | CATGTGGAGATGAAACTTGC |
TfR1 reverse | TCCCATAGCAGATACTTCCA |
HO-1 forward | ACCCATGACACCAAGGACCA |
HO-1 reverse | ATGCCTGCATTCACATGGCA |
GAPDH forward | TGTTCCAATATGATTCCACCC |
GAPDH reverse | CCACTTGATTTTGGAGGGAT |