AQP3 and AQP5 Modulation in Response to Prolonged Oxidative Stress in Breast Cancer Cell Lines
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Cell Culture Treatments
2.3. Viability and Proliferation Assays
2.4. Total Lipid Extraction and GC Analysis
2.5. Measurement of LOOH Concentration
2.6. Cell Migration Assay
2.7. RNA Isolation, cDNA Synthesis, and RT-qPCR
2.8. Protein Isolation and Western Blot Analyses
2.9. Statistical Analysis
3. Results
3.1. Effect of Prolonged Exposure to H2O2 on Cell Viability and Proliferation
3.2. Effect of Prolonged Exposure to H2O2 on Cell Migration
3.3. Effect of Prolonged Exposure to H2O2 on Fatty Acid Content and LOOH Formation
3.4. Effect of Prolonged Exposure to H2O2 on Protein and Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Preston, G.M.; Agre, P. Isolation of the CDNA for Erythrocyte Integral Membrane Protein of 28 Kilodaltons: Member of an Ancient Channel Family. Proc. Natl. Acad. Sci. USA 1991, 88, 11110–11114. [Google Scholar] [CrossRef]
- Agre, P.; Preston, G.M.; Smith, B.L.; Jung, J.S.; Raina, S.; Moon, C.; Guggino, W.B.; Nielsen, S. Aquaporin CHIP: The Archetypal Molecular Water Channel. Am. J. Physiol.-Ren. Physiol. 1993, 265, F463–F476. [Google Scholar] [CrossRef] [PubMed]
- King, L.S.; Kozono, D.; Agre, P. From Structure to Disease: The Evolving Tale of Aquaporin Biology. Nat. Rev. Mol. Cell Biol. 2004, 5, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Ishibashi, K.; Hara, S.; Kondo, S. Aquaporin Water Channels in Mammals. Clin. Exp. Nephrol. 2009, 13, 107–117. [Google Scholar] [CrossRef] [PubMed]
- Bienert, G.P.; Møller, A.L.B.; Kristiansen, K.A.; Schulz, A.; Møller, I.M.; Schjoerring, J.K.; Jahn, T.P. Specific Aquaporins Facilitate the Diffusion of Hydrogen Peroxide across Membranes. J. Biol. Chem. 2007, 282, 1183–1192. [Google Scholar] [CrossRef] [PubMed]
- Sies, H.; Berndt, C.; Jones, D.P. Oxidative Stress. Annu. Rev. Biochem. 2017, 86, 715–748. [Google Scholar] [CrossRef] [PubMed]
- Almasalmeh, A.; Krenc, D.; Wu, B.; Beitz, E. Structural Determinants of the Hydrogen Peroxide Permeability of Aquaporins. FEBS J. 2014, 281, 647–656. [Google Scholar] [CrossRef] [PubMed]
- Prata, C.; Hrelia, S.; Fiorentini, D. Peroxiporins in Cancer. Int. J. Mol. Sci. 2019, 20, 1371. [Google Scholar] [CrossRef] [PubMed]
- Milković, L.; Mlinarić, M.; Lučić, I.; Čipak Gašparović, A. The Involvement of Peroxiporins and Antioxidant Transcription Factors in Breast Cancer Therapy Resistance. Cancers 2023, 15, 5747. [Google Scholar] [CrossRef]
- Henzler, T.; Steudle, E. Transport and Metabolic Degradation of Hydrogen Peroxide in Chara Corallina: Model Calculations and Measurements with the Pressure Probe Suggest Transport of H2O2 across Water Channels. J. Exp. Bot. 2000, 51, 2053–2066. [Google Scholar] [CrossRef] [PubMed]
- Verkman, A.S. More than Just Water Channels: Unexpected Cellular Roles of Aquaporins. J. Cell Sci. 2005, 118, 3225–3232. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization International Agency for Research on Cancer (IARC). World Cancer Report: Cancer Research for Cancer Prevention; Wild, C.P., Weiderpass, E., Stewart, B.W., Eds.; IARC: Sydney, NSW, Australia, 2020; Volume 199, ISBN 978-92-832-0447-3. [Google Scholar]
