Dysfunction of the Brown Adipose Organ in HFD-Obese Rats and Effect of Tart Cherry Supplementation
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Blood Sampling and Analysis
2.3. Total Phenolic Compound and Anthocyanin Determinations
2.4. Morphological Aspects
2.5. Immunohistochemistry
2.6. Western Blot
2.7. Gene Expression Analysis
2.8. Data Analysis
3. Results
3.1. Interscapular Brown Adipose Organ Weight
3.2. Microscopical Analyses of iBAT Morphology
3.3. Metabolic Assessment of the Whitening Process
3.4. Genetic Analysis of Metabolic Pathways
3.5. Metabolic Stress: Oxidative Stress, Endoplasmatic Reticulum Stress, and Apoptosis
3.6. Inflammation in iBAT
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rosen, E.D.; Spiegelman, B.M. What we talk about when we talk about fat. Cell 2014, 156, 20–44. [Google Scholar] [CrossRef]
- Formiguera, X.; Cantón, A. Obesity: Epidemiology and clinical aspects. Best. Pract. Res. Clin. Gastroenterol. 2004, 18, 1125–1146. [Google Scholar] [CrossRef] [PubMed]
- Cohen, P.; Spiegelman, B.M. Brown and Beige Fat: Molecular Parts of a Thermogenic Machine. Diabetes 2015, 64, 2346–2351. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Xu, Z.; Wang, L.; Ling, D.; Nong, Q.; Xie, J.; Zhu, X.; Shan, T. Cold Exposure Induces Depot-Specific Alterations in Fatty Acid Composition and Transcriptional Profile in Adipose Tissues of Pigs. Front. Endocrinol. Lausanne 2022, 13, 827523. [Google Scholar] [CrossRef]
- Choe, S.S.; Huh, J.Y.; Hwang, I.J.; Kim, J.I.; Kim, J.B. Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Front. Endocrinol. Lausanne 2016, 7, 30. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Boström, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef]
- Okamatsu-Ogura, Y.; Fukano, K.; Tsubota, A.; Uozumi, A.; Terao, A.; Kimura, K.; Saito, M. Thermogenic ability of uncoupling protein 1 in beige adipocytes in mice. PLoS ONE 2013, 8, e84229. [Google Scholar] [CrossRef]
- Villarroya, J.; Cereijo, R.; Villarroya, F. An endocrine role for brown adipose tissue? Am. J. Physiol. Endocrinol. Metab. 2013, 305, E567–E572. [Google Scholar] [CrossRef]
- Cinti, S.; Frederich, R.C.; Zingaretti, M.C.; De Matteis, R.; Flier, J.S.; Lowell, B.B. Immunohistochemical localization of leptin and uncoupling protein in white and brown adipose tissue. Endocrinology 1997, 138, 797–804. [Google Scholar] [CrossRef]
- Moinat, M.; Deng, C.; Muzzin, P.; Assimacopoulos-Jeannet, F.; Seydoux, J.; Dulloo, A.G.; Giacobino, J.P. Modulation of obese gene expression in rat brown and white adipose tissues. FEBS Lett. 1995, 373, 131–134. [Google Scholar] [CrossRef]
- Hosogai, N.; Fukuhara, A.; Oshima, K.; Miyata, Y.; Tanaka, S.; Segawa, K.; Furukawa, S.; Tochino, Y.; Komuro, R.; Matsuda, M.; et al. Adipose tissue hypoxia in obesity and its impact on adipocytokine dysregulation. Diabetes 2007, 56, 901–911. [Google Scholar] [CrossRef] [PubMed]
- Kawasaki, N.; Asada, R.; Saito, A.; Kanemoto, S.; Imaizumi, K. Obesity-induced endoplasmic reticulum stress causes chronic inflammation in adipose tissue. Sci. Rep. 2012, 2, 799. [Google Scholar] [CrossRef]
