Next Article in Journal
GDSL Lipase Gene HTA1 Negatively Regulates Heat Tolerance in Rice Seedlings by Regulating Reactive Oxygen Species Accumulation
Next Article in Special Issue
Lysophosphatidylcholine Impairs the Mitochondria Homeostasis Leading to Trophoblast Dysfunction in Gestational Diabetes Mellitus
Previous Article in Journal
The Interplay between Perioperative Oxidative Stress and Hepatic Dysfunction after Human Liver Resection: A Prospective Observational Pilot Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia

by
Miguel A. Ortega
1,2,*,†,
Luis M. Garcia-Puente
1,2,†,
Oscar Fraile-Martinez
1,2,
Tatiana Pekarek
1,2,
Cielo García-Montero
1,2,
Julia Bujan
1,2,
Leonel Pekarek
1,2,
Silvestra Barrena-Blázquez
2,3,4,
Raquel Gragera
1,
Inmaculada C. Rodríguez-Rojo
3,4,
Patrocinio Rodríguez-Benitez
5,6,7,8,
Laura López-González
2,9,
Raul Díaz-Pedrero
2,9,
Melchor Álvarez-Mon
1,2,10,
Natalio García-Honduvilla
1,2,
Juan A. De León-Luis
5,6,7,
Coral Bravo
5,6,7,‡ and
Miguel A. Saez
1,2,11,‡
1
Department of Medicine and Medical Specialities, (CIBEREHD), Faculty of Medicine and Health Sciences, University of Alcalá, 28801 Alcala de Henares, Spain
2
Ramón y Cajal Institute of Sanitary Research (IRYCIS), 28034 Madrid, Spain
3
Department of Nursing and Physiotherapy, Faculty of Medicine and Health Sciences, University of Alcalá, 28801 Alcala de Henares, Spain
4
Center for Cognitive and Computational Neuroscience, Complutense University of Madrid, 28801 Alcala de Henares, Spain
5
Department of Public and Maternal and Child Health, School of Medicine, Complutense University of Madrid, 28040 Madrid, Spain
6
Department of Obstetrics and Gynecology, University Hospital Gregorio Marañón, 28009 Madrid, Spain
7
Health Research Institute Gregorio Marañón, 28009 Madrid, Spain
8
Department of Nephrology, University Hospital Gregorio Marañón, 28009 Madrid, Spain
9
Department of Surgery, Medical and Social Sciences, Faculty of Medicine and Health Sciences, University of Alcalá, 28801 Alcala de Henares, Spain
10
Immune System Diseases-Rheumatology and Internal Medicine Service, University Hospital Prince of Asturias, Networking Research Center on for Liver and Digestive Diseases (CIBEREHD), 28806 Alcala de Henares, Spain
11
Pathological Anatomy Service, University Hospital Gómez-Ulla, 28806 Alcala de Henares, Spain
*
Author to whom correspondence should be addressed.
These authors contributed equality to this word.
These authors are a senior authorship.
Antioxidants 2024, 13(5), 591; https://doi.org/10.3390/antiox13050591
Submission received: 27 March 2024 / Revised: 30 April 2024 / Accepted: 8 May 2024 / Published: 11 May 2024

Abstract

Preeclampsia, a serious and potentially life-threatening medical complication occurring during pregnancy, is characterized by hypertension and often accompanied by proteinuria and multiorgan dysfunction. It is classified into two subtypes based on the timing of diagnosis: early-onset (EO-PE) and late-onset preeclampsia (LO-PE). Despite being less severe and exhibiting distinct pathophysiological characteristics, LO-PE is more prevalent than EO-PE, although both conditions have a significant impact on placental health. Previous research indicates that different pathophysiological events within the placenta may contribute to the development of preeclampsia across multiple pathways. In our experimental study, we investigated markers of oxidative stress, ferroptosis, and lipid peroxidation pathways in placental tissue samples obtained from women with LO-PE (n = 68) compared to healthy control pregnant women (HC, n = 43). Through a comprehensive analysis, we observed an upregulation of specific molecules associated with these pathways, including NADPH oxidase 1 (NOX-1), NADPH oxidase 2 (NOX-2), transferrin receptor protein 1 (TFRC), arachidonate 5-lipoxygenase (ALOX-5), acyl-CoA synthetase long-chain family member 4 (ACSL-4), glutathione peroxidase 4 (GPX4) and malondialdehyde (MDA) in women with LO-PE. Furthermore, increased ferric tissue deposition (Fe3+) was observed in placenta samples stained with Perls’ Prussian blue. The assessment involved gene and protein expression analyses conducted through RT-qPCR experiments and immunohistochemistry assays. Our findings underscore the heightened activation of inflammatory pathways in LO-PE compared to HC, highlighting the pathological mechanisms underlying this pregnancy disorder.

1. Introduction

Preeclampsia is a multifactorial and life-threatening obstetric disorder characterized by new-onset clinical hypertension arising after 20 weeks of gestation, which is commonly accompanied by new-onset proteinuria, edema, and multiple organ dysfunction [1,2,3]. Preeclampsia complicates between 2% and 8% of pregnancies worldwide and, together with other hypertensive disorders of pregnancy, represents a notable socioeconomic burden, posing significant risks to both maternal and fetal health, with a more serious impact in low- and middle-income countries [4]. Two major types of preeclampsia are clinically recognized: early-onset preeclampsia (EO-PE) and late-onset preeclampsia (LO-PE). This classification depends on the time of initiation of clinical symptoms with EOPE occurring before 34 weeks and LO-PE occurring after 34 weeks [5]. In general, LO-PE is more prevalent but also less severe than the EO-PE variant in terms of maternal and perinatal adverse outcomes associated [6,7,8]. The etiopathogenesis of both types of preeclampsia remains mostly elusive, although it is suggested that the placenta has a major role in their development and progression [9,10]. It seems that both early- and LO-PE result from placental syncytiotrophoblast stress (stage 1 or preclinical), which leads the stage 2 (clinical) characterized by the aforementioned new-onset hypertension and proteinuria [11]. However, the causes and timing of placental stress differ among both entities. EO-PE seems to be associated with failures in the placentation process with defects in the spiral arteries and trophoblast invasion. Meanwhile, LO-PE may be secondary to intraplacental (intervillous) malperfusions due to mechanical restrictions being more likely related to an inability of the maternal cardiovascular system to meet the increased metabolic demands of an overgrown fetoplacental unit [9]. Therefore, the placenta is a central organ involved in the pathophysiology of EO-PE and LO-PE. However, the existing differences in the causes of its dysfunction make it worthwhile to explore this organ distinctly in both entities.
Oxidative stress is a major cellular imbalance caused by an increase in oxidative molecules (free radicals) like reactive oxygen species (ROS) and a decrease in antioxidant mechanisms. Although oxidative stress can favorably modulate physiological processes, its dysregulation can lead to chemical changes in lipids, proteins and nucleic acids that eventually damage cell organelles and alter many biological pathways [12,13]. Lipid peroxidation is one of the main consequences derived from oxidative stress. This process consists of the attack, by free radicals, of lipids containing carbon–carbon double bond(s), especially polyunsaturated fatty acids (PUFAs), which are components presented in many cellular membranes [14,15]. Compelling evidence has found that augmented oxidative stress and lipid peroxidation can be reported in the placenta of women with different obstetric complications [16,17,18,19], demonstrating the relevance of studying both processes for the understanding of the damage associated in this structure. On the other hand, a proper balance in iron levels and metabolism is also crucial during pregnancy, and the placenta has a major regulatory role in these processes [20]. Both defective and excessive iron levels can have detrimental effects in pregnancy. Despite the former being more common, iron overload can also have detrimental consequences during this period, leading among other consequences to oxidative stress, lipid peroxidation and a distinctive type of cell death named ferroptosis [21]. The concomitant involvement of oxidative stress, lipid peroxidation and ferroptosis in the pathogenesis of preeclampsia have been previously demonstrated [22,23]. However, the study of these interconnected processes in the placentas of women with LO-PE needs to be more deeply explored.
NADPH oxidase 1 (NOX-1) and NOX-2 are two isoforms of NADPH oxidase enzymes associated with the production of ROS [24,25], aiding to explore potential increases in oxidative stress in different tissues. On the other hand, glutathione peroxidase-4 (GPX-4) is an antioxidant implicated in the protection against oxidative stress, lipid peroxidation and ferroptosis [26]. The transferrin receptor (TFRC) is implicated in the regulation of intracellular iron, whereas acyl-CoA synthetase long-chain family member 4 (ACSL-4) is associated with lipid synthesis and participates in making cell membranes susceptible to lipid peroxidation, and both molecules contribute to ferroptosis [27,28]. Finally, malondialdehyde (MDA) is a product of lipid peroxidation that is formed when lipids are attacked by free radicals during oxidative stress, and 5-lipoxygenase (ALOX-5) is linked to lipid peroxidation and inflammatory processes [29,30]. Likewise, the use of histological techniques and strains such as Blue Prussian can be specifically useful for studying tissue iron levels [31]. In this sense, the aim of the present study is to determine the gene and protein expression of oxidative stress, lipid peroxidation and ferroptosis markers in the placentas of women with LO-PE and compare them with healthy pregnant women (HC-PW). Having this goal, real-time quantitative PCR (RT-qPCR) and immunohistochemical techniques will be performed.