- Wang, J.; Feng, L.; Zhu, Z.; Zheng, M.; Wang, D.; Chen, Z.; Sun, H. Aquaporins as Diagnostic and Therapeutic Targets in Cancer: How Far We Are? J. Transl. Med. 2015, 13, 96. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulos, M.C.; Saadoun, S. Key Roles of Aquaporins in Tumor Biology. Biochim. Biophys. Acta 2015, 1848, 2576–2583. [Google Scholar] [CrossRef] [PubMed]
- Chow, P.H.; Bowen, J.; Yool, A.J. Combined Systematic Review and Transcriptomic Analyses of Mammalian Aquaporin Classes 1 to 10 as Biomarkers and Prognostic Indicators in Diverse Cancers. Cancers 2020, 12, 1911. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; Kang, B.W.; Kim, J.G.; Jung, J.H.; Lee, J.; Kim, W.W.; Park, H.Y.; Jeong, J.H.; Jeong, J.Y.; Park, J.Y.; et al. AQP5 Variants Affect Tumoral Expression of AQP5 and Survival in Patients with Early Breast Cancer. Oncology 2017, 92, 153–160. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; Chae, Y.S.; Kim, J.G.; Kim, W.W.; Jung, J.H.; Park, H.Y.; Jeong, J.Y.; Park, J.Y.; Jung, H.J.; Kwon, T.H. AQP5 Expression Predicts Survival in Patients with Early Breast Cancer. Ann. Surg. Oncol. 2014, 21, 375–383. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Jiao, L.; Li, T.; Wang, H.; Wei, W.; Qian, H. Expression of AQP3 and AQP5 as a Prognostic Marker in Triple-Negative Breast Cancer. Oncol. Lett. 2018, 16, 2661–2667. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Chae, Y.S.; Lee, S.J.; Kang, B.W.; Kim, J.G.; Kim, W.W.; Jung, J.H.; Park, H.Y.; Jeong, J.-H.; Jeong, J.Y.; et al. Aquaporin 3 Expression Predicts Survival in Patients with HER2-Positive Early Breast Cancer. Anticancer Res. 2015, 35, 2775–2782. [Google Scholar] [PubMed]
- Moloney, J.N.; Cotter, T.G. ROS Signalling in the Biology of Cancer. Semin. Cell Dev. Biol. 2018, 80, 50–64. [Google Scholar] [CrossRef]
- Orešić, T.; Bubanović, S.; Ramić, S.; Šarčević, B.; Čipak Gašparović, A. Nuclear Localization of NRF2 in Stroma of HER2 Positive and Triple-Negative Breast Cancer. Pathol. Res. Pract. 2023, 248, 154662. [Google Scholar] [CrossRef] [PubMed]
- Bottoni, L.; Minetti, A.; Realini, G.; Pio, E.; Giustarini, D.; Rossi, R.; Rocchio, C.; Franci, L.; Salvini, L.; Catona, O.; et al. NRF2 Activation by Cysteine as a Survival Mechanism for Triple-Negative Breast Cancer Cells. Oncogene 2024. [Google Scholar] [CrossRef]
- Sies, H. Hydrogen Peroxide as a Central Redox Signaling Molecule in Physiological Oxidative Stress: Oxidative Eustress. Redox Biol. 2017, 11, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Buck, T.; Hack, C.T.; Berg, D.; Berg, U.; Kunz, L.; Mayerhofer, A. The NADPH Oxidase 4 Is a Major Source of Hydrogen Peroxide in Human Granulosa-Lutein and Granulosa Tumor Cells. Sci. Rep. 2019, 9, 3585. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, M.; Martínez, M.P.; López-Oliva, M.E.; Rodríguez, C.; Corbacho, C.; Carballido, J.; García-Sacristán, A.; Hernández, M.; Rivera, L.; Sáenz-Medina, J.; et al. Hydrogen Peroxide Derived from NADPH Oxidase 4- and 2 Contributes to the Endothelium-Dependent Vasodilatation of Intrarenal Arteries. Redox Biol. 2018, 19, 92–104. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Lin, B.; Wei, H.; Wang, X.; Nie, X.; Shi, Y. AQP3 Promotes the Invasion and Metastasis in Cervical Cancer by Regulating NOX4-Derived H2O2 Activation of Syk/PI3K/Akt Signaling Axis. J. Cancer 2024, 15, 1124. [Google Scholar] [CrossRef] [PubMed]