- Tilg, H.; Moschen, A.R. Inflammatory mechanisms in the regulation of insulin resistance. Mol. Med. 2008, 14, 222–231. [Google Scholar] [CrossRef] [PubMed]
- Kotzbeck, P.; Giordano, A.; Mondini, E.; Murano, I.; Severi, I.; Venema, W.; Cecchini, M.P.; Kershaw, E.E.; Barbatelli, G.; Haemmerle, G.; et al. Brown adipose tissue whitening leads to brown adipocyte death and adipose tissue inflammation. J. Lipid Res. 2018, 59, 784–794. [Google Scholar] [CrossRef] [PubMed]
- Long, E.K.; Olson, D.M.; Bernlohr, D.A. High-fat diet induces changes in adipose tissue trans-4-oxo-2-nonenal and trans-4-hydroxy-2-nonenal levels in a depot-specific manner. Free Radic. Biol. Med. 2013, 63, 390–398. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.; Tomassoni, D.; Traini, E.; Martinelli, I.; Micioni Di Bonaventura, M.V.; Cifani, C.; Amenta, F.; Tayebati, S.K. Natural Antioxidant Application on Fat Accumulation: Preclinical Evidence. Antioxidants 2021, 10, 858. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.K.; Lee, B.; Kim, C.Y. Natural Extracts That Stimulate Adipocyte Browning and Their Underlying Mechanisms. Antioxidants 2021, 10, 308. [Google Scholar] [CrossRef]
- Rao, A.V.; Snyder, D.M. Raspberries and human health: A review. J. Agric. Food Chem. 2010, 58, 3871–3883. [Google Scholar] [CrossRef]
- Jeong, M.Y.; Kim, H.L.; Park, J.; Jung, Y.; Youn, D.H.; Lee, J.H.; Jin, J.S.; So, H.S.; Park, R.; Kim, S.H.; et al. Rubi Fructus (Rubus coreanus) activates the expression of thermogenic genes in vivo and in vitro. Int. J. Obes. 2015, 39, 456–464. [Google Scholar] [CrossRef]
- Martinelli, I.; Micioni Di Bonaventura, M.V.; Moruzzi, M.; Amantini, C.; Maggi, F.; Gabrielli, M.G.; Fruganti, A.; Marchegiani, A.; Dini, F.; Marini, C.; et al. Effects of Prunus cerasus L. Seeds and Juice on Liver Steatosis in an Animal Model of Diet-Induced Obesity. Nutrients 2020, 12, 1308. [Google Scholar] [CrossRef]
- Martinelli, I.; Tomassoni, D.; Bellitto, V.; Roy, P.; Micioni Di Bonaventura, M.V.; Amenta, F.; Amantini, C.; Cifani, C.; Tayebati, S.K. Anti-Inflammatory and Antioxidant Properties of Tart Cherry Consumption in the Heart of Obese Rats. Biology 2022, 11, 646. [Google Scholar] [CrossRef]
- Micioni Di Bonaventura, M.V.; Martinelli, I.; Moruzzi, M.; Micioni Di Bonaventura, E.; Giusepponi, M.E.; Polidori, C.; Lupidi, G.; Tayebati, S.K.; Amenta, F.; Cifani, C.; et al. Brain alterations in high fat diet induced obesity: Effects of tart cherry seeds and juice. Nutrients 2020, 12, 623. [Google Scholar] [CrossRef]
- Cocci, P.; Moruzzi, M.; Martinelli, I.; Maggi, F.; Micioni Di Bonaventura, M.V.; Cifani, C.; Mosconi, G.; Tayebati, S.K.; Damiano, S.; Lupidi, G.; et al. Tart cherry (Prunus cerasus L.) dietary supplement modulates visceral adipose tissue CB1 mRNA levels along with other adipogenesis-related genes in rat models of diet-induced obesity. Eur. J. Nutr. 2021, 60, 2695–2707. [Google Scholar] [CrossRef]
- Moruzzi, M.; Klöting, N.; Blüher, M.; Martinelli, I.; Tayebati, S.K.; Gabrielli, M.G.; Roy, P.; Micioni Di Bonaventura, M.V.; Cifani, C.; Lupidi, G.; et al. Tart Cherry Juice and Seeds Affect Pro-Inflammatory Markers in Visceral Adipose Tissue of High-Fat Diet Obese Rats. Molecules 2021, 26, 1403. [Google Scholar] [CrossRef]