2. Patients and Methods

2.1. Study Design and Participant Demographics

The research employed a prospective observational design, which was nested within a cohort to facilitate comparative analysis. The participants in the study were patients diagnosed with late-onset preeclampsia (LO-PE) who met specific severity criteria outlined in accordance with the American College of Obstetricians and Gynecologists Practice Guidelines for Gestational Hypertension and Preeclampsia [4]. Diagnosis criteria included confirmed elevated blood pressure measurements (systolic ≥ 160 mmHg and/or diastolic ≥ 110 mmHg) after a 15-minute interval, urine protein/creatinine ratio estimation or measurement in a 24 h period, oliguria (≤500 mL/24 h) or diuresis rate (<0.5 mL/kg/h) sustained for two hours, renal failure indicated by a serum creatinine > 1.1 mg/dL or twice the serum creatinine value in the absence of other renal diseases, hematological disorders like thrombocytopenia (<100,000 mm3), disseminated intravascular coagulation (DIC), or hemolysis, as well as neurological or visual disturbances such as persistent severe headache, blurred vision, diplopia, or amaurosis. Other criteria encompassed acute pulmonary edema or cyanosis, epigastric or right hypochondrial pain, liver dysfunction denoted by transaminase levels elevated to twice the normal value, and placental involvement with fetal symptoms including fetal mortality, aberrant umbilical artery Doppler readings, and intrauterine growth restriction (IGR) [32,33]. Within this investigation, the severity of preeclampsia was specifically categorized based on a blood creatinine level exceeding 1.1 mg/dL [4]. Furthermore, 43 pregnant women without any identified ailments, classified as healthy controls (HCs), were included in the study. Table 1 presents the key clinical characteristics of the individuals involved in the study.

2.2. Sample Processing

Following childbirth, placental biopsies were acquired. In each case, the placenta underwent division into five sections to ensure the inclusion of a diverse array of cotyledons within the sample. Subsequently, these fragments were deposited into a sterile tube containing a 1% antibiotic/antimycotic solution and Minimum Essential Medium (MEM) sourced from Thermo Fisher Scientific, Waltham, MA, USA. All specimens were stored under refrigeration and promptly transported to the laboratory within a two-hour timeframe. Utilizing a laminar class II laminar flow hood (Telstar AV 30/70 Müller 220 V 50 MHz; Telstar SA Group, Terrassa, Spain), the samples were processed in a sterile environment. Following this, the MEM samples underwent subsequent analysis through immunodetection and histopathology assessments.
Placental fragments preserved in MEM underwent conventional division procedures with the subsequent extraction of blood cells achieved by immersing the fragments in F13 (comprising 60% ethanol, 20% methanol, 7% polyethylene glycol, and 13% distilled water). Employing molds, initial paraffin blocks were created, and once the paraffin solidified, 5 µm thick slices were meticulously sliced using an HM 350 S rotation microtome from Thermo Fisher Scientific, Waltham, MA, USA. Following this, the sections were immersed in a hot water bath and carefully placed onto a glass slide pre-coated with 10% polylysine to enhance the adherence of the incisions.

2.3. Assessment of Gene Expression

Quantitative assessment of gene expression was carried out through the application of quantitative reverse transcription polymerase chain reaction (RT-qPCR). The determination of cDNA concentration (Thermo Fisher Scientific) in each sample was undertaken. RNA extraction utilized the guanidine–phenol–chloroform isothiocyanate method [34], and the primers employed were designed using the Auto-Dimer program and the Primer-BLAST tool [35,36]. RTqPCR was conducted utilizing the StepOnePlusTM instrument and the relative standard curve method. After dilution with nuclease-free water, 5 µL of each sample was combined with 10 µL of the intercalating agent iQTM SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 1 µL for each primer (forward and reverse), and 3 µL of DNase and RNase-free water. The resulting 20 µL solutions were assessed using a MicroAmp® 96-well plate (Applied Biosystems-Life Technologies, Foster City, CA, USA). To standardize and compare the obtained data, the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Table 2) was employed. Data interpolation for each gene was accomplished using the standard curve. Two tests were conducted on the standard curve, three tests were conducted on the samples, and the remaining two wells were allocated for negative controls.

2.4. Immunohistochemistry

The exploration of antigen–antibody response detection employed the ABC (avidin–biotin complex) method, utilizing peroxidase as the chromogen, in adherence to established protocols [37]. Primary antibody incubation (Table 3) occurred overnight at 4 °C, utilizing a 3% BSA and PBS dilution sourced from Abcam (Cambridge, UK). Conversely, the secondary antibody, coupled to biotin and diluted in PBS, underwent a 1.5 h incubation at room temperature. For chromogenic substrate application, diaminobenzidine (Kit DAB, SK-4100, Vector Laboratories, Burlingame, CA, USA) was utilized for 60 min at room temperature (in a PBS 1:200 dilution) and prepared immediately before exposure (5 mL distilled water, two drops of buffer, four drops of DAB, and two drops of hydrogen peroxide). This process may result in brown staining. Negative controls in each immunohistochemistry experiment involved sections from the same tissue, where primary antibody incubation was replaced by a PBS incubation, acting as a blocking solution.

2.5. Malondialdehyde Assay

A colorimetric lipid peroxidation assay kit (ab118970; Abcam) is a convenient tool for the sensitive detection of MDA in a variety of samples. The MDA that is present in the sample reacts with thiobarbituric acid (TBA) to generate an MDA–TBA adduct that is quantified colorimetrically (OD 532 nm). This assay detects MDA levels as low as 0.1 mol/well of MDA (1 mol/well of MDA in colorimetry). The present study quantified the MDA levels in the placental tissue samples of women with LO-PE and HC. To conduct the experiment, the following protocol was used: Steps 1–3. MDA lysis buffer, phosphotungstic acid solution and butylated hydroxytoluene (BHT; 100×): ready for use as supplied; the buffer was stored at −20 °C and brought to ambient temperature before use; Step 4. TBA solution: a vial of TBA was reconstituted in 7.5 mL of glacial acetic acid, where it then was transferred to another tube, and the final volume was adjusted to 25 mL with ddH2O; the sample was mixed well to dissolve, sonication was performed in an RT water bath, and the sample was stored at 4 °C; and Step 5. standard MDA (4.17 mol/L): ready for use as supplied; the solution was stored at −20 °C and brought to ambient temperature before use.
A total of 20 mg of placental tissue was employed for the analysis, following the outlined protocol: Step 1. Rinse the tissue in cold PBS; Step 2. Prepare the lysis solution consisting of 300 mL of MDA lysis buffer and 3 µL of BHT (100×); Step 3. Homogenize the tissue in 303 µL of the lysis solution (buffer + BHT) with 10–15 passes using a homogenizer on ice; and Step 4. Centrifuge at 13,000× g for 10 min to eliminate insoluble material and collect the supernatant.

2.6. Statistical Analysis

Statistical analysis utilized GraphPad Prism® 6.0, running a Mann–Whitney U-test. Data presentation includes the median and interquartile range (IQR). Significance levels were indicated by p-values of 0.05 (*), 0.01 (**), and 0.001 (***). Immunopositive cell counts in tissue slices involved five random assessments, excluding cells not meeting predetermined demarcation lines.
Patients were classified as positive based on anatomopathological criteria outlined in previous studies with an immunoreactive score (ISR score) exceeding or equal to 5% of the overall test sample score [38]. Analysis of cuts was performed using an optical microscope, specifically the Carl Zeiss Axiophot (Oberkochen, Germany). Two histologists, blinded to the outcome measure, evaluated tissue immunostaining.