- Roque, A.T.; Gambeloni, R.Z.; Felitti, S.; Ribeiro, M.L.; Santos, J.C. Inflammation-Induced Oxidative Stress in Breast Cancer Patients. Med. Oncol. 2015, 32, 263. [Google Scholar] [CrossRef] [PubMed]
- Conklin, K.A. Chemotherapy-Associated Oxidative Stress: Impact on Chemotherapeutic Effectiveness. Integr. Cancer Ther. 2004, 3, 294–300. [Google Scholar] [CrossRef]
- Mahalingaiah, P.K.S.; Singh, K.P. Chronic Oxidative Stress Increases Growth and Tumorigenic Potential of MCF-7 Breast Cancer Cells. PLoS ONE 2014, 9, e87371. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [PubMed]
- Mihaljević, B.; Katušin-Ražem, B.; Ražem, D. The Reevaluation of the Ferric Thiocyanate Assay for Lipid Hydroperoxides with Special Considerations of the Mechanistic Aspects of the Response. Free Radic. Biol. Med. 1996, 21, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Neganova, M.; Liu, J.; Aleksandrova, Y.; Klochkov, S.; Fan, R. Therapeutic Influence on Important Targets Associated with Chronic Inflammation and Oxidative Stress in Cancer Treatment. Cancers 2021, 13, 6062. [Google Scholar] [CrossRef] [PubMed]
- Qin, F.; Zhang, H.; Shao, Y.; Liu, X.; Yang, L.; Huang, Y.; Fu, L.; Gu, F.; Ma, Y. Expression of Aquaporin1, a Water Channel Protein, in Cytoplasm Is Negatively Correlated with Prognosis of Breast Cancer Patients. Oncotarget 2016, 7, 8143. [Google Scholar] [CrossRef]
- Huang, Y.T.; Zhou, J.; Shi, S.; Xu, H.Y.; Qu, F.; Zhang, D.; Chen, Y.D.; Yang, J.; Huang, H.F.; Sheng, J.Z. Identification of Estrogen Response Element in Aquaporin-3 Gene That Mediates Estrogen-Induced Cell Migration and Invasion in Estrogen Receptor-Positive Breast Cancer. Sci. Rep. 2015, 5, srep12484. [Google Scholar] [CrossRef] [PubMed]
- Satooka, H.; Hara-Chikuma, M. Aquaporin-3 Controls Breast Cancer Cell Migration by Regulating Hydrogen Peroxide Transport and Its Downstream Cell Signaling. Mol. Cell Biol. 2016, 36, 1206. [Google Scholar] [CrossRef] [PubMed]
- Hara-Chikuma, M.; Watanabe, S.; Satooka, H. Involvement of Aquaporin-3 in Epidermal Growth Factor Receptor Signaling via Hydrogen Peroxide Transport in Cancer Cells. Biochem. Biophys. Res. Commun. 2016, 471, 603–609. [Google Scholar] [CrossRef] [PubMed]
- De Ieso, M.L.; Pei, J.V. An Accurate and Cost-Effective Alternative Method for Measuring Cell Migration with the Circular Wound Closure Assay. Biosci. Rep. 2018, 38, 20180698. [Google Scholar] [CrossRef]
- Hurd, T.R.; DeGennaro, M.; Lehmann, R. Redox Regulation of Cell Migration and Adhesion. Trends Cell Biol. 2012, 22, 107. [Google Scholar] [CrossRef] [PubMed]