- Prior, R.L.; Wu, X.; Schaich, K. Standardized methods for the determination of antioxidant capacity and phenolics in foods and dietary supplements. J. Agric. Food Chem. 2005, 53, 4290–4302. [Google Scholar] [CrossRef]
- Lee, J.; Durst, R.W.; Wrolstad, R.E. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: Collaborative study. J. AOAC Int. 2005, 88, 1269–1278. [Google Scholar] [CrossRef]
- Barbu, A.; Hedlund, G.P.; Lind, J.; Carlsson, C. Pref-1 and adipokine expression in adipose tissues of GK and Zucker rats. Mol. Cell Endocrinol. 2009, 299, 163–171. [Google Scholar] [CrossRef]
- Nøhr, M.K.; Bobba, N.; Richelsen, B.; Lund, S.; Pedersen, S.B. Inflammation Downregulates UCP1 Expression in Brown Adipocytes Potentially via SIRT1 and DBC1 Interaction. Int. J. Mol. Sci. 2017, 18, 1006. [Google Scholar] [CrossRef] [PubMed]
- Gao, Q.; Jia, Y.; Yang, G.; Zhang, X.; Boddu, P.C.; Petersen, B.; Narsingam, S.; Zhu, Y.J.; Thimmapaya, B.; Kanwar, Y.S.; et al. PPARα-Deficient ob/ob Obese Mice Become More Obese and Manifest Severe Hepatic Steatosis Due to Decreased Fatty Acid Oxidation. Am. J. Pathol. 2015, 185, 1396–1408. [Google Scholar] [CrossRef] [PubMed]
- Padilla, J.; Jenkins, N.T.; Vieira-Potter, V.J.; Laughlin, M.H. Divergent phenotype of rat thoracic and abdominal perivascular adipose tissues. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 304, R543–R552. [Google Scholar] [CrossRef] [PubMed]
- Ziqubu, K.; Dludla, P.V.; Mthembu, S.X.H.; Nkambule, B.B.; Mabhida, S.E.; Jack, B.U.; Nyambuya, T.M.; Mazibuko-Mbeje, S.E. An insight into brown/beige adipose tissue whitening, a metabolic complication of obesity with the multifactorial origin. Front. Endocrinol. Lausanne 2023, 14, 1114767. [Google Scholar] [CrossRef]
- Sano, R.; Reed, J.C. ER stress-induced cell death mechanisms. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2013, 1833, 3460–3470. [Google Scholar] [CrossRef]
- Song, A.; Dai, W.; Jang, M.J.; Medrano, L.; Li, Z.; Zhao, H.; Shao, M.; Tan, J.; Li, A.; Ning, T.; et al. Low- and high-thermogenic brown adipocyte subpopulations coexist in murine adipose tissue. J. Clin. Investig. 2020, 130, 247–257. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Li, X.; Fang, H.; Guo, F.; Li, F.; Chen, A.; Huang, S. Flavonoids as inducers of white adipose tissue browning and thermogenesis: Signalling pathways and molecular triggers. Nutr. Metab. 2019, 16, 47. [Google Scholar] [CrossRef] [PubMed]
- Manríquez-Núñez, J.; Ramos-Gómez, M. Bioactive Compounds and Adipocyte Browning Phenomenon. Curr. Issues Mol. Biol. 2022, 44, 3039–3052. [Google Scholar] [CrossRef] [PubMed]
- Frühbeck, G.; Méndez-Giménez, L.; Becerril, S.; Ramírez, B.; Hernández-Pardos, A.W.; Cienfuegos, J.A.; Valentí, V.; Moncada, R.; Catalán, V.; Gómez-Ambrosi, J.; et al. Increased Aquaporin-7 Expression Is Associated with Changes in Rat Brown Adipose Tissue Whitening in Obesity: Impact of Cold Exposure and Bariatric Surgery. Int. J. Mol. Sci. 2023, 24, 3412. [Google Scholar] [CrossRef] [PubMed]