3. Results

3.1. The Placentas of Women with Late-Onset Preeclampsia Display Enhanced Expression of NOX-1 and NOX-2

Firstly, our findings demonstrate a statistically significant increase in the expression of the NOX-1 gene in the placental tissue of pregnant women with LO-PE (*** p < 0.0001; LO-PE = 35.565 [15.313–59.365], HC = 23.031 [8.031–40.032], Figure 1A). Histological analysis of placental villi showed that chorionic villi from women with LO-PE exhibited a significant increase in NOX-1 protein expression (*** p < 0.0001; LO-PE = 43.500 [22.000–85.000], HC = 27.000 [14.000–47.000], Figure 1B). The tissue expression of NOX-1 was strongly evident in all placental villi of women affected by LO-PE compared to HC, particularly in the syncytiotrophoblast layer (Figure 1C,D).
In the same line, our data reveal a statistically significant increase in the expression of NOX-2 gene in placental tissue of pregnant women with LO-PE (** p < 0.0076; LO-PE = 25.471 [9.320–50.969], HC = 21.616 [5.065–36.054], Figure 2A). Histological examination of placental villi showed a notable elevation in NOX-2 protein expression in chorionic villi from women with LO-PE (** p < 0.0035; LO-PE = 23.000 [16.000–36.000], HC = 22.000 [10.000–34.000], Figure 2B). Tissue expression of NOX-2 was markedly elevated in all placental villi of women affected by LO-PE in comparison to HC, particularly within the syncytiotrophoblast layer (Figure 2C).

3.2. The Placentas of Women with Late-Onset Preeclampsia Show Augmented Iron Deposits and TFRC Expression

To begin with, we assessed the presence of ferric ions bound to hemosiderin via Prussian Blue staining. Our findings revealed elevated iron deposits in the placental tissue of women with LO-PE compared to HC (*** p < 0.001, LO-PE = 97.000 [26.000–185.000], HC = 35.000 [12.000–88.000]; Figure 3A). Histologically, we observed that the increased iron staining affected the entire villous structure, including syncytiotrophoblasts, cytotrophoblasts, the matrix, and fetal capillaries (Figure 3B).
Similarly, our results indicate a statistically significant increase in the expression of the TFRC gene in placental tissue of pregnant women with LO-PE (*** p < 0.0001; *** p < 0.001, LO-PE = 29.311 [12.321–54.362], HC = 18.066 [5.032–34.065]; Figure 4A). Histological examination of placental villi displayed a noticeable rise in TFRC protein expression in chorionic villi from women with LO-PE (*** p < 0.0001; LO-PE = 41.500 [23.000–75.000], HC = 19.000 [11.000–30.000], Figure 4B). Tissue expression of TFRC was markedly heightened in all placental villi of women affected by LO-PE in comparison to HC, particularly within the syncytiotrophoblast layer (Figure 4C).

3.3. The Placentas of Women with Late-Onset Preeclampsia Exhibit Augmented Levels of ACSL-4, ALOX-5 and GPX-4

Furthermore, our findings indicate a statistically significant increase in the expression of ACSL-4 gene in the placental tissue of pregnant women with LO-PE (*** p < 0.0001; LO-PE = 31.046 [15.016–51.062], HC = 18.065 [8.315–35.055], Figure 5A). A histological examination of placental villi revealed a pronounced elevation in ACSL-4 protein expression in chorionic villi from women with LO-PE (*** p < 0.0001; LO-PE = 45.500 [23.000–89.000], HC = 23.000 [12.000–35.000], Figure 5B). The tissue expression of ACSL-4 was significantly elevated in all placental villi of women affected by LO-PE compared to HC, particularly within the syncytiotrophoblast layer (Figure 5C).
Moreover, our data demonstrate a statistically significant increase in the expression of the ALOX-5 gene in placental tissue of pregnant women with LO-PE (*** p < 0.0001; LO-PE = 32.532 [15.065–55.117], HC = 19.031 [8.065–37.412], Figure 6A). The histological analysis of placental villi exhibited a marked elevation in ALOX-5 protein expression in chorionic villi from women with LO-PE (*** p < 0.0001; LO-PE = 55.000 [25.000–92.000], HC = 16.000 [10.000–32.000], Figure 6B). The tissue expression of ALOX-5 was significantly heightened in all placental villi of women affected by LO-PE compared to HC, particularly within the syncytiotrophoblast layer (Figure 6C).
Lastly, our findings reveal a statistically significant increase in the expression of GPX-4 gene in the placental tissue of pregnant women with LO-PE (** p = 0.0011; LO-PE = 27.082 [18.036–46.032], HC = 22.032 [8.065–37.455], Figure 7A). Histological examination of placental villi showed a notable rise in GPX-4 protein expression in chorionic villi from women with LO-PE (** p = 0.0012; LO-PE = 23.000 [18.000–35.000], HC = 22.000 [11.000–31.000], Figure 7B). The tissue expression of GPX-4 was significantly elevated in all placental villi of women affected by LO-PE compared to HC particularly within the syncytiotrophoblast layer (Figure 7C).

3.4. The Placentas of Women with LO-PE Exhibit Elevated Detection of MDA

Eventually, we also observed that the levels of MDA in placentas from women with LO-PE (143.434 [45.633–194.984] pmol/mg) were significantly higher than those found in the HC group (74.162 [22.654–98.016] pmol/mg; *** p < 0.0001; Figure 8).