- Hecht, F.; Cazarin, J.M.; Lima, C.E.; Faria, C.C.; Leitão, A.A.d.C.; Ferreira, A.C.F.; Carvalho, D.P.; Fortunato, R.S. Redox Homeostasis of Breast Cancer Lineages Contributes to Differential Cell Death Response to Exogenous Hydrogen Peroxide. Life Sci. 2016, 158, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Zimta, A.A.; Cenariu, D.; Irimie, A.; Magdo, L.; Nabavi, S.M.; Atanasov, A.G.; Berindan-Neagoe, I. The Role of Nrf2 Activity in Cancer Development and Progression. Cancers 2019, 11, 1755. [Google Scholar] [CrossRef] [PubMed]
- Hayes, J.D.; Dinkova-Kostova, A.T.; Tew, K.D. Oxidative Stress in Cancer. Cancer Cell 2020, 38, 167–197. [Google Scholar] [CrossRef] [PubMed]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal 2018, 29, 1727. [Google Scholar] [CrossRef] [PubMed]
- Ji, L.; Li, H.; Gao, P.; Shang, G.; Zhang, D.D.; Zhang, N.; Jiang, T. Nrf2 Pathway Regulates Multidrug-Resistance-Associated Protein 1 in Small Cell Lung Cancer. PLoS ONE 2013, 8, e63404. [Google Scholar] [CrossRef] [PubMed]
- Ji, X.; Lu, Y.; Tian, H.; Meng, X.; Wei, M.; Cho, W.C. Chemoresistance Mechanisms of Breast Cancer and Their Countermeasures. Biomed. Pharmacother. 2019, 114, 108800. [Google Scholar] [CrossRef]
- Jeddi, F.; Soozangar, N.; Sadeghi, M.R.; Somi, M.H.; Shirmohamadi, M.; Eftekhar-Sadat, A.T.; Samadi, N. Nrf2 Overexpression Is Associated with P-Glycoprotein Upregulation in Gastric Cancer. Biomed. Pharmacother. 2018, 97, 286–292. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Wu, H.; Zhang, P.; Happel, C.; Ma, J.; Biswal, S. Expression of ABCG2 (BCRP) Is Regulated by Nrf2 in Cancer Cells That Confers Side Population and Chemoresistance Phenotype. Mol. Cancer Ther. 2010, 9, 2365–2376. [Google Scholar] [CrossRef] [PubMed]
- Hallis, S.P.; Go, B.J.; Yoo, J.M.; Cho, G.H.; Kwak, M.-K. Toward a Better Understanding of NRF2/NFE2L2 and BCRP/ABCG2 in Therapy Resistance in Cancer. Drug Targets Ther. 2023, 2, 111–123. [Google Scholar] [CrossRef]
- Mlinarić, M.; Lučić, I.; Milković, L.; da Silva, I.V.; Tartaro Bujak, I.; Musani, V.; Soveral, G.; Čipak Gašparović, A. AQP3-Dependent PI3K/Akt Modulation in Breast Cancer Cells. Int. J. Mol. Sci. 2023, 24, 8133. [Google Scholar] [CrossRef] [PubMed]
- Jensen, H.H.; Login, F.H.; Park, J.Y.; Kwon, T.H.; Nejsum, L.N. Immunohistochemical Evalulation of Activated Ras and Rac1 as Potential Downstream Effectors of Aquaporin-5 in Breast Cancer in Vivo. Biochem. Biophys. Res. Commun. 2017, 493, 1210–1216. [Google Scholar] [CrossRef] [PubMed]
- Woo, J.; Lee, J.; Kim, M.S.; Jang, S.J.; Sidransky, D.; Moon, C. The Effect of Aquaporin 5 Overexpression on the Ras Signaling Pathway. Biochem. Biophys. Res. Commun. 2008, 367, 291–298. [Google Scholar] [CrossRef] [PubMed]
- Arif, M.; Kitchen, P.; Conner, M.T.; Hill, E.J.; Nagel, D.; Bill, R.M.; Dunmore, S.J.; Armesilla, A.L.; Gross, S.; Carmichael, A.R.; et al. Downregulation of Aquaporin 3 Inhibits Cellular Proliferation, Migration and Invasion in the MDA-MB-231 Breast Cancer Cell Line. Oncol. Lett. 2018, 16, 713–720. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Chen, Z.; Song, Y.; Zhang, P.; Hu, J.; Bai, C. Expression of Aquaporin 5 Increases Proliferation and Metastasis Potential of Lung Cancer. J. Pathol. 2010, 221, 210–220. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.J.; Park, J.Y.; Jeon, H.S.; Kwon, T.H. Aquaporin-5: A Marker Protein for Proliferation and Migration of Human Breast Cancer Cells. PLoS ONE 2011, 6, e28492. [Google Scholar] [CrossRef] [PubMed]