- Fernández, M.R.; Vilca, C.C.; Batista, L.O.; Figueiredo, L.S.; Ribeiro, R.A.; do Carmo, M.D.G.T.; Albuquerque, K.T. Fasting and refeeding cycles alter subcutaneous white depot growth dynamics and the morphology of brown adipose tissue in female rats. Br. J. Nutr. 2021, 126, 460–469. [Google Scholar] [CrossRef] [PubMed]
- Maric, I.; Krieger, J.P.; van der Velden, P.; Börchers, S.; Asker, M.; Vujicic, M.; Asterholm, I.W.; Skibicka, K.P. Sex and Species Differences in the Development of Diet-Induced Obesity and Metabolic Disturbances in Rodents. Front. Nutr. 2022, 9, 828522. [Google Scholar] [CrossRef] [PubMed]
- Schaab, M.; Kratzsch, J. The soluble leptin receptor. Best Pract. Res. Clin. Endocrinol. Metab. 2015, 29, 661–670. [Google Scholar] [CrossRef] [PubMed]
- Lyu, X.; Yan, K.; Wang, X.; Xu, H.; Guo, X.; Zhu, H.; Pan, H.; Wang, L.; Yang, H.; Gong, F. A novel anti-obesity mechanism for liraglutide by improving adipose tissue leptin resistance in high-fat diet-fed obese mice. Endocr. J. 2022, 69, 1233–1244. [Google Scholar] [CrossRef]
- Gaidhu, M.P.; Anthony, N.M.; Patel, P.; Hawke, T.J.; Ceddia, R.B. Dysregulation of lipolysis and lipid metabolism in visceral and subcutaneous adipocytes by high-fat diet: Role of ATGL, HSL, and AMPK. Am. J. Physiol. Cell Physiol. 2010, 298, C961–C971. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.J.; Jung, J.Y.; Kim, H.W.; Park, T. Anti-obesity effects of Juniperus chinensis extract are associated with increased AMP-activated protein kinase expression and phosphorylation in the visceral adipose tissue of rats. Biol. Pharm. Bull. 2008, 31, 1415–1421. [Google Scholar] [CrossRef] [PubMed]
- Bonnard, C.; Durand, A.; Vidal, H.; Rieusset, J. Changes in adiponectin, its receptors and AMPK activity in tissues of diet-induced diabetic mice. Diabetes Metab. 2008, 34, 52–61. [Google Scholar] [CrossRef] [PubMed]
- Sutherland, L.N.; Capozzi, L.C.; Turchinsky, N.J.; Bell, R.C.; Wright, D.C. Time course of high-fat diet-induced reductions in adipose tissue mitochondrial proteins: Potential mechanisms and the relationship to glucose intolerance. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E1076–E1083. [Google Scholar] [CrossRef] [PubMed]
- Kraegen, E.W.; Saha, A.K.; Preston, E.; Wilks, D.; Hoy, A.J.; Cooney, G.J.; Ruderman, N.B. Increased malonyl-CoA and diacylglycerol content and reduced AMPK activity accompany insulin resistance induced by glucose infusion in muscle and liver of rats. Am. J. Physiol. Endocrinol. Metab. 2006, 290, E471–E479. [Google Scholar] [CrossRef] [PubMed]
- Lindholm, C.R.; Ertel, R.L.; Bauwens, J.D.; Schmuck, E.G.; Mulligan, J.D.; Saupe, K.W. A high-fat diet decreases AMPK activity in multiple tissues in the absence of hyperglycemia or systemic inflammation in rats. Physiol. Biochem. 2013, 69, 165–175. [Google Scholar] [CrossRef]
- Saha, A.K.; Xu, X.J.; Lawson, E.; Deoliveira, R.; Brandon, A.E.; Kraegen, E.W.; Ruderman, N.B. Downregulation of AMPK accompanies leucine- and glucose-induced increases in protein synthesis and insulin resistance in rat skeletal muscle. Diabetes 2010, 59, 2426–2434. [Google Scholar] [CrossRef]
- Finucane, O.M.; Lyons, C.L.; Murphy, A.M.; Reynolds, C.M.; Klinger, R.; Healy, N.P.; Cooke, A.A.; Coll, R.C.; McAllan, L.; Nilaweera, K.N.; et al. Monounsaturated fatty acid-enriched high-fat diets impede adipose NLRP3 inflammasome-mediated IL-1β secretion and insulin resistance despite obesity. Diabetes 2015, 64, 2116–2128. [Google Scholar] [CrossRef]
- Kim, Y.; Park, Y. Conjugated linoleic acid (CLA) stimulates mitochondrial biogenesis signaling by the upregulation of PPARγ coactivator 1α (PGC-1α) in C2C12 cells. Lipids 2015, 50, 329–338. [Google Scholar] [CrossRef]
- Akdad, M.; Ameziane, R.; Khallouki, F.; Bakri, Y.; Eddouks, M. Antidiabetic Phytocompounds Acting as Glucose Transport Stimulators. Endocr. Metab. Immune Disord. Drug Targets. 2023, 23, 147–168. [Google Scholar] [CrossRef]
- Zhao, L.; Zou, T.; Gomez, N.A.; Wang, B.; Zhu, M.J.; Du, M. Raspberry alleviates obesity-induced inflammation and insulin resistance in skeletal muscle through activation of AMP-activated protein kinase (AMPK) α1. Nutr. Diabetes 2018, 8, 39. [Google Scholar] [CrossRef]
- Caputo, T.; Tran, V.D.T.; Bararpour, N.; Winkler, C.; Aguileta, G.; Trang, K.B.; Giordano Attianese, G.M.P.; Wilson, A.; Thomas, A.; Pagni, M.; et al. Anti-adipogenic signals at the onset of obesity-related inflammation in white adipose tissue. Cell Mol. Life Sci. 2021, 78, 227–247. [Google Scholar] [CrossRef]
- Fromme, T.; Klingenspor, M. Uncoupling protein 1 expression and high-fat diets. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R1–R8. [Google Scholar] [CrossRef]
- Brauer, M.J.; Huttenhower, C.; Airoldi, E.M.; Rosenstein, R.; Matese, J.C.; Gresham, D.; Boer, V.M.; Troyanskaya, O.G.; Botstein, D. Coordination of growth rate, cell cycle, stress response, and metabolic activity in yeast. Mol. Biol. Cell. 2008, 19, 352–367. [Google Scholar] [CrossRef]
- Lee, M.V.; Topper, S.E.; Hubler, S.L.; Hose, J.; Wenger, C.D.; Coon, J.J.; Gasch, A.P. A dynamic model of proteome changes reveals new roles for transcript alteration in yeast. Mol. Syst. Biol. 2011, 7, 514. [Google Scholar] [CrossRef]
- Marguerat, S.; Schmidt, A.; Codlin, S.; Chen, W.; Aebersold, R.; Bähler, J. Quantitative analysis of fission yeast transcriptomes and proteomes in proliferating and quiescent cells. Cell 2012, 51, 671–683. [Google Scholar] [CrossRef]
- Dephoure, N.; Hwang, S.; O’Sullivan, C.; Dodgson, S.E.; Gygi, S.P.; Amon, A.; Torres, E.M. Quantitative proteomic analysis reveals posttranslational responses to aneuploidy in yeast. eLife 2014, 3, e03023. [Google Scholar] [CrossRef] [PubMed]
- Stingele, S.; Stoehr, G.; Peplowska, K.; Cox, J.; Mann, M.; Storchova, Z. Global analysis of genome, transcriptome and proteome reveals the response to aneuploidy in human cells. Mol. Syst. Biol. 2012, 8, 608. [Google Scholar] [CrossRef]
- Barrios, V.; Frago, L.M.; Canelles, S.; Guerra-Cantera, S.; Arilla-Ferreiro, E.; Chowen, J.A.; Argente, J. Leptin Modulates the Response of Brown Adipose Tissue to Negative Energy Balance: Implication of the GH/IGF-I Axis. Int. J. Mol. Sci. 2021, 22, 2827. [Google Scholar] [CrossRef] [PubMed]
- Maffei, M.; Fei, H.; Lee, G.H.; Dani, C.; Leroy, P.; Zhang, Y.; Proenca, R.; Negrel, R.; Ailhaud, G.; Friedman, J.M. Increased expression in adipocytes of ob RNA in mice with lesions of the hypothalamus and with mutations at the db locus. Proc. Natl. Acad. Sci. USA 1995, 92, 6957–6960. [Google Scholar] [CrossRef] [PubMed]
- Frederich, R.C.; Löllmann, B.; Hamann, A.; Napolitano-Rosen, A.; Kahn, B.B.; Lowell, B.B.; Flier, J.S. Expression of ob mRNA and its encoded protein in rodents. Impact of nutrition and obesity. J. Clin. Investig. 1995, 96, 1658–1663. [Google Scholar] [CrossRef] [PubMed]
- Machado, S.A.; Pasquarelli-do-Nascimento, G.; da Silva, D.S.; Farias, G.R.; de Oliveira Santos, I.; Baptista, L.B.; Magalhães, K.G. Browning of the white adipose tissue regulation: New insights into nutritional and metabolic relevance in health and diseases. Nutr. Metab. 2022, 19, 61. [Google Scholar] [CrossRef] [PubMed]
- Cinti, S. Adipose Organ Development and Remodeling. Compr. Physiol. 2018, 8, 1357–1431. [Google Scholar] [CrossRef] [PubMed]
- Wojdyło, A.; Nowicka, P.; Laskowski, P.; Oszmiański, J. Evaluation of sour cherry (Prunus cerasus L.) fruits for their polyphenol content, antioxidant properties, and nutritional components. J. Agric. Food Chem. 2014, 62, 12332–12345. [Google Scholar] [CrossRef] [PubMed]
- Rangel-Azevedo, C.; Santana-Oliveira, D.A.; Miranda, C.S.; Martins, F.F.; Mandarim-de-Lacerda, C.A.; Souza-Mello, V. Progressive brown adipocyte dysfunction: Whitening and impaired nonshivering thermogenesis as long-term obesity complications. J. Nutr. Biochem. 2022, 105, 109002. [Google Scholar] [CrossRef]
- Villarroya, F.; Cereijo, R.; Gavaldà-Navarro, A.; Villarroya, J.; Giralt, M. Inflammation of brown/beige adipose tissues in obesity and metabolic disease. J. Intern. Med. 2018, 284, 492–504. [Google Scholar] [CrossRef]
- Gavaldà-Navarro, A.; Villarroya, J.; Cereijo, R.; Giralt, M.; Villarroya, F. The endocrine role of brown adipose tissue: An update on actors and actions. Rev. Endocr. Metab. Disord. 2022, 23, 31–41. [Google Scholar] [CrossRef]
- Harlan, L.; Mena, L.T.; Ramalingam, L.; Jayarathne, S.; Shen, C.L.; Moustaid-Moussa, N. Mechanisms Mediating Anti-Inflammatory Effects of Delta-Tocotrienol and Tart Cherry Anthocyanins in 3T3-L1 Adipocytes. Nutrients 2020, 12, 3356. [Google Scholar] [CrossRef]
- Ngamsamer, C.; Sirivarasai, J.; Sutjarit, N. The Benefits of Anthocyanins against Obesity-Induced Inflammation. Biomolecules 2022, 12, 852. [Google Scholar] [CrossRef] [PubMed]
- Seymour, E.M.; Lewis, S.K.; Urcuyo-Llanes, D.E.; Tanone, I.I.; Kirakosyan, A.; Kaufman, P.B.; Bolling, S.F. Regular tart cherry intake alters abdominal adiposity, adipose gene transcription, and inflammation in obesity-prone rats fed a high fat diet. J. Med. Food. 2009, 10, 935–942. [Google Scholar] [CrossRef] [PubMed]
- Lila, M.A.; Raskin, I. Health-related interactions of phytochemicals. J. Food Sci. 2005, 70, R20–R27. [Google Scholar] [CrossRef]
- Kyrakosyan, A.; Seymour, E.M.; Llanes, D.E.U.; Kaufman, P.B.; Bolling, S.F. Chemical profile and antioxidant capacities of tart cherry products. Food Chem. 2009, 115, 20–25. [Google Scholar] [CrossRef]
- Yilmaz, F.M.; Gorguc, A.; Karaaslan, M.; Vardin, H.; Ersus, B.S.; Uygun, O.; Bircan, C. Sour cherry by-products: Compositions, functional properties, and recovery potentials—A review. Crit. Rev. Food Sci. Nutr. 2019, 59, 3549–3563. [Google Scholar] [CrossRef] [PubMed]
- You, Y.; Yuan, X.; Liu, X.; Liang, C.; Meng, M.; Huang, Y.; Han, X.; Guo, J.; Guo, Y.; Ren, C.; et al. Cyanidin-3-glucoside increases whole body energy metabolism by upregulating brown adipose tissue mitochondrial function. Mol. Nutr. Food Res. 2017, 61, 10. [Google Scholar] [CrossRef]
- Liu, J.; Wang, Y.; Lin, L. Small molecules for fat combustion: Targeting obesity. Acta Pharm. Sin. B 2019, 9, 220–236. [Google Scholar] [CrossRef] [PubMed]
- Shen, W.; Baldwin, J.; Collins, B.; Hixson, L.; Lee, K.-T.; Herberg, T.; Starnes, J.; Cooney, P.; Chuang, C.-C.; Hopkins, R.; et al. Low level of trans-10, cis-12 conjugated linoleic acid decreases adiposity and increases browning independent of inflammatory signaling in overweight Sv129 mice. J. Nutr. Biochem. 2015, 26, 616–625. [Google Scholar] [CrossRef]






| Gene | Primer Sequences | References | Accession Number |
|---|---|---|---|
| Adiponectin | GAGAAGGGAGACGCAGGTGT GCTGAATGCTGAGTGATACATGTAAG | [27] | XM_039087986 |
| Leptin | GACATTTCACACAGGCAGTCG GCAAGCTGGTGAGGATCTGT | [27] | XM_032905243 |
| UCP-1 | GCCATCTGCATGGGATCAAACC TCGTCCCTTTCCAAAGTGTTGAC | [28] | NM_009463 |
| PGC-1α | CTCCATGCCTGACGGCACCC GCAGGGACGTCTTTGTGGCT | [29] | XM_032916065 |
| PRDM16 | CACGGTGAAGCCATTCATATGCG AGGTTGGAGAACTGCGTGTAGG | [28] | XM_006539171 |
| 18s rRNA | GCCGCTAGAGGTGAAATTCTTG CATTCTTGGCAAATGCTTTCG | [30] | NR_046237 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bellitto, V.; Gabrielli, M.G.; Martinelli, I.; Roy, P.; Nittari, G.; Cocci, P.; Palermo, F.A.; Amenta, F.; Micioni Di Bonaventura, M.V.; Cifani, C.; et al. Dysfunction of the Brown Adipose Organ in HFD-Obese Rats and Effect of Tart Cherry Supplementation. Antioxidants 2024, 13, 388. https://doi.org/10.3390/antiox13040388
Bellitto V, Gabrielli MG, Martinelli I, Roy P, Nittari G, Cocci P, Palermo FA, Amenta F, Micioni Di Bonaventura MV, Cifani C, et al. Dysfunction of the Brown Adipose Organ in HFD-Obese Rats and Effect of Tart Cherry Supplementation. Antioxidants. 2024; 13(4):388. https://doi.org/10.3390/antiox13040388
Chicago/Turabian StyleBellitto, Vincenzo, Maria Gabriella Gabrielli, Ilenia Martinelli, Proshanta Roy, Giulio Nittari, Paolo Cocci, Francesco Alessandro Palermo, Francesco Amenta, Maria Vittoria Micioni Di Bonaventura, Carlo Cifani, and et al. 2024. "Dysfunction of the Brown Adipose Organ in HFD-Obese Rats and Effect of Tart Cherry Supplementation" Antioxidants 13, no. 4: 388. https://doi.org/10.3390/antiox13040388
APA StyleBellitto, V., Gabrielli, M. G., Martinelli, I., Roy, P., Nittari, G., Cocci, P., Palermo, F. A., Amenta, F., Micioni Di Bonaventura, M. V., Cifani, C., Tomassoni, D., & Tayebati, S. K. (2024). Dysfunction of the Brown Adipose Organ in HFD-Obese Rats and Effect of Tart Cherry Supplementation. Antioxidants, 13(4), 388. https://doi.org/10.3390/antiox13040388