4. Discussion

In the present work, we have observed that the placental tissue of women with LO-PE present an increased expression of oxidative stress, lipid peroxidation and ferroptosis markers NOX-1, NOX-2, GPX-4, TFRC, ACSL-4, ALOX-5 and MDA. In addition, an increased presence of iron in the placental tissue of women with LO-PE was evidenced through the Prussian blue staining. The relevance of oxidative stress in the placentas of women with preeclampsia has been supported in prior works, particularly in the EO-PE variant, altering trophoblast behavior and function [39,40,41]. The existing literature has made similar observations by concluding that while there is an increase in ferroptosis and lipid peroxidation in the placental tissue of women with preeclampsia, it appears that these mechanisms carry greater significance in those with EO-PE as opposed to the late-onset variant [42,43,44]. However, few studies have deeply explored the relevance of oxidative stress, ferroptosis and lipid peroxidation markers in the placentas of women with LO-PE. Although the causative role of these mechanisms in this variant is unlikely, the literature agrees that the syncytiotrophoblasts from both women with EO-PE and LO-PE exhibit ROS overproduction, oxidative stress, lipid peroxidation and different types of cell death like ferroptosis [45]. Similarly, these processes are tightly linked to other pathophysiological events such as inflammation, hypoxia and autophagy [46,47], whose relevance in the placental tissue of women with LO-PE has been previously demonstrated [11,48,49,50]. Therefore, our results suggest that oxidative stress, lipid peroxidation and ferroptosis play an important role in the placenta of women with LO-PE, although further efforts are warranted for a better understanding of these mechanisms.
Firstly, we hypothesize that increased NOX-1 and NOX-2 expression could be indicative of an enhanced oxidative insult in the placental tissue. NOX are complex multidomain proteins which play a pivotal role in diverse physiological processes such as host defense, protein processing, signaling, gene expression regulation, and cell differentiation [51]. There are seven members of the Nox/Duox enzyme family in humans: Nox1–5, Duox1, and Duox2 [52]. The different members of the NOX family are generally located in the plasma membrane and intracellular compartments, including the mitochondria, the endoplasmic reticulum, and the nuclear envelope, except NOX-2, which is more commonly found within intracellular vesicles, being translocated to the phagosome and/or the plasma membrane on cell activation [53]. Nox/Duox family NADPH oxidases are the primary sources of regulated ROS production, particularly the superoxide anion [54]. NOX-1 and NOX-2 are two proteins highly expressed by trophoblastic cells in the placenta during early developmental phases but also in the third trimester of physiological pregnancies, having a close association with inflammatory events [55,56]. However, augmented levels of these molecules in this tissue have been related to the development of different obstetric complications [57,58,59,60]. In case of preeclampsia, Poinsignon et al. [56] recently found that NOX-1 was downregulated in the placentas of women with EO-PE. Conversely, Cui et al. [58] described that NOX-1 expression was significantly increased in the syncytiotrophoblast and endothelial cells from women with preeclampsia, although they did not specify the type of preeclampsia. Thus, it is likely that NOX-1 might have a differential role in EO-PE when compared to LO-PE. On the other hand, NOX-2 has been found to be augmented in the placental tissue and other maternofetal structures of women with preeclampsia, since its overexpression is associated with endothelial cell damage [61] along with changes in mitochondrial respiration, the transition of glycolysis, inhibition of placental angiogenesis and enhanced ferroptosis [62]. Thus, the increased expression of NOX-1 and NOX-2 might have a potential biological significance in the placentas of women with LO-PE, being critically involved in enhanced oxidative stress and additional related pathogenic mechanisms.
The relevance of ferroptosis and lipid peroxidation in the placentas of women with LO-PE is herein evidenced by increased iron deposits (measured by Prussian Blue staining) and TFRC expression when compared to healthy pregnant women. Iron mainly exists in two ionic forms, ferrous (Fe2+) and ferric (Fe3+). Transferrin receptor 1 (TFRC1) is involved in the importation of the iron-bound transferrin (Fe3+) from the blood or extracellular matrix to the cell by endocytosis in endosomes [63]. Perls’ Prussian Blue staining is responsible for detecting the iron in a ferric state. Increased iron deposits in the placenta of women with different diseases through the application of Perls’ Prussian Blue staining have been demonstrated in past works [64,65]. Similarly, an altered expression of TFRC seems to be broadly accepted as an important marker of ferroptosis [66]. In this study, we report that an increased accumulation of extracellular ferric iron and TFRC can be observed in the placentas of women with LO-PE. Contrary to our results, Masoumi et al. [64] found that the placentas of women with EO-PE (n = 6) presented increased iron deposits evidenced by this technique; but no significant changes were found between LO-PE (n = 10) and healthy pregnant women (n = 10). In parallel, TFRC was shown to be slightly decreased in both types of preeclampsia. A possible explanation of the differences observed in our results might be attributed to the differences in sample size. According to the literature, despite reduced TFRC expression being generally related to ferroptosis, an increased expression of this component augments the labile redox-active iron pool, which is equally needed for ferroptosis [66]. Further studies including a greater population of women with LO-PE could aid in better understanding the relevance of placental iron deposits and transports in the placenta in women affected by this condition.
In parallel, previous works have also related ACSL-4, ALOX-5 and GPX-4 with both ferroptosis and lipid peroxidation [67]. ACSL-4 is a unique isozyme that preferentially catalyzes several PUFAs such as arachidonic acid (AA) into acyl-CoAs [68]. This function modulates a broad spectrum of physiological processes, including inflammation steroidogenesis, cancer and different types of cell death, including ferroptosis [69]. Mechanistically, the effect of ACSL-4 in the enrichment of long-chain PUFAs makes cellular membranes susceptible to suffer from lipid peroxidation and ferroptosis, particularly in an environment associated with increased free radicals and oxidative stress [28]. ALOX-5 is an iron-containing and nonheme dioxygenase that catalyzes the peroxidation of polyunsaturated fatty acids like AA as well, mediating different types of cell death like ferroptosis by promoting an inflammatory environment and lipid peroxidation [30]. Contrary to these activities, GPX4 is a selenoenzyme implicated in the reduction of phospholipid hydroperoxides (PLOOH), which is a toxic lipid oxidation product [70]. GPX-4 is integrated in a concerted antiperoxidative mechanism together with reduced glutathione (GSH) and α-tocopherol, ameliorating processes of lipid peroxidation and ferroptosis [71]. In general, the literature recognizes that oxidative stress and lipid peroxidation can influence ferroptosis by an ACSL4-dependent pathway or through the activity of the ALOX enzymes with GPX-4 exerting an important counteract action against both enzymes [72,73]. An increased expression of ACSL-4 and ALOX-5 together with decreased GPX4 levels in the placenta has been associated with trophoblastic ferroptosis and different obstetric complications such as preeclampsia [22]. Overall and based on the available literature [74], as increased levels of ACSL-4, ALOX-5 and ferric iron are valuable markers of lipid peroxidation and ferroptosis, we hypothesize that the concomitant increase in these components in our study might reflect an increased susceptibility to lipid peroxidation and ferroptosis that is intended to be ameliorated by an increased expression of GPX-4. Further studies are, however, warranted to verify if ferroptosis and lipid peroxidation are important mechanisms occurring in the placentas of women with LO-PE. Compelling evidence also supports the existence of a broad spectrum of GPX-4 independent mechanisms of ferroptosis [75], which should be studied in the placentas of women with LO-PE in future works.
Finally, we have observed that oxidative stress may lead to lipid peroxidation in women with LO-PE, as MDA is notably increased both in the placental tissue and in the maternal blood. MDA is the result of a reaction of free radicals with PUFAs which can react with cellular components such as proteins, DNA, and lipids, leading to cellular damage and dysfunction [76,77]. An increased presence of MDA in the placental tissue and plasma has been detected in different obstetric complications from vascular origin including preeclampsia and gestational venous hypertension [60,78,79]. In case of preeclampsia, Freire et al. [80] developed a meta-analysis to study different oxidative stress markers in different subtypes of preeclampsia. Specifically, they obtained interesting results comparing mild versus severe preeclampsia, and although they did not focus on early versus LO-PE, they reported that the MDA levels were higher in the blood of women in the third trimester of pregnancy with both mild and severe variants with a greater increase in the latter. They also showed that MDA levels in the placental tissue were significantly higher in both subtypes of preeclampsia, suggesting that the levels of this marker in the third trimester of pregnancy correlated with the severity of the disease. In agreement with this statement, previous works have suggested the valuable use of this component as a diagnostic biomarker for this condition [81]. Although we have not compared the levels between early and LO-PE, our results suggest that increased blood and placental MDA levels can also be indicative of this subtype of preeclampsia, offering potential translational applications to be explored in future works. Likewise, it is important to remark that some authors argue that not only the placenta but also organs and cells of the body are of great relevance in the pathogenesis of EO-PE and LO-PE. For instance, some authors give a central role to different alterations affecting podocytes, located in the kidneys [82,83,84], whereas endothelial cells, the liver or even the pancreas have also been suggested to take part in the pathogenesis and development of preeclampsia [85]. Future works relating placental changes similar to those observed in our study with clinical or biological parameters associated with these structures will be of great importance to connect and understand the complex picture of early and late-onset preeclampsia.

5. Conclusions

In conclusion, our prospective observational study provides compelling evidence of different pathophysiological pathways in the placentas of women with LO-PE. The upregulation of oxidative stress, ferroptosis, and lipid peroxidation markers in this tissue suggests a complex interplay of molecular mechanisms contributing to the pathogenesis of this disorder. These findings offer valuable insights into potential therapeutic targets for mitigating the adverse outcomes associated with LO-PE.

Author Contributions

Conceptualization, M.A.O., J.A.D.L.-L., C.B. and M.A.S.; methodology, M.A.O., L.M.G.-P., O.F.-M., T.P., C.G.-M., P.R.-B., J.A.D.L.-L., C.B. and M.A.S.; software, M.A.O. and O.F.-M.; validation, J.A.D.L.-L.; formal analysis, M.A.O., L.M.G.-P., J.A.D.L.-L., C.B. and M.A.S.; investigation, M.A.O., L.M.G.-P., O.F.-M., T.P., C.G.-M., J.B., L.P., S.B.-B., R.G., I.C.R.-R., P.R.-B., L.L.-G., R.D.-P., M.Á.-M., N.G.-H., J.A.D.L.-L., C.B. and M.A.S.; resources, M.A.O.; data curation, M.A.O.; writing—original draft preparation, M.A.O., L.M.G.-P., O.F.-M., T.P., C.G.-M., J.B., L.P., S.B.-B., R.G., I.C.R.-R., P.R.-B., L.L.-G., R.D.-P., M.Á.-M., N.G.-H., J.A.D.L.-L., C.B. and M.A.S.; writing—review and editing, M.A.O., L.M.G.-P., O.F.-M., T.P., C.G.-M., J.B., L.P., S.B.-B., R.G., I.C.R.-R., P.R.-B., L.L.-G., R.D.-P., M.Á.-M., N.G.-H., J.A.D.L.-L., C.B. and M.A.S.; visualization, M.A.O., L.M.G.-P., O.F.-M., T.P., C.G.-M. and J.B.; supervision, M.A.S.; project administration, M.A.O.; funding acquisition, M.A.O. and M.Á.-M. All authors have read and agreed to the published version of the manuscript.