- Edamana, S.; Pedersen, S.F.; Nejsum, L.N. Aquaporin Water Channels Affect the Response of Conventional Anticancer Therapies of 3D Grown Breast Cancer Cells. Biochem. Biophys. Res. Commun. 2023, 639, 126–133. [Google Scholar] [CrossRef] [PubMed]
- Chong, W.; Zhang, H.; Guo, Z.; Yang, L.; Shao, Y.; Liu, X.; Zhao, Y.; Wang, Z.; Zhang, M.; Guo, C.; et al. Aquaporin 1 Promotes Sensitivity of Anthracycline Chemotherapy in Breast Cancer by Inhibiting β-Catenin Degradation to Enhance TopoIIα Activity. Cell Death Differ. 2020, 28, 382–400. [Google Scholar] [CrossRef] [PubMed]
- Trigueros-Motos, L.; Pérez-Torras, S.; Casado, F.J.; Molina-Arcas, M.; Pastor-Anglada, M. Aquaporin 3 (AQP3) Participates in the Cytotoxic Response to Nucleoside-Derived Drugs. BMC Cancer 2012, 12, 434. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Pei, B.; Wang, H.; Tang, C.; Zhu, W.; Jin, F. Effect of AQP-5 Silencing by SiRNA Interference on Chemosensitivity of Breast Cancer Cells. Onco Targets Ther. 2018, 11, 3359–3368. [Google Scholar] [CrossRef]
- Li, Q.; Yang, T.; Li, D.; Ding, F.; Bai, G.; Wang, W.; Sun, H. Knockdown of Aquaporin-5 Sensitizes Colorectal Cancer Cells to 5-Fluorouracil via Inhibition of the Wnt-β-Catenin Signaling Pathway. Biochem. Cell Biol. 2018, 96, 572–579. [Google Scholar] [CrossRef]
AQP1 (NM_198098) | Forward | AATGACCTGGCTGATGGTGT |
Reverse | CAGGAGGTGTCCAAGGGCTA | |
AQP9 (NM_020980) | Forward | TCTCAGTCGAGGACGTTTTGG |
Reverse | GTGACCACCAGAGACACCG | |
AQP11 (NM_173039) | Forward | TGCAGGAGGAAGTCTAACAGG |
Reverse | AGCCATGGAAGGAAAAAGCTG | |
B2M (NM_004048) | Forward | TGTCTTTCAGCAAGGACTGGT |
Reverse | ACATGTCTCGATCCCACTTAAC | |
PPIA (NM_001300981) | Forward | GACTGAGTGGTTGGATGGCA |
Reverse | GCTCCATGGCCTCCACAATA | |
HPRT-1 (NM_000194) | Forward | CCCTGGCGTCGTGATTAGTG |
Reverse | TCGAGCAAGACGTTCAGTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mlinarić, M.; Lučić, I.; Tomljanović, M.; Tartaro Bujak, I.; Milković, L.; Čipak Gašparović, A. AQP3 and AQP5 Modulation in Response to Prolonged Oxidative Stress in Breast Cancer Cell Lines. Antioxidants 2024, 13, 626. https://doi.org/10.3390/antiox13060626
Mlinarić M, Lučić I, Tomljanović M, Tartaro Bujak I, Milković L, Čipak Gašparović A. AQP3 and AQP5 Modulation in Response to Prolonged Oxidative Stress in Breast Cancer Cell Lines. Antioxidants. 2024; 13(6):626. https://doi.org/10.3390/antiox13060626
Chicago/Turabian StyleMlinarić, Monika, Ivan Lučić, Marko Tomljanović, Ivana Tartaro Bujak, Lidija Milković, and Ana Čipak Gašparović. 2024. "AQP3 and AQP5 Modulation in Response to Prolonged Oxidative Stress in Breast Cancer Cell Lines" Antioxidants 13, no. 6: 626. https://doi.org/10.3390/antiox13060626
APA StyleMlinarić, M., Lučić, I., Tomljanović, M., Tartaro Bujak, I., Milković, L., & Čipak Gašparović, A. (2024). AQP3 and AQP5 Modulation in Response to Prolonged Oxidative Stress in Breast Cancer Cell Lines. Antioxidants, 13(6), 626. https://doi.org/10.3390/antiox13060626