Neuroinflammation and Lysosomal Abnormalities Characterise the Essential Role for Oxidation Resistance 1 in the Developing and Adult Cerebellum
Abstract
1. Introduction
2. Materials and Methods
2.1. Mouse Strains
2.2. Phenotyping
2.3. Tissue Immunohistochemistry and TUNEL Staining
2.4. Immunocytochemistry
2.5. RNA Extraction, cDNA Synthesis and qPCR
- C1qa AAAGGCAATCCAGGCAATATCA/TGGTTCTGGTATGGACTCTCC
- Ctsd GCTTCCGGTCTTTGACAACCT/CACCAAGCATTAGTTCTCCTCC
- Cd68 TGCCTGACAAGGGACACTTC/TGGTGGCTTACACAGTGGAC
- Gapdh CGGCCGCATCTTCTTGTG/CCGACCTTCACCATTTTGTCTAC
- Gfap GCAGAAGCTCCAAGATGAAACC/CGAACTTCCTCCTCATAGATCTTC
- Hexb AATGGTCAGCCGTGGAATAG/CATAGCTGGAATGCTGTAGACG
- Laptm5 GATGCCGTACCTCAGGATGG/CTCCCGGTTCTTGACCACG
- Ly86 TATACTATGCCGGCCCTGTC/GGGTCCCCTGAGATTGAGTT
- Ppia AGTTTTTTATCTGCACTGCCAAGA/CCTTCCCAAAGACCACATGCT
- S16 TTCTGGGCAAGAGCGATT/GATGGACTGTCGGATGGCA
- Tgfβ TGAGTGGCTGTCTTTTGACG/GGTTCATGTCATGGATGGTG
- Trem2 CTGGAACCGTCACCATCACTC/CGAAACTCGATGACTCCTCGG
2.6. RNA Sequencing
2.7. Protein Extraction, SDS-PAGE and Western Blotting
2.8. Electron Microscopy
2.9. Human OXR1 Variant Constructs and Assays
2.10. Cell Culture and Treatment
2.11. Reactive Oxygen Species (ROS) Production Assay
2.12. Cell Death Assay
2.13. Next Generation Sequencing
2.14. Data Analysis and Statistics
3. Results
3.1. Pre-Symptomatic Lysosomal and Inflammatory Pathology in the Oxr1 KO Cerebellum
3.2. Neuronal Expression of Oxr1 Rescues Oxr1 KO Pathology In Vivo
3.3. Adult-Onset Deletion of Oxr1 Causes Pathology Equivalent to Constitutive Loss of the Gene
3.4. Pathogenic Variants in OXR1 That Cause Contrasting Clinical Outcomes Retain Neuroprotective Properties
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Finelli, M.J.; Oliver, P.L. TLDc Proteins: New Players in the Oxidative Stress Response and Neurological Disease. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 2017, 28, 395–406. [Google Scholar] [CrossRef] [Scilit]
- Finelli, M.J.; Sanchez-Pulido, L.; Liu, K.X.; Davies, K.E.; Oliver, P.L. The Evolutionarily Conserved Tre2/Bub2/Cdc16 (TBC), Lysin Motif (LysM), Domain Catalytic (TLDc) Domain Is Neuroprotective against Oxidative Stress. J. Biol. Chem. 2016, 291, 2751–2763. [Google Scholar] [CrossRef] [Scilit]
- Arnaud-Arnould, M.; Tauziet, M.; Moncorgé, O.; Goujon, C.; Blaise, M. Crystal Structure of the TLDc Domain of Human NCOA7-AS. Acta Crystallogr. Sect. F Struct. Biol. Commun. 2021, 77, 230–237. [Google Scholar] [CrossRef] [Scilit]
- Blaise, M.; Alsarraf, H.M.A.B.; Wong, J.E.M.M.; Midtgaard, S.R.; Laroche, F.; Schack, L.; Spaink, H.; Stougaard, J.; Thirup, S. Crystal Structure of the TLDc Domain of Oxidation Resistance Protein 2 from Zebrafish. Proteins 2012, 80, 1694–1698. [Google Scholar] [CrossRef] [Scilit]
- Balestrini, S.; Milh, M.; Castiglioni, C.; Lüthy, K.; Finelli, M.J.; Verstreken, P.; Cardon, A.; Stražišar, B.G.; Holder, J.L.; Lesca, G.; et al. TBC1D24 Genotype-Phenotype Correlation: Epilepsies and Other Neurologic Features. Neurology 2016, 87, 77–85. [Google Scholar] [CrossRef] [Scilit]
- Doan, R.N.; Lim, E.T.; De Rubeis, S.; Betancur, C.; Cutler, D.J.; Chiocchetti, A.G.; Overman, L.M.; Soucy, A.; Goetze, S.; Autism Sequencing Consortium; et al. Recessive Gene Disruptions in Autism Spectrum Disorder. Nat. Genet. 2019, 51, 1092–1098. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Rousseau, J.; Kim, E.; Ehresmann, S.; Cheng, Y.-T.; Duraine, L.; Zuo, Z.; Park, Y.-J.; Li-Kroeger, D.; Bi, W.; et al. Loss of Oxidation Resistance 1, OXR1, Is Associated with an Autosomal-Recessive Neurological Disease with Cerebellar Atrophy and Lysosomal Dysfunction. Am. J. Hum. Genet. 2019, 105, 1237–1253. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.; Wang, W.; Yang, M.; Damseh, N.; de Sousa, M.M.L.; Jacob, F.; Lång, A.; Kristiansen, E.; Pannone, M.; Kissova, M.; et al. A Loss-of-Function Mutation in Human Oxidation Resistance 1 Disrupts the Spatial-Temporal Regulation of Histone Arginine Methylation in Neurodevelopment. Genome Biol. 2023, 24, 216. [Google Scholar] [CrossRef] [Scilit]
- Aprile, D.; Fruscione, F.; Baldassari, S.; Fadda, M.; Ferrante, D.; Falace, A.; Buhler, E.; Sartorelli, J.; Represa, A.; Baldelli, P.; et al. TBC1D24 Regulates Axonal Outgrowth and Membrane Trafficking at the Growth Cone in Rodent and Human Neurons. Cell Death Differ. 2019, 26, 2464–2478. [Google Scholar] [CrossRef] [Scilit]
- Castroflorio, E.; den Hoed, J.; Svistunova, D.; Finelli, M.J.; Cebrian-Serrano, A.; Corrochano, S.; Bassett, A.R.; Davies, B.; Oliver, P.L. The Ncoa7 Locus Regulates V-ATPase Formation and Function, Neurodevelopment and Behaviour. Cell. Mol. Life Sci. CMLS 2021, 78, 3503–3524. [Google Scholar] [CrossRef] [Scilit]
- Eaton, A.F.; Brown, D.; Merkulova, M. The Evolutionary Conserved TLDc Domain Defines a New Class of (H+)V-ATPase Interacting Proteins. Sci. Rep. 2021, 11, 22654. [Google Scholar] [CrossRef] [Scilit]
- Finelli, M.J.; Aprile, D.; Castroflorio, E.; Jeans, A.; Moschetta, M.; Chessum, L.; Degiacomi, M.T.; Grasegger, J.; Lupien-Meilleur, A.; Bassett, A.; et al. The Epilepsy-Associated Protein TBC1D24 Is Required for Normal Development, Survival and Vesicle Trafficking in Mammalian Neurons. Hum. Mol. Genet. 2019, 28, 584–597. [Google Scholar] [CrossRef] [Scilit]
- Lin, L.; Lyu, Q.; Kwan, P.-Y.; Zhao, J.; Fan, R.; Chai, A.; Lai, C.S.W.; Chan, Y.-S.; Shen, X.; Lai, K.-O. The Epilepsy and Intellectual Disability-Associated Protein TBC1D24 Regulates the Maintenance of Excitatory Synapses and Animal Behaviors. PLoS Genet. 2020, 16, e1008587. [Google Scholar] [CrossRef] [Scilit]
- Volkert, M.R.; Elliott, N.A.; Housman, D.E. Functional Genomics Reveals a Family of Eukaryotic Oxidation Protection Genes. Proc. Natl. Acad. Sci. USA 2000, 97, 14530–14535. [Google Scholar] [CrossRef] [Scilit]
- Elliott, N.A.; Volkert, M.R. Stress Induction and Mitochondrial Localization of Oxr1 Proteins in Yeast and Humans. Mol. Cell. Biol. 2004, 24, 3180–3187. [Google Scholar] [CrossRef] [Scilit]
- Volkert, M.R.; Crowley, D.J. Preventing Neurodegeneration by Controlling Oxidative Stress: The Role of OXR1. Front. Neurosci. 2020, 14, 611904. [Google Scholar] [CrossRef] [Scilit]
- Finelli, M.J.; Liu, K.X.; Wu, Y.; Oliver, P.L.; Davies, K.E. Oxr1 Improves Pathogenic Cellular Features of ALS-Associated FUS and TDP-43 Mutations. Hum. Mol. Genet. 2015, 24, 3529–3544. [Google Scholar] [CrossRef] [Scilit]
- Sahu, B.; Leon, L.M.; Zhang, W.; Puranik, N.; Periasamy, R.; Khanna, H.; Volkert, M. Oxidative Stress Resistance 1 Gene Therapy Retards Neurodegeneration in the Rd1 Mutant Mouse Model of Retinopathy. Investig. Ophthalmol. Vis. Sci. 2021, 62, 8. [Google Scholar] [CrossRef] [Scilit]
- Williamson, M.G.; Finelli, M.J.; Sleigh, J.N.; Reddington, A.; Gordon, D.; Talbot, K.; Davies, K.E.; Oliver, P.L. Neuronal Over-Expression of Oxr1 Is Protective against ALS-Associated Mutant TDP-43 Mislocalisation in Motor Neurons and Neuromuscular Defects In Vivo. Hum. Mol. Genet. 2019, 28, 3584–3599. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Li, Y.; Xiong, J.; Xu, H.; Xiang, G.; Fan, M.; Zhou, K.; Lin, Y.; Chen, X.; Xie, L.; et al. Delivery of pOXR1 through an Injectable Liposomal Nanoparticle Enhances Spinal Cord Injury Regeneration by Alleviating Oxidative Stress. Bioact. Mater. 2021, 6, 3177–3191. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.; Lin, X.; Rowe, A.; Rognes, T.; Eide, L.; Bjørås, M. Transcriptome Analysis of Human OXR1 Depleted Cells Reveals Its Role in Regulating the P53 Signaling Pathway. Sci. Rep. 2015, 5, 17409. [Google Scholar] [CrossRef] [Scilit]
- Svistunova, D.M.; Simon, J.N.; Rembeza, E.; Crabtree, M.; Yue, W.W.; Oliver, P.L.; Finelli, M.J. Oxidation Resistance 1 Regulates Post-Translational Modifications of Peroxiredoxin 2 in the Cerebellum. Free Radic. Biol. Med. 2019, 130, 151–162. [Google Scholar] [CrossRef] [Scilit]
- Oliver, P.L.; Finelli, M.J.; Edwards, B.; Bitoun, E.; Butts, D.L.; Becker, E.B.E.; Cheeseman, M.T.; Davies, B.; Davies, K.E. Oxr1 Is Essential for Protection against Oxidative Stress-Induced Neurodegeneration. PLoS Genet. 2011, 7, e1002338. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.; Lin, X.; Segers, F.; Suganthan, R.; Hildrestrand, G.A.; Rinholm, J.E.; Aas, P.A.; Sousa, M.M.L.; Holm, S.; Bolstad, N.; et al. OXR1A, a Coactivator of PRMT5 Regulating Histone Arginine Methylation. Cell Rep. 2020, 30, 4165–4178.e7. [Google Scholar] [CrossRef] [Scilit]
- Skarnes, W.C.; Rosen, B.; West, A.P.; Koutsourakis, M.; Bushell, W.; Iyer, V.; Mujica, A.O.; Thomas, M.; Harrow, J.; Cox, T.; et al. A Conditional Knockout Resource for the Genome-Wide Study of Mouse Gene Function. Nature 2011, 474, 337–342. [Google Scholar] [CrossRef] [Scilit]
- Ruzankina, Y.; Pinzon-Guzman, C.; Asare, A.; Ong, T.; Pontano, L.; Cotsarelis, G.; Zediak, V.P.; Velez, M.; Bhandoola, A.; Brown, E.J. Deletion of the Developmentally Essential Gene ATR in Adult Mice Leads to Age-Related Phenotypes and Stem Cell Loss. Cell Stem Cell 2007, 1, 113–126. [Google Scholar] [CrossRef] [Scilit]
- Webster, P. Microwave-Assisted Processing and Embedding for Transmission Electron Microscopy. Methods Mol. Biol. Clifton N.J. 2014, 1117, 21–37. [Google Scholar] [CrossRef] [Scilit]
- Efthymiou, S.; Salpietro, V.; Malintan, N.; Poncelet, M.; Kriouile, Y.; Fortuna, S.; De Zorzi, R.; Payne, K.; Henderson, L.B.; Cortese, A.; et al. Biallelic Mutations in Neurofascin Cause Neurodevelopmental Impairment and Peripheral Demyelination. Brain J. Neurol. 2019, 142, 2948–2964. [Google Scholar] [CrossRef] [Scilit]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. Off. J. Am. Coll. Med. Genet. 2015, 17, 405–424. [Google Scholar] [CrossRef] [Scilit]
- Tang, D.; Chen, M.; Huang, X.; Zhang, G.; Zeng, L.; Zhang, G.; Wu, S.; Wang, Y. SRplot: A Free Online Platform for Data Visualization and Graphing. PLoS ONE 2023, 18, e0294236. [Google Scholar] [CrossRef] [Scilit]
- Martinet, W.; De Bie, M.; Schrijvers, D.M.; De Meyer, G.R.Y.; Herman, A.G.; Kockx, M.M. 7-Ketocholesterol Induces Protein Ubiquitination, Myelin Figure Formation, and Light Chain 3 Processing in Vascular Smooth Muscle Cells. Arterioscler. Thromb. Vasc. Biol. 2004, 24, 2296–2301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.-W.; Duan, T.-T.; Chu, J.-Y.; Pan, S.-Y.; Zeng, Y.; Hu, F.-F. SCAD-Brain: A Public Database of Single Cell RNA-Seq Data in Human and Mouse Brains with Alzheimer’s Disease. Front. Aging Neurosci. 2023, 15, 1157792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, K.X.; Edwards, B.; Lee, S.; Finelli, M.J.; Davies, B.; Davies, K.E.; Oliver, P.L. Neuron-Specific Antioxidant OXR1 Extends Survival of a Mouse Model of Amyotrophic Lateral Sclerosis. Brain J. Neurol. 2015, 138, 1167–1181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cardoso-Moreira, M.; Halbert, J.; Valloton, D.; Velten, B.; Chen, C.; Shao, Y.; Liechti, A.; Ascenção, K.; Rummel, C.; Ovchinnikova, S.; et al. Gene Expression across Mammalian Organ Development. Nature 2019, 571, 505–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Ning, G.; Kang, B.; Zhu, J.; Wang, X.-Y.; Wang, Q.; Cai, T. A Novel Recessive Mutation in OXR1 Is Identified in Patient with Hearing Loss Recapitulated by the Knockdown Zebrafish. Hum. Mol. Genet. 2023, 32, 764–772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.S.; Reader, R.H.; Hoischen, A.; Veltman, J.A.; Simpson, N.H.; Francks, C.; Newbury, D.F.; Fisher, S.E. Next-Generation DNA Sequencing Identifies Novel Gene Variants and Pathways Involved in Specific Language Impairment. Sci. Rep. 2017, 7, 46105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alam, M.S.; Getz, M.; Safeukui, I.; Yi, S.; Tamez, P.; Shin, J.; Velázquez, P.; Haldar, K. Genomic Expression Analyses Reveal Lysosomal, Innate Immunity Proteins, as Disease Correlates in Murine Models of a Lysosomal Storage Disorder. PLoS ONE 2012, 7, e48273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez, M.E.; Klein, A.D.; Hong, J.; Dimbil, U.J.; Scott, M.P. Neuronal and Epithelial Cell Rescue Resolves Chronic Systemic Inflammation in the Lipid Storage Disorder Niemann-Pick C. Hum. Mol. Genet. 2012, 21, 2946–2960. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evers, B.M.; Rodriguez-Navas, C.; Tesla, R.J.; Prange-Kiel, J.; Wasser, C.R.; Yoo, K.S.; McDonald, J.; Cenik, B.; Ravenscroft, T.A.; Plattner, F.; et al. Lipidomic and Transcriptomic Basis of Lysosomal Dysfunction in Progranulin Deficiency. Cell Rep. 2017, 20, 2565–2574. [Google Scholar] [CrossRef] [Scilit]
- Cougnoux, A.; Yerger, J.C.; Fellmeth, M.; Serra-Vinardell, J.; Martin, K.; Navid, F.; Iben, J.; Wassif, C.A.; Cawley, N.X.; Porter, F.D. Single Cell Transcriptome Analysis of Niemann–Pick Disease, Type C1 Cerebella. Int. J. Mol. Sci. 2020, 21, 5368. [Google Scholar] [CrossRef] [Scilit]
- Lopez, M.E.; Scott, M.P. Genetic Dissection of a Cell-Autonomous Neurodegenerative Disorder: Lessons Learned from Mouse Models of Niemann-Pick Disease Type C. Dis. Model. Mech. 2013, 6, 1089–1100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loftus, S.K.; Erickson, R.P.; Walkley, S.U.; Bryant, M.A.; Incao, A.; Heidenreich, R.A.; Pavan, W.J. Rescue of Neurodegeneration in Niemann–Pick C Mice by a Prion-Promoter-Driven Npc1 cDNA Transgene. Hum. Mol. Genet. 2002, 11, 3107–3114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, D.C.; Milenkovic, L.; Beier, S.M.; Manuel, H.; Buchanan, J.; Scott, M.P. Cell-Autonomous Death of Cerebellar Purkinje Neurons with Autophagy in Niemann-Pick Type C Disease. PLoS Genet. 2005, 1, 81–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merkulova, M.; Păunescu, T.G.; Azroyan, A.; Marshansky, V.; Breton, S.; Brown, D. Mapping the H(+) (V)-ATPase Interactome: Identification of Proteins Involved in Trafficking, Folding, Assembly and Phosphorylation. Sci. Rep. 2015, 5, 14827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Rubinstein, J.L. CryoEM of V-ATPases: Assembly, Disassembly, and Inhibition. Curr. Opin. Struct. Biol. 2023, 80, 102592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, M.M.; Lee, S.; Couoh-Cardel, S.; Oot, R.A.; Kim, H.; Wilkens, S.; Roh, S.-H. Oxidative Stress Protein Oxr1 Promotes V-ATPase Holoenzyme Disassembly in Catalytic Activity-Independent Manner. EMBO J. 2022, 41, e109360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, Y.Z.; Abbas, Y.M.; Wu, J.Z.; Wu, D.; Keon, K.A.; Hesketh, G.G.; Bueler, S.A.; Gingras, A.-C.; Robinson, C.V.; Grinstein, S.; et al. CryoEM of Endogenous Mammalian V-ATPase Interacting with the TLDc Protein mEAK-7. Life Sci. Alliance 2022, 5, e202201527. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wu, D.; Robinson, C.V.; Fu, T.-M. Identification of mEAK-7 as a Human V-ATPase Regulator via Cryo-EM Data Mining. Proc. Natl. Acad. Sci. USA 2022, 119, e2203742119. [Google Scholar] [CrossRef] [Scilit]
- Wilson, K.A.; Bar, S.; Dammer, E.B.; Carrera, E.M.; Hodge, B.A.; Hilsabeck, T.A.U.; Bons, J.; Brownridge, G.W.; Beck, J.N.; Rose, J.; et al. OXR1 Maintains the Retromer to Delay Brain Aging under Dietary Restriction. Nat. Commun. 2024, 15, 467. [Google Scholar] [CrossRef] [Scilit]
- Beauregard-Lacroix, E.; Pacheco-Cuellar, G.; Ajeawung, N.F.; Tardif, J.; Dieterich, K.; Dabir, T.; Vind-Kezunovic, D.; White, S.M.; Zadori, D.; Castiglioni, C.; et al. DOORS Syndrome and a Recurrent Truncating ATP6V1B2 Variant. Genet. Med. Off. J. Am. Coll. Med. Genet. 2021, 23, 149–154. [Google Scholar] [CrossRef] [Scilit]
- Guerrini, R.; Mei, D.; Kerti-Szigeti, K.; Pepe, S.; Koenig, M.K.; Von Allmen, G.; Cho, M.T.; McDonald, K.; Baker, J.; Bhambhani, V.; et al. Phenotypic and Genetic Spectrum of ATP6V1A Encephalopathy: A Disorder of Lysosomal Homeostasis. Brain J. Neurol. 2022, 145, 2687–2703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Indrawinata, K.; Argiropoulos, P.; Sugita, S. Structural and Functional Understanding of Disease-Associated Mutations in V-ATPase Subunit A1 and Other Isoforms. Front. Mol. Neurosci. 2023, 16, 1135015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campeau, P.M.; Kasperaviciute, D.; Lu, J.T.; Burrage, L.C.; Kim, C.; Hori, M.; Powell, B.R.; Stewart, F.; Félix, T.M.; van den Ende, J.; et al. The Genetic Basis of DOORS Syndrome: An Exome-Sequencing Study. Lancet Neurol. 2014, 13, 44–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michetti, C.; Falace, A.; Benfenati, F.; Fassio, A. Synaptic genes and neurodevelopmental disorders: From molecular mechanisms to developmental strategies of behavioral testing. Neurobiol. Dis. 2022, 173, 105856. [Google Scholar] [CrossRef] [Scilit] [PubMed]





Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bucknor, E.M.V.; Johnson, E.; Efthymiou, S.; Alvi, J.R.; Sultan, T.; Houlden, H.; Maroofian, R.; Karimiani, E.G.; Finelli, M.J.; Oliver, P.L. Neuroinflammation and Lysosomal Abnormalities Characterise the Essential Role for Oxidation Resistance 1 in the Developing and Adult Cerebellum. Antioxidants 2024, 13, 685. https://doi.org/10.3390/antiox13060685
Bucknor EMV, Johnson E, Efthymiou S, Alvi JR, Sultan T, Houlden H, Maroofian R, Karimiani EG, Finelli MJ, Oliver PL. Neuroinflammation and Lysosomal Abnormalities Characterise the Essential Role for Oxidation Resistance 1 in the Developing and Adult Cerebellum. Antioxidants. 2024; 13(6):685. https://doi.org/10.3390/antiox13060685
Chicago/Turabian StyleBucknor, Eboni M. V., Errin Johnson, Stephanie Efthymiou, Javeria R. Alvi, Tipu Sultan, Henry Houlden, Reza Maroofian, Ehsan G. Karimiani, Mattéa J. Finelli, and Peter L. Oliver. 2024. "Neuroinflammation and Lysosomal Abnormalities Characterise the Essential Role for Oxidation Resistance 1 in the Developing and Adult Cerebellum" Antioxidants 13, no. 6: 685. https://doi.org/10.3390/antiox13060685
APA StyleBucknor, E. M. V., Johnson, E., Efthymiou, S., Alvi, J. R., Sultan, T., Houlden, H., Maroofian, R., Karimiani, E. G., Finelli, M. J., & Oliver, P. L. (2024). Neuroinflammation and Lysosomal Abnormalities Characterise the Essential Role for Oxidation Resistance 1 in the Developing and Adult Cerebellum. Antioxidants, 13(6), 685. https://doi.org/10.3390/antiox13060685