Funding

The study (FIS-PI21/01244) was supported by the Instituto de Salud Carlos III (grant no. Estatal de I + D + I 2020–2027) and co-financed by the European Development Regional Fund “A way to achieve Europe”, as well as P2022/BMD-7321 (Comunidad de Madrid) and ProACapital, Halekulani S.L. and MJR.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of Clinical Investigations of the Central University Hospital of Principe de Asturias-UAH (LIB 12/2022 on 30 September 2022).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data used to support the findings of the present study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Filipek, A.; Jurewicz, E. [Preeclampsia—A Disease of Pregnant Women]. Postep. Biochem. 2018, 64, 229–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Tranquilli, A.L. Introduction to ISSHP New Classification of Preeclampsia. Pregnancy Hypertens. 2013, 3, 58–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Brown, M.A.; Magee, L.A.; Kenny, L.C.; Karumanchi, S.A.; McCarthy, F.P.; Saito, S.; Hall, D.R.; Warren, C.E.; Adoyi, G.; Ishaku, S. Hypertensive Disorders of Pregnancy: ISSHP Classification, Diagnosis, and Management Recommendations for International Practice. Hypertension 2018, 72, 24–43. [Google Scholar] [CrossRef] [Scilit]
  4. Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222. Obstet. Gynecol. 2020, 135, E237–E260. [CrossRef] [Scilit] [PubMed]
  5. Raymond, D.; Peterson, E. A Critical Review of Early-Onset and Late-Onset Preeclampsia. Obs. Gynecol. Surv. 2011, 66, 497–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Lisonkova, S.; Joseph, K.S. Incidence of Preeclampsia: Risk Factors and Outcomes Associated with Early- versus Late-Onset Disease. Am. J. Obs. Gynecol. 2013, 209, 544.e1–544.e12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Herzog, E.M.; Eggink, A.J.; Reijnierse, A.; Kerkhof, M.A.M.; de Krijger, R.R.; Roks, A.J.M.; Reiss, I.K.M.; Nigg, A.L.; Eilers, P.H.C.; Steegers, E.A.P.; et al. Impact of Early- and Late-Onset Preeclampsia on Features of Placental and Newborn Vascular Health. Placenta 2017, 49, 72–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Lisonkova, S.; Sabr, Y.; Mayer, C.; Young, C.; Skoll, A.; Joseph, K.S. Maternal Morbidity Associated with Early-Onset and Late-Onset Preeclampsia. Obstet. Gynecol. 2014, 124, 771–781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Sáez, M.A.; Álvarez-Mon, M.A.; Torres-Carranza, D.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; Bravo, C.; et al. The Pivotal Role of the Placenta in Normal and Pathological Pregnancies: A Focus on Preeclampsia, Fetal Growth Restriction, and Maternal Chronic Venous Disease. Cells 2022, 11, 568. [Google Scholar] [CrossRef] [Scilit]
  10. Ren, Z.; Gao, Y.; Gao, Y.; Liang, G.; Chen, Q.; Jiang, S.; Yang, X.; Fan, C.; Wang, H.; Wang, J.; et al. Distinct Placental Molecular Processes Associated with Early-Onset and Late-Onset Preeclampsia. Theranostics 2021, 11, 5028. [Google Scholar] [CrossRef] [Scilit]
  11. Staff, A.C. The Two-Stage Placental Model of Preeclampsia: An Update. J. Reprod. Immunol. 2019, 134–135, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Ji, L.L.; Yeo, D. Oxidative Stress: An Evolving Definition. Fac. Rev. 2021, 10, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid. Med. Cell Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxid. Med. Cell Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gaschler, M.M.; Stockwell, B.R. Lipid Peroxidation in Cell Death. Biochem. Biophys. Res. Commun. 2017, 482, 419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Jakovljevic, B.; Novakov-Mikic, A.; Brkic, S.; Bogavac, M.A.; Tomic, S.; Miler, V. Lipid Peroxidation in the First Trimester of Pregnancy. J. Matern. -Fetal Neonatal Med. 2012, 25, 1316–1318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Johnston, P.C.; McCance, D.R.; Holmes, V.A.; Young, I.S.; McGinty, A. Placental Antioxidant Enzyme Status and Lipid Peroxidation in Pregnant Women with Type 1 Diabetes: The Effect of Vitamin C and E Supplementation. J. Diabetes Complicat. 2016, 30, 109–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Wu, F.; Tian, F.J.; Lin, Y.; Xu, W.M. Oxidative Stress: Placenta Function and Dysfunction. Am. J. Reprod. Immunol. 2016, 76, 258–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Schoots, M.H.; Gordijn, S.J.; Scherjon, S.A.; van Goor, H.; Hillebrands, J.L. Oxidative Stress in Placental Pathology. Placenta 2018, 69, 153–161. [Google Scholar] [CrossRef] [Scilit]
  20. Mégier, C.; Peoc’h, K.; Puy, V.; Cordier, A.G. Iron Metabolism in Normal and Pathological Pregnancies and Fetal Consequences. Metabolites 2022, 12, 129. [Google Scholar] [CrossRef] [Scilit]
  21. Zhang, Y.; Lu, Y.; Jin, L. Iron Metabolism and Ferroptosis in Physiological and Pathological Pregnancy. Int. J. Mol. Sci. 2022, 23, 9395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Beharier, O.; Kajiwara, K.; Sadovsky, Y. Ferroptosis, Trophoblast Lipotoxic Damage, and Adverse Pregnancy Outcome. Placenta 2021, 108, 32–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Ding, Y.; Yang, X.; Han, X.; Shi, M.; Sun, L.; Liu, M.; Zhang, P.; Huang, Z.; Yang, X.; Li, R. Ferroptosis-Related Gene Expression in the Pathogenesis of Preeclampsia. Front. Genet. 2022, 13, 2043. [Google Scholar]
  24. Salazar, G. NADPH Oxidases and Mitochondria in Vascular Senescence. Int. J. Mol. Sci. 2018, 19, 1327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Tarafdar, A.; Pula, G. The Role of NADPH Oxidases and Oxidative Stress in Neurodegenerative Disorders. Int. J. Mol. Sci. 2018, 19, 3824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Ursini, F.; Maiorino, M. Lipid Peroxidation and Ferroptosis: The Role of GSH and GPx4. Free Radic. Biol. Med. 2020, 152, 175–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Kawabata, H. Transferrin and Transferrin Receptors Update. Free Radic. Biol. Med. 2019, 133, 46–54. [Google Scholar] [CrossRef] [Scilit]
  28. Doll, S.; Proneth, B.; Tyurina, Y.Y.; Panzilius, E.; Kobayashi, S.; Ingold, I.; Irmler, M.; Beckers, J.; Aichler, M.; Walch, A.; et al. ACSL4 Dictates Ferroptosis Sensitivity by Shaping Cellular Lipid Composition. Nat. Chem. Biol. 2017, 13, 91–98. [Google Scholar] [CrossRef] [Scilit]
  29. Tsikas, D. Assessment of Lipid Peroxidation by Measuring Malondialdehyde (MDA) and Relatives in Biological Samples: Analytical and Biological Challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [Scilit]
  30. Sun, Q.Y.; Zhou, H.H.; Mao, X.Y. Emerging Roles of 5-Lipoxygenase Phosphorylation in Inflammation and Cell Death. Oxid. Med. Cell Longev. 2019, 2019, 2749173. [Google Scholar] [CrossRef] [Scilit]
  31. Bitonto, V.; Garello, F.; Scherberich, A.; Filippi, M. Prussian Blue Staining to Visualize Iron Oxide Nanoparticles. Methods Mol. Biol. 2023, 2566, 321–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Von Dadelszen, P.; Payne, B.; Li, J.; Ansermino, J.M.; Pipkin, F.B.; Côté, A.M.; Douglas, M.J.; Gruslin, A.; Hutcheon, J.A.; Joseph, K.S.; et al. Prediction of Adverse Maternal Outcomes in Pre-Eclampsia: Development and Validation of the FullPIERS Model. Lancet 2011, 377, 219–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Sibai, B.M. Evaluation and Management of Severe Preeclampsia before 34 Weeks’ Gestation. Am. J. Obs. Gynecol. 2011, 205, 191–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Ortega, M.A.; Sáez, M.A.; Fraile-Martínez, O.; Álvarez-Mon, M.A.; García-Montero, C.; Guijarro, L.G.; Asúnsolo, Á.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; et al. Overexpression of Glycolysis Markers in Placental Tissue of Pregnant Women with Chronic Venous Disease: A Histological Study. Int. J. Med. Sci. 2022, 19, 186. [Google Scholar] [CrossRef] [Scilit]
  35. Vallone, P.M.; Butler, J.M. AutoDimer: A Screening Tool for Primer-Dimer and Hairpin Structures. Biotechniques 2004, 37, 226–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Ortega, M.A.; Fraile-Martinez, O.; García-Montero, C.; Rodriguez-Martín, S.; Funes Moñux, R.M.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Saez, M.A.; Guijarro, L.G.; et al. Evidence of Increased Oxidative Stress in the Placental Tissue of Women Who Suffered an Episode of Psychosis during Pregnancy. Antioxidants 2023, 12, 179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Rodríguez-Martín, S.; Funes Moñux, R.M.; Pekarek, L.; Bravo, C.; De Leon-Luis, J.A.; Saez, M.A.; Guijarro, L.G.; et al. Women with Psychotic Episodes during Pregnancy Show Increased Markers of Placental Damage with Tenney-Parker Changes. Histol. Histopathol. 2023, 38, 1109–1118. [Google Scholar] [CrossRef] [Scilit]
  39. Aouache, R.; Biquard, L.; Vaiman, D.; Miralles, F. Oxidative Stress in Preeclampsia and Placental Diseases. Int. J. Mol. Sci. 2018, 19, 1496. [Google Scholar] [CrossRef] [Scilit]
  40. Mukherjee, I.; Dhar, R.; Singh, S.; Sharma, J.B.; Nag, T.C.; Mridha, A.R.; Jaiswal, P.; Biswas, S.; Karmakar, S. Oxidative Stress-Induced Impairment of Trophoblast Function Causes Preeclampsia through the Unfolded Protein Response Pathway. Sci. Rep. 2021, 11, 18415. [Google Scholar] [CrossRef] [Scilit]
  41. Phoswa, W.N.; Khaliq, O.P. The Role of Oxidative Stress in Hypertensive Disorders of Pregnancy (Preeclampsia, Gestational Hypertension) and Metabolic Disorder of Pregnancy (Gestational Diabetes Mellitus). Oxid. Med. Cell Longev. 2021, 2021, 5581570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Chen, Z.; Gan, J.; Zhang, M.; Du, Y.; Zhao, H. Ferroptosis and Its Emerging Role in Pre-Eclampsia. Antioxidants 2022, 11, 1282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Yang, N.; Wang, Q.; Ding, B.; Gong, Y.; Wu, Y.; Sun, J.; Wang, X.; Liu, L.; Zhang, F.; Du, D.; et al. Expression Profiles and Functions of Ferroptosis-Related Genes in the Placental Tissue Samples of Early- and Late-Onset Preeclampsia Patients. BMC Pregnancy Childbirth 2022, 22, 87. [Google Scholar]
  44. Gupta, S.; Aziz, N.; Sekhon, L.; Agarwal, R.; Mansour, G.; Li, J.; Agarwal, A. Lipid Peroxidation and Antioxidant Status in Preeclampsia: A Systematic Review. Obs. Gynecol. Surv. 2009, 64, 750–759. [Google Scholar] [CrossRef] [Scilit]
  45. Marín, R.; Chiarello, D.I.; Abad, C.; Rojas, D.; Toledo, F.; Sobrevia, L. Oxidative Stress and Mitochondrial Dysfunction in Early-Onset and Late-Onset Preeclampsia. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2020, 1866, 165961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Yun, H.R.; Jo, Y.H.; Kim, J.; Shin, Y.; Kim, S.S.; Choi, T.G. Roles of Autophagy in Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 3289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. McGarry, T.; Biniecka, M.; Veale, D.J.; Fearon, U. Hypoxia, Oxidative Stress and Inflammation. Free Radic. Biol. Med. 2018, 125, 15–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Sriyanti, R.; Mose, J.C.; Masrul, M.; Suharti, N. The Difference in Maternal Serum Hypoxia-Inducible Factors-1α Levels between Early Onset and Late-Onset Preeclampsia. Open Access Maced. J. Med. Sci. 2019, 7, 2133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Garcia-Puente, L.M.; García-Montero, C.; Fraile-Martinez, O.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; López-González, L.; Díaz-Pedrero, R.; Álvarez-Mon, M.; et al. Exploring the Importance of Differential Expression of Autophagy Markers in Term Placentas from Late-Onset Preeclamptic Pregnancies. Int. J. Mol. Sci. 2024, 25, 2029. [Google Scholar] [CrossRef] [Scilit]
  50. Garcia-Puente, L.M.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; Pintado, P.; Ruiz-Labarta, F.J.; Álvarez-Mon, M.; et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules 2023, 13, 1644. [Google Scholar] [CrossRef] [Scilit]
  51. Vermot, A.; Petit-Härtlein, I.; Smith, S.M.E.; Fieschi, F. NADPH Oxidases (NOX): An Overview from Discovery, Molecular Mechanisms to Physiology and Pathology. Antioxidants 2021, 10, 890. [Google Scholar] [CrossRef] [Scilit]
  52. Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Sola, M.; Álavrez-Rocha, M.J.; Sainz, F.; Álavrez-Mon, M.; Buján, J.; García-Honduvilla, N. Patients with Incompetent Valves in Chronic Venous Insufficiency Show Increased Systematic Lipid Peroxidation and Cellular Oxidative Stress Markers. Oxid Med Cell Longev. 2019, 10, 5164576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Nayernia, Z.; Jaquet, V.; Krause, K.H. New Insights on NOX Enzymes in the Central Nervous System. Antioxid. Redox Signal. 2014, 20, 2815. [Google Scholar] [CrossRef] [Scilit]
  54. Sirokmány, G.; Donkó, Á.; Geiszt, M. Nox/Duox Family of NADPH Oxidases: Lessons from Knockout Mouse Models. Trends Pharmacol. Sci. 2016, 37, 318–327. [Google Scholar] [CrossRef] [Scilit]
  55. Hernandez, I.; Fournier, T.; Chissey, A.; Therond, P.; Slama, A.; Beaudeux, J.L.; Zerrad-Saadi, A. NADPH Oxidase Is the Major Source of Placental Superoxide in Early Pregnancy: Association with MAPK Pathway Activation. Sci. Rep. 2019, 9, 13962. [Google Scholar] [CrossRef] [Scilit]
  56. Poinsignon, L.; Chissey, A.; Ajjaji, A.; Hernandez, I.; Vignaud, M.L.; Ferecatu, I.; Fournier, T.; Beaudeux, J.L.; Zerrad-Saadi, A. Placental Cartography of NADPH Oxidase (NOX) Family Proteins: Involvement in the Pathophysiology of Preeclampsia. Arch. Biochem. Biophys. 2023, 749, 109787. [Google Scholar] [CrossRef] [Scilit]
  57. Williamson, R.D.; McCarthy, C.; McCarthy, F.P.; Kenny, L.C. Oxidative Stress in Pre-Eclampsia; Have We Been Looking in the Wrong Place? Pregnancy Hypertens. Int. J. Women’s Cardiovasc. Health 2017, 8, 1–5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Cui, X.L.; Brockman, D.; Campos, B.; Myatt, L. Expression of NADPH Oxidase Isoform 1 (Nox1) in Human Placenta: Involvement in Preeclampsia. Placenta 2006, 27, 422. [Google Scholar] [CrossRef] [Scilit]
  59. Polettini, J.; Silva, M.G.; Kacerovsky, M.; Syed, T.A.; Saade, G.; Menon, R. Expression Profiles of Fetal Membrane Nicotinamide Adenine Dinucleotide Phosphate Oxidases (NOX) 2 and 3 Differentiates Spontaneous Preterm Birth and PPROM Pathophysiologies. Placenta 2014, 35, 188–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Martínez-Vivero, C.; Sainz, F.; Bravo, C.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Pregnancy-Associated Venous Insufficiency Course with Placental and Systemic Oxidative Stress. J. Cell Mol. Med. 2020, 24, 4157–4170. [Google Scholar] [CrossRef] [Scilit]
  61. Chen, J.; Gao, Q.; Jiang, L.; Feng, X.; Zhu, X.; Fan, X.; Mao, C.; Xu, Z. The NOX2-Derived Reactive Oxygen Species Damaged Endothelial Nitric Oxide System via Suppressed BKCa/SKCa in Preeclampsia. Hypertens. Res. 2017, 40, 457–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Xu, X.; Zhu, M.; Zu, Y.; Wang, G.; Li, X.; Yan, J. Nox2 Inhibition Reduces Trophoblast Ferroptosis in Preeclampsia via the STAT3/GPX4 Pathway. Life Sci. 2024, 343, 122555. [Google Scholar] [CrossRef] [Scilit]
  63. Zhou, B.; Liu, J.; Kang, R.; Klionsky, D.J.; Kroemer, G.; Tang, D. Ferroptosis Is a Type of Autophagy-Dependent Cell Death. Semin. Cancer Biol. 2020, 66, 89–100. [Google Scholar] [CrossRef] [Scilit]
  64. Masoumi, Z.; Hansson, L.R.; Hansson, E.; Ahlm, E.; Mezey, E.; Erlandsson, L.; Hansson, S.R. Assessing Erythroferrone and Iron Homeostasis in Preeclamptic and Normotensive Pregnancies: A Retrospective Study. Placenta 2023, 133, 10–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Ortega, M.A.; Fraile-Martinez, O.; García-Montero, C.; Funes Moñux, R.M.; Rodriguez-Martín, S.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Saez, M.A.; Guijarro, L.G.; et al. The Placentas of Women Who Suffer an Episode of Psychosis during Pregnancy Have Increased Lipid Peroxidation with Evidence of Ferroptosis. Biomolecules 2023, 13, 120. [Google Scholar] [CrossRef] [Scilit]
  66. Feng, H.; Schorpp, K.; Jin, J.; Yozwiak, C.E.; Hoffstrom, B.G.; Decker, A.M.; Rajbhandari, P.; Stokes, M.E.; Bender, H.G.; Csuka, J.M.; et al. Transferrin Receptor Is a Specific Ferroptosis Marker. Cell Rep. 2020, 30, 3411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular Mechanisms and Health Implications. Cell Res. 2020, 31, 107–125. [Google Scholar] [CrossRef] [Scilit]
  68. Shimbara-Matsubayashi, S.; Kuwata, H.; Tanaka, N.; Kato, M.; Hara, S. Analysis on the Substrate Specificity of Recombinant Human Acyl-CoA Synthetase ACSL4 Variants. Biol. Pharm. Bull. 2019, 42, 850–855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Kuwata, H.; Hara, S. Role of Acyl-CoA Synthetase ACSL4 in Arachidonic Acid Metabolism. Prostaglandins Other Lipid Mediat. 2019, 144, 106363. [Google Scholar] [CrossRef] [Scilit]
  70. Xie, Y.; Kang, R.; Klionsky, D.J.; Tang, D. GPX4 in Cell Death, Autophagy, and Disease. Autophagy 2023, 19, 2621. [Google Scholar] [CrossRef] [Scilit]
  71. Maiorino, M.; Conrad, M.; Ursini, F. GPx4, Lipid Peroxidation, and Cell Death: Discoveries, Rediscoveries, and Open Issues. Antioxid. Redox Signal 2018, 29, 61–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Conrad, M.; Friedmann Angeli, J.P. Glutathione Peroxidase 4 (Gpx4) and Ferroptosis: What’s so Special about It? Mol. Cell Oncol. 2015, 2, e995047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Song, S.; Su, Z.; Kon, N.; Chu, B.; Li, H.; Jiang, X.; Luo, J.; Stockwell, B.R.; Gu, W. ALOX5-Mediated Ferroptosis Acts as a Distinct Cell Death Pathway upon Oxidative Stress in Huntington’s Disease. Genes Dev. 2023, 37, 204–217. [Google Scholar] [PubMed]
  74. Seibt, T.M.; Proneth, B.; Conrad, M. Role of GPX4 in Ferroptosis and Its Pharmacological Implication. Free Radic. Biol. Med. 2019, 133, 144–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Ma, T.; Du, J.; Zhang, Y.; Wang, Y.; Wang, B.; Zhang, T. GPX4-Independent Ferroptosis—A New Strategy in Disease’s Therapy. Cell Death Discovery 2022, 8, 434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Girón, S.H.; Sanz, J.M.; Ortega, M.A.; Garcia-Montero, C.; Fraile-Martínez, O.; Gómez-Lahoz, A.M.; Boaru, D.L.; de Leon-Oliva, D.; Guijarro, L.G.; Atienza-Perez, M.; et al. Prognostic Value of Malondialdehyde (MDA) in the Temporal Progression of Chronic Spinal Cord Injury. J. Pers. Med. 2023, 13, 626. [Google Scholar] [CrossRef] [Scilit]
  77. Alvarez-Mon, M.A.; Ortega, M.A.; García-Montero, C.; Fraile-Martinez, O.; Lahera, G.; Monserrat, J.; Gomez-Lahoz, A.M.; Molero, P.; Gutierrez-Rojas, L.; Rodriguez-Jimenez, R.; et al. Differential Malondialdehyde (MDA) Detection in Plasma Samples of Patients with Major Depressive Disorder (MDD): A Potential Biomarker. J. Int. Med. Res. 2022, 50, 030006052210949. [Google Scholar] [CrossRef] [Scilit]
  78. Ortega, M.A.; Sánchez-Trujillo, L.; Bravo, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Alvarez-Mon, M.A.; Sainz, F.; Alvarez-Mon, M.; Bujan, J.; et al. Newborns of Mothers with Venous Disease during Pregnancy Show Increased Levels of Lipid Peroxidation and Markers of Oxidative Stress and Hypoxia in the Umbilical Cord. Antioxidants 2021, 10, 980. [Google Scholar] [CrossRef] [Scilit]
  79. Gohil, J.T.; Patel, P.K.; Priyanka, G. Evaluation of Oxidative Stress and Antioxidant Defence in Subjects of Preeclampsia. J. Obs. Gynaecol. India 2011, 61, 638. [Google Scholar] [CrossRef] [Scilit]
  80. Freire, V.A.F.; de Melo, A.D.; de Lima Santos, H.; Barros-Pinheiro, M. Evaluation of Oxidative Stress Markers in Subtypes of Preeclampsia: A Systematic Review and Meta-Analysis. Placenta 2023, 132, 55–67. [Google Scholar] [CrossRef] [Scilit]
  81. Afrose, D.; Chen, H.; Ranashinghe, A.; Liu, C.C.; Henessy, A.; Hansbro, P.M.; McClements, L. The Diagnostic Potential of Oxidative Stress Biomarkers for Preeclampsia: Systematic Review and Meta-Analysis. Biol. Sex. Differ. 2022, 13, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  82. Kwiatkowska, E.; Stefańska, K.; Zieliński, M.; Sakowska, J.; Jankowiak, M.; Trzonkowski, P.; Marek-Trzonkowska, N.; Kwiatkowski, S. Podocytes—The Most Vulnerable Renal Cells in Preeclampsia. Int. J. Mol. Sci. 2020, 21, 5051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Mesfine, B.B.; Vojisavljevic, D.; Kapoor, R.; Watson, D.; Kandasamy, Y.; Rudd, D. Urinary nephrin-a potential marker of early glomerular injury: A systematic review and meta-analysis. J. Nephrol. 2024, 37, 39–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Avendanha, R.A.; Campos, G.F.C.; Branco, B.C.; Ishii, N.C.; Gomes, L.H.N.; de Castro, A.J.; Leal, C.R.V.; e Silva, A.C.S. Potential urinary biomarkers in preeclampsia: A narrative review. Mol. Biol. Rep. 2024, 51, 172. [Google Scholar] [CrossRef] [Scilit]
  85. Phipps, E.A.; Thadhani, R.; Benzing, T.; Karumanchi, S.A. Pre-eclampsia: Pathogenesis, novel diagnostics and therapies. Nat. Rev. Nephrol. 2019, 15, 275–289. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Comparative analysis of NOX1 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for NOX1 gene expression. Panel (B) displays the IRS-score of NOX1 expression within placental villi. Panel (C) showcases histological images depicting NOX1 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Figure 1. Comparative analysis of NOX1 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for NOX1 gene expression. Panel (B) displays the IRS-score of NOX1 expression within placental villi. Panel (C) showcases histological images depicting NOX1 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Antioxidants 13 00591 g001
Figure 2. Comparative analysis of NOX2 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for NOX2 gene expression. Panel (B) displays the IRS-score of NOX2 expression within placental villi. Panel (C) showcases histological images depicting NOX2 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.01 (**).
Figure 2. Comparative analysis of NOX2 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for NOX2 gene expression. Panel (B) displays the IRS-score of NOX2 expression within placental villi. Panel (C) showcases histological images depicting NOX2 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.01 (**).
Antioxidants 13 00591 g002
Figure 3. Histopathological examination (Panel (A))of iron deposits conducted using Perls’ Prussian Blue staining, depicting positive villi in women with LO-PE (Panel (B)) and healthy control pregnant women (HC) group (Panel (C)). Statistical analysis revealed significant differences (p < 0.001, ***). Arrow = Iron deposit.
Figure 3. Histopathological examination (Panel (A))of iron deposits conducted using Perls’ Prussian Blue staining, depicting positive villi in women with LO-PE (Panel (B)) and healthy control pregnant women (HC) group (Panel (C)). Statistical analysis revealed significant differences (p < 0.001, ***). Arrow = Iron deposit.
Antioxidants 13 00591 g003
Figure 4. Comparative analysis of TFRC gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for TFRC gene expression. Panel (B) displays the IRS-score of TFRC expression within placental villi. Panel (C) showcases histological images depicting TFRC protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Figure 4. Comparative analysis of TFRC gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for TFRC gene expression. Panel (B) displays the IRS-score of TFRC expression within placental villi. Panel (C) showcases histological images depicting TFRC protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Antioxidants 13 00591 g004
Figure 5. Comparative analysis of ACSL4 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for ACSL4 gene expression. Panel (B) displays the IRS-score of ACSL4 expression within placental villi. Panel (C) showcases histological images depicting ACSL4 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Figure 5. Comparative analysis of ACSL4 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for ACSL4 gene expression. Panel (B) displays the IRS-score of ACSL4 expression within placental villi. Panel (C) showcases histological images depicting ACSL4 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Antioxidants 13 00591 g005
Figure 6. Comparative analysis of ALOX5 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for ALOX5 gene expression. Panel (B) displays the IRS-score of ALOX5 expression within placental villi. Panel (C) showcases histological images depicting ALOX5 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Figure 6. Comparative analysis of ALOX5 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for ALOX5 gene expression. Panel (B) displays the IRS-score of ALOX5 expression within placental villi. Panel (C) showcases histological images depicting ALOX5 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.001 (***).
Antioxidants 13 00591 g006
Figure 7. Comparative analysis of GPX4 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for GPX4 gene expression. Panel (B) displays the IRS score of GPX4 expression within placental villi. Panel (C) showcases histological images depicting GPX4 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.01 (**).
Figure 7. Comparative analysis of GPX4 gene expression in late-onset preeclampsia (LO-PE) versus healthy control (HC) pregnant women. Panel (A) presents the results of RT-qPCR measurements for GPX4 gene expression. Panel (B) displays the IRS score of GPX4 expression within placental villi. Panel (C) showcases histological images depicting GPX4 protein expression in placental villi of women with LO-PE, while Panel (D) contrasts this expression with that of HC individuals. p-values of 0.01 (**).
Antioxidants 13 00591 g007
Figure 8. Malondialdehyde (MDA) levels in pmol/mg in the placental tissues of pregnant women with healthy control (HC) pregnant women and late-onset preeclampsia (LO-PE).
Figure 8. Malondialdehyde (MDA) levels in pmol/mg in the placental tissues of pregnant women with healthy control (HC) pregnant women and late-onset preeclampsia (LO-PE).
Antioxidants 13 00591 g008
Table 1. Clinical characteristics of the participants included in the study. p-values of 0.05 (*) and 0.001 (***).
Table 1. Clinical characteristics of the participants included in the study. p-values of 0.05 (*) and 0.001 (***).
HC (n = 43)LO-PE (n = 68)p-Value
Maternal age (years) Mean ± SD31.35 ± 5.1229.02 ± 4.82p = 0.0154
(*)
Nulliparity
(%) Total number
14 (32.56)53 (77.94)p < 0.0001
(***)
Gestation time (weeks)39.07 ± 1.4938.63 ± 1.43NS
Cesarean
(%) Total number
8 (18.60)15 (22.06)NS, p = 0.27
Placental weight (g)500.98 ± 65.33370.25 ± 61.65p < 0.0001
(***)
Table 2. Primers selected for each gene.
Table 2. Primers selected for each gene.
GeneSequence Fwd (5′ → 3′)Sequence Rev (5′ → 3′)Temp
NOX-1GTTTTACCGCTCCCAGCAGAAGGATGCCATTCCAGGAGAGAG55 °C
NOX-2TCCGCATCGTTGGGGACTGGACCAAAGGGCCCATCAACCGCT60 °C
GPX4ATTGGTCGGCTGGACGAGCCGAACTGGTTACACGGGAA59 °C
TFRCGAACTACACCGACCCTCGTGGTGCTGTCCAGTTTCTCCGA60 °C
ACSL-4GCTGGGACAGTTACTGAAGGTAGAGATACATACTCTCCTGCTTGT58 °C
ALOX-5TGGCGCGGTGGATTCATACAGGGGTCTGTTTTGTTGGCA60 °C
Table 3. Antibodies employed in our study and their corresponding dilutions. This table is adapted from the manuscript [37].
Table 3. Antibodies employed in our study and their corresponding dilutions. This table is adapted from the manuscript [37].
AntigenSpeciesDilutionProviderProtocol Specifications
NOX-1Rabbit polyclonal1:250Abcam (ab78016)10 mM sodium citrate pH = 6 before incubation with blocking solution
NOX-2Goat polyclonal1:500Abcam (ab111175)0.1% Triton X-100 in PBS, 10 min, before incubation with blocking solution
GPX4 Rabbit monoclonal1:100Abcam (ab125066)10 mM sodium citrate pH = 6, before incubation with blocking solution
TFRCRabbit monoclonal1:500Abcam (ab185550)EDTA pH = 9, before incubation with blocking solution
ACSL-4Rabbit monoclonal1:100Abcam (ab155282)100% Triton, 0.1% in PBS for 10 min, before incubation with blocking solution
ALOX-5Rabbit monoclonal1:250Abcam (ab169755)100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ortega, M.A.; Garcia-Puente, L.M.; Fraile-Martinez, O.; Pekarek, T.; García-Montero, C.; Bujan, J.; Pekarek, L.; Barrena-Blázquez, S.; Gragera, R.; Rodríguez-Rojo, I.C.; et al. Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants 2024, 13, 591. https://doi.org/10.3390/antiox13050591

AMA Style

Ortega MA, Garcia-Puente LM, Fraile-Martinez O, Pekarek T, García-Montero C, Bujan J, Pekarek L, Barrena-Blázquez S, Gragera R, Rodríguez-Rojo IC, et al. Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants. 2024; 13(5):591. https://doi.org/10.3390/antiox13050591

Chicago/Turabian Style

Ortega, Miguel A., Luis M. Garcia-Puente, Oscar Fraile-Martinez, Tatiana Pekarek, Cielo García-Montero, Julia Bujan, Leonel Pekarek, Silvestra Barrena-Blázquez, Raquel Gragera, Inmaculada C. Rodríguez-Rojo, and et al. 2024. "Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia" Antioxidants 13, no. 5: 591. https://doi.org/10.3390/antiox13050591

APA Style

Ortega, M. A., Garcia-Puente, L. M., Fraile-Martinez, O., Pekarek, T., García-Montero, C., Bujan, J., Pekarek, L., Barrena-Blázquez, S., Gragera, R., Rodríguez-Rojo, I. C., Rodríguez-Benitez, P., López-González, L., Díaz-Pedrero, R., Álvarez-Mon, M., García-Honduvilla, N., De León-Luis, J. A., Bravo, C., & Saez, M. A. (2024). Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants, 13(5), 591. https://doi.org/10.3390/antiox13050591

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop