NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. MMP-10 and NOX5 Specific Silencing
2.3. NOX5 Acute Overexpression Model
2.4. NOX5 Chronic Overexpression Model
2.5. Cell Culture Reagents
2.6. Wound Healing Assay
2.7. RNA Isolation, Reverse-Transcription and qPCR
2.8. gDNA Extraction and Cell Line Genotyping
2.9. Protein Extraction and Immunodetection
2.10. Extracellular MMP-10 Detection by ELISA
2.11. MMP-10 Promoter Activity Assays
2.12. ROS Production
2.13. Real-Time Proliferation Measurement
2.14. In Vivo Studies
2.15. Statistical Analysis
3. Results
3.1. NOX5 Enhances MMP-10 Production and Cell Migration in Human Endothelial Cells
3.2. MMP-10 Is Involved in Cell Migration in Human Endothelial Cells
3.3. NOX5 Chronic Overexpression Enhances MMP-10 Production and the Associated Cell Migration in Human Endothelial Cells
3.4. Ang II Stimulation of NOX5-Overexpressing Human Endothelial Cells Enhances MMP-10 Production and Cell Migration
3.5. ERK, p38, and JNK Are Involved in the Ang II/NOX5/MMP-10/Cell Migration Pathway
3.6. NOX5 Enhances MMP-10 Promoter Activity via JNK and AP-1
3.7. Endothelial NOX5 Expression Leads to Cardiac MMP-10 Upregulation at Protein Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sorescu, D.; Weiss, D.; Lassègue, B.; Clempus, R.E.; Szöcs, K.; Sorescu, G.P.; Valppu, L.; Quinn, M.T.; Lambeth, J.D.; Vega, J.D.; et al. Superoxide production and expression of nox family proteins in human atherosclerosis. Circulation 2002, 105, 1429–1435. [Google Scholar] [CrossRef] [PubMed]
- Azumi, H.; Inoue, N.; Takeshita, S.; Rikitake, Y.; Kawashima, S.; Hayashi, Y.; Itoh, H.; Yokoyama, M. Expression of NADH/NADPH oxidase p22phox in human coronary arteries. Circulation 1999, 100, 1494–1498. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, M.; López-Oliva, M.E.; Rodríguez, C.; Martínez, M.P.; Saénz-Medina, J.; Sánchez, A.; Climent, B.; Benedito, S.; García-Sacristán, A.; Rivera, L.; et al. Differential contribution of Nox1, Nox2 and Nox4 to kidney vascular oxidative stress and endothelial dysfunction in obesity. Redox Biol. 2020, 28, 101330. [Google Scholar] [CrossRef] [PubMed]
- Youn, J.Y.; Gao, L.; Cai, H. The p47phox- and NADPH oxidase organiser 1 (NOXO1)-dependent activation of NADPH oxidase 1 (NOX1) mediates endothelial nitric oxide synthase (eNOS) uncoupling and endothelial dysfunction in a streptozotocin-induced murine model of diabetes. Diabetologia 2012, 55, 2069–2079. [Google Scholar] [CrossRef] [PubMed]
- Youn, J.Y.; Zhou, J.; Cai, H. Bone morphogenic protein 4 mediates NOX1-dependent eNOS uncoupling, endothelial dysfunction and COX2 induction in type 2 diabetes mellitus. Mol. Endocrinol. 2015, 29, 1123–1133. [Google Scholar] [CrossRef] [PubMed]
- Douglas, G.; Bendall, J.K.; Crabtree, M.J.; Tatham, A.L.; Carter, E.E.; Hale, A.B.; Channon, K.M. Endothelial-specific Nox2 overexpression increases vascular superoxide and macrophage recruitment in ApoE−/− mice. Cardiovasc. Res. 2012, 94, 20–29. [Google Scholar] [CrossRef]
- Hu, X.F.; Xiang, G.; Wang, T.J.; Ma, Y.B.; Zhang, Y.; Yan, Y.B.; Zhao, X.; Wu, Z.X.; Feng, Y.F.; Lei, W. Impairment of type H vessels by NOX2-mediated endothelial oxidative stress: Critical mechanisms and therapeutic targets for bone fragility in streptozotocin-induced type 1 diabetic mice. Theranostics 2021, 11, 3796–3812. [Google Scholar] [CrossRef]
- Birk, M.; Baumm, E.; Zadeh, J.K.; Manicam, C.; Pfeiffer, N.; Patzak, A.; Helmstädter, J.; Steven, S.; Kuntic, M.; Daiber, A.; et al. Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2. Antioxidants 2021, 10, 1238. [Google Scholar] [CrossRef]
- Gray, S.P.; Di Marco, E.; Kennedy, K.; Chew, P.; Okabe, J.; El-Osta, A.; Calkin, A.C.; Biessen, E.A.L.; Touyz, R.M.; Cooper, M.E.; et al. Reactive Oxygen Species Can Provide Atheroprotection via NOX4-Dependent Inhibition of Inflammation and Vascular Remodeling. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 295–307. [Google Scholar] [CrossRef]
- Yuan, S.; Hahn, S.A.; Miller, M.P.; Sanker, S.; Calderon, M.J.; Sullivan, M.; Dosunmu-Ogunbi, A.M.; Fazzari, M.; Li, Y.; Reynolds, M.; et al. Cooperation between CYB5R3 and NOX4 via coenzyme Q mitigates endothelial inflammation. Redox Biol. 2021, 47, 102166. [Google Scholar] [CrossRef]
- Escudero, P.; Martinez de Marañón, A.; Collado, A.; Gonzalez-Navarro, H.; Hermenegildo, C.; Peiró, C.; Piqueras, L.; Sanz, M.J. Combined sub-optimal doses of rosuvastatin and bexarotene impair angiotensin II-induced arterial mononuclear cell adhesion through inhibition of Nox5 signaling pathways and increased RXR/PPARα and RXR/PPARγ interactions. Antioxid. Redox Signal. 2015, 22, 901–920. [Google Scholar] [CrossRef] [PubMed]
- Vlad, M.L.; Manea, S.A.; Lazar, A.G.; Raicu, M.; Muresian, H.; Simionescu, M.; Manea, A. Histone Acetyltransferase-Dependent Pathways Mediate Upregulation of NADPH Oxidase 5 in Human Macrophages under Inflammatory Conditions: A Potential Mechanism of Reactive Oxygen Species Overproduction in Atherosclerosis. Oxidative Med. Cell. Longev. 2019, 2019, 3201062. [Google Scholar] [CrossRef] [PubMed]
- Guzik, T.J.; Chen, W.; Gongora, M.C.; Guzik, B.; Lob, H.E.; Mangalat, D.; Hoch, N.; Dikalov, S.; Rudzinski, P.; Kapelak, B.; et al. Calcium-dependent NOX5 nicotinamide adenine dinucleotide phosphate oxidase contributes to vascular oxidative stress in human coronary artery disease. J. Am. Coll. Cardiol. 2008, 52, 1803–1809. [Google Scholar] [CrossRef] [PubMed]
- Marqués, J.; Fernández-Irigoyen, J.; Ainzúa, E.; Martínez-Azcona, M.; Cortés, A.; Roncal, C.; Orbe, J.; Santamaría, E.; Zalba, G. NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3). Antioxidants 2022, 11, 2147. [Google Scholar] [CrossRef] [PubMed]
- Marqués, J.; Cortés, A.; Pejenaute, Á.; Ansorena, E.; Abizanda, G.; Prósper, F.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. Induction of Cyclooxygenase-2 by Overexpression of the Human NADPH Oxidase 5 (NOX5) Gene in Aortic Endothelial Cells. Cells 2020, 9, 637. [Google Scholar] [CrossRef]
- Simões, G.; Pereira, T.; Caseiro, A. Matrix metaloproteinases in vascular pathology. Microvasc. Res. 2022, 143, 104398. [Google Scholar] [CrossRef]
- Rodriguez, J.A.; Orbe, J.; Martinez de Lizarrondo, S.; Calvayrac, O.; Rodriguez, C.; Martinez-Gonzalez, J.; Paramo, J.A. Metalloproteinases and atherothrombosis: MMP-10 mediates vascular remodeling promoted by inflammatory stimuli. Front. Biosci. 2008, 13, 2916–2921. [Google Scholar] [CrossRef]
- Matilla, L.; Roncal, C.; Ibarrola, J.; Arrieta, V.; García-Peña, A.; Fernández-Celis, A.; Navarro, A.; Álvarez, V.; Gainza, A.; Orbe, J.; et al. A Role for MMP-10 (Matrix Metalloproteinase-10) in Calcific Aortic Valve Stenosis. Arterioscler. Thromb. Vasc. Biol. 2020, 40, 1370–1382. [Google Scholar] [CrossRef]
- Purroy, A.; Roncal, C.; Orbe, J.; Meilhac, O.; Belzunce, M.; Zalba, G.; Villa-Bellosta, R.; Andrés, V.; Parks, W.C.; Páramo, J.A.; et al. Matrix metalloproteinase-10 deficiency delays aterosclerosis progression and plaque calcification. Atherosclerosis 2018, 278, 124–134. [Google Scholar] [CrossRef]
- Wang, H.; Albadawi, H.; Siddiquee, Z.; Stone, J.M.; Panchenko, M.P.; Watkins, M.T.; Stone, J.R. Altered vascular activation due to deficiency of the NADPH oxidase component p22phox. Cardiovasc. Pathol. 2014, 23, 35–42. [Google Scholar] [CrossRef]
- Quesada, I.M.; Lucero, A.; Amaya, C.; Meijles, D.N.; Cifuentes, M.E.; Pagano, P.J.; Castro, C. Selective inactivation of NADPH oxidase 2 causes regression of vascularization and the size and stability of atherosclerotic plaques. Atherosclerosis 2015, 242, 469–475. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, Y.; Zhen, S. Inhibition of NADPH oxidase 5 (NOX5) suppresses high glucose-induced oxidative stress, inflammation and extracellular matrix accumulation in human glomerular mesangial cells. Med. Sci. Monit. 2020, 26, e919399. [Google Scholar] [CrossRef] [PubMed]
- Jha, J.C.; Dai, A.; Holterman, C.E.; Cooper, M.E.; Touyz, R.M.; Kennedy, C.R.; Jandeleit-Dahm, K.A.M. Endothelial or vascular smooth muscle cell-specific expression of human NOX5 exacerbates renal inflammation, fibrosis and albuminuria in the Akita mouse. Diabetologia 2019, 62, 1712–1726. [Google Scholar] [CrossRef] [PubMed]
- Jha, J.C.; Banal, C.; Okabe, J.; Gray, S.P.; Hettige, T.; Chow, B.S.M.; Thallas-Bonke, V.; De Vos, L.; Holterman, C.E.; Coughlan, M.T.; et al. NADPH Oxidase Nox5 Accelerates Renal Injury in Diabetic Nephropathy. Diabetes 2017, 66, 2691–2703. [Google Scholar] [CrossRef] [PubMed]
- Cortés, A.; Pejenaute, Á.; Marqués, J.; Izal, Í.; Cenoz, S.; Ansorena, E.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. NADPH Oxidase 5 Induces Changes in the Unfolded Protein Response in Human Aortic Endothelial Cells and in Endothelial-Specific Knock-in Mice. Antioxidants 2021, 10, 194. [Google Scholar] [CrossRef] [PubMed]
- Lan, T.H.; Huang, X.Q.; Tan, H.M. Vascular fibrosis in atherosclerosis. Cardiovasc. Pathol. 2013, 22, 401–407. [Google Scholar] [CrossRef]
- Andueza, A.; Garde, N.; García-Garzón, A.; Ansorena, E.; López-Zabalza, M.J.; Iraburu, M.J.; Zalba, G.; Martínez-Irujo, J.J. NADPH oxidase 5 promotes proliferation and fibrosis in human hepatic stellate cells. Free Radic. Biol. Med. 2018, 126, 15–26. [Google Scholar] [CrossRef]
- Orbe, J.; Rodríguez, J.A.; Calvayrac, O.; Rodríguez-Calvo, R.; Rodríguez, C.; Roncal, C.; Martínez de Lizarrondo, S.; Barrenetxe, J.; Reverter, J.C.; Martínez-González, J.; et al. Matrix metalloproteinase-10 is upregulated by thrombin in endothelial cells and increased in patients with enhanced thrombin generation. Arterioscler. Thromb. Vasc. Biol. 2009, 12, 2109–2116. [Google Scholar] [CrossRef]
- Howe, M.D.; Zhu, L.; Sansing, L.H.; Gonzales, N.R.; McCullough, L.D.; Edwards, N.J. Serum Markers of Blood-Brain Barrier Remodeling and Fibrosis as Predictors of Etiology and Clinicoradiologic Outcome in Intracerebral Hemorrhage. Front. Neurol. 2018, 9, 746. [Google Scholar] [CrossRef]
- Spychalowicz, A.; Wilk, G.; Śliwa, T.; Ludew, D.; Guzik, T.J. Novel therapeutic approaches in limiting oxidative stress and inflammation. Curr. Pharm. Biotechnol. 2012, 13, 2456–2466. [Google Scholar] [CrossRef]
- Casas, A.I.; Kleikers, P.W.; Geuss, E.; Langhauser, F.; Adler, T.; Busch, D.H.; Gailus-Durner, V.; Hrabê de Angelis, M.; Egea, J.; Lopez, M.G.; et al. Calcium-dependent blood-brain barrier breakdown by NOX5 limits postreperfusion benefit in stroke. J. Clin. Investig. 2019, 129, 1772–1778. [Google Scholar] [CrossRef] [PubMed]
- Goettsch, C.; Goettsch, W.; Muller, G.; Seebach, J.; Schnittler, H.J.; Morawietz, H. Nox4 overexpression activates reactive oxygen species and p38 MAPK in human endothelial cells. Biochem. Biophys. Res. Commun. 2009, 380, 355–360. [Google Scholar] [CrossRef] [PubMed]
- Li, W.J.; Liu, Y.; Wang, J.J.; Zhang, Y.L.; Lai, S.; Xia, Y.L.; Wang, H.X.; Li, H.H. “Angiotensin II memory” contributes to the development of hypertension and vascular injury via activation of NADPH oxidase. Life Sci. 2016, 15, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, J.; Chowdhury, A.; Chakraborti, T.; Chakraborti, S. Cross-talk between NADPH oxidase-PKCα-p(38)MAPK and NF-κB-MT1MMP in activating proMMP-2 by ET-1 in pulmonary artery smooth muscle cells. Mol. Cell. Biochem. 2016, 415, 13–28. [Google Scholar] [CrossRef] [PubMed]
- Manea, A.; Manea, S.A.; Florea, I.C.; Luca, C.M.; Raicu, M. Positive regulation of NADPH oxidase 5 by proinflammatory-related mechanisms in human aortic smooth muscle cells. Free Radic. Biol. Med. 2012, 52, 1497–1507. [Google Scholar] [CrossRef]
- Pandey, D.; Patel, A.; Patel, V.; Chen, F.; Qian, J.; Wang, Y.; Barman, S.A.; Venema, R.C.; Stepp, D.W.; Rudic, R.D.; et al. Expression and functional significance of NADPH oxidase 5 (Nox5) and its splice variants in human blood vessels. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, 1919–1928. [Google Scholar] [CrossRef]
- Gole, H.K.A.; Tharp, D.L.; Bowles, D.K. Upregulation of intermediate-conductance Ca2+-activated K+ channels (KCNN4) in porcine coronary smooth muscle requires NADPH oxidase 5 (NOX5). PLoS ONE 2014, 9, e105337. [Google Scholar] [CrossRef]
- Salazar, G. NADPH Oxidases and Mitochondria in Vascular Senescence. Int. J. Mol. Sci. 2018, 19, 1327. [Google Scholar] [CrossRef]
- Valente, A.J.; Yoshida, T.; Murthy, S.N.; Sakamuri, S.S.V.P.; Katsuyama, M.; Clark, R.A.; Delafontaine, P.; Chandrasekar, B. Angiotensin II enhances AT1-Nox1 binding and stimulates arterial smooth muscle cell migration and proliferation through AT1, Nox1, and interleukin-18. Am. J. Physiol. Heart Circ. Physiol. 2012, 303, 282–296. [Google Scholar] [CrossRef]
- Li, X.; Wang, H.F.; Li, X.X.; Xu, M. Contribution of acid sphingomyelinase to angiotensin II-induced vascular adventitial remodeling via membrane rafts/Nox2 signal pathway. Life Sci. 2019, 219, 303–310. [Google Scholar] [CrossRef]
- Moraes, J.A.; Frony, A.C.; Dias, A.M.; Renovato-Martins, M.; Rodrigues, G.; Marcinkiewicz, C.; Assreuy, J.; Barja-Fidalgo, C. Alpha1beta1 and integrin-linked kinase interact and modulate angiotensin II effects in vascular smooth muscle cells. Atherosclerosis 2015, 243, 477–485. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Xiao, L.; Que, Y.; Li, S.; Chen, L.; Hu, P.; Xiong, R.; Seta, F.; Chen, H.; Tong, X. Smooth muscle NADPH oxidase 4 promotes angiotensin II-induced aortic aneurysm and atherosclerosis by regulating osteopontin. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165912. [Google Scholar] [CrossRef]
- Harrison, C.B.; Trevelin, S.C.; Richards, D.A.; Santos, C.X.C.; Sawyer, G.; Markovinovic, A.; Zhang, X.; Zhang, M.; Brewer, A.C.; Yin, X.; et al. Fibroblast Nox2 (NADPH Oxidase-2) Regulates ANG II (Angiotensin II)-Induced Vascular Remodeling and Hypertension via Paracrine Signaling to Vascular Smooth Muscle Cells. Arterioscler. Thromb. Vasc. Biol. 2021, 41, 698–710. [Google Scholar] [CrossRef]
- Montezano, A.C.; Burger, D.; Paravicini, T.M.; Chignalia, A.Z.; Yusuf, H.; Almasri, M.; He, Y.; Callera, G.E.; He, G.; Krause, K.H.; et al. Nicotinamide adenine dinucleotide phosphate reduced oxidase 5 (Nox5) regulation by angiotensin II and endothelin-1 is mediated via calcium/calmodulin-dependent, rac-1-independent pathways in human endothelial cells. Circ. Res. 2010, 106, 1363–1373. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.J.; Zhao, C.L.; Ouyang, S.; Deng, K.Q.; Zhu, L.; Montezano, A.C.; Zhang, C.; Hu, F.; Zhu, X.Y.; Tian, S.; et al. Ca2+-Dependent NOX5 (NADPH Oxidase 5) Exaggerates Cardiac Hypertrophy Through Reactive Oxygen Species Production. Hypertension 2020, 76, 827–838. [Google Scholar] [CrossRef] [PubMed]
- Nguyen Dinh Cat, A.; Montezano, A.C.; Burger, D.; Touyz, R.M. Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxid. Redox Signal. 2013, 19, 1110–1120. [Google Scholar] [CrossRef] [PubMed]
- Cortés, A.; Solas, M.; Pejenaute, Á.; Abellanas, M.A.; Garcia-Lacarte, M.; Aymerich, M.S.; Marqués, J.; Ramírez, M.J.; Zalba, G. Expression of Endothelial NOX5 Alters the Integrity of the Blood-Brain Barrier and Causes Loss of Memory in Aging Mice. Antioxidants 2021, 10, 1311. [Google Scholar] [CrossRef]
- Elbatreek, M.H.; Sadegh, S.; Anastasi, E.; Guney, E.; Nogales, C.; Kacprowski, T.; Hassan, A.A.; Teubner, A.; Huang, P.H.; Hsu, C.Y.; et al. NOX5-induced uncoupling of endothelial NO synthase is a causal mechanism and theragnostic target of an age-related hypertension endotype. PLoS Biol. 2020, 18, e3000885. [Google Scholar] [CrossRef]
- Baraibar-Churio, A.; Bobadilla, M.; Machado, F.J.D.; Sáinz, N.; Roncal, C.; Abizanda, G.; Prósper, F.; Orbe, J.; Pérez-Ruiz, A. Deficiency of MMP-10 aggravates the diseased phenotype of aged dystrophic mice. Life 2021, 11, 1398. [Google Scholar] [CrossRef]









| Gene Name | Accession Number | Sequence (5′-3′) | Product Size (bp) | Annealing T (°C) | |
|---|---|---|---|---|---|
| NOX1 | NM_007052.5 | Forward | CTACCTCCCACCCCAAGTCT | 227 | 60 |
| Reverse | TGACTGCTCAAACCTGACGA | ||||
| NOX2 | NM_000433.4 | Forward | CTGTGAATGAGGGGCTCTCC | 340 | 60 |
| Reverse | GCAATGGTGTGAATCGCAGA | ||||
| NOX4 | NM_016931.5 | Forward | CTGTATTTTCTCAGGCGTGCAT | 113 | 60 |
| Reverse | CCTCATCTCGGTATCTTGCTGC | ||||
| NOX5 | NM_024505.4 | Forward | TAAGAGGCTGTCGAGGAGTGT | 71 | 60 |
| Reverse | CCAAAAGTATCTCAGAGCCCTTG | ||||
| SOD1 | NM_000454.5 | Forward | GAAGAGAGGCATGTTGGAGAC | 240 | 59 |
| Reverse | GAATGTTTATTGGGCGATCC | ||||
| SOD2 | NM_000636.4 | Forward | GTTGGCCAAGGGAGATGTT | 171 | 61 |
| Reverse | TCAAAGGAACCAAAGTCACG | ||||
| MMP-1 | NM_002421.4 | Forward | CAAAGGGAATAAGTACTGGGCTGT | 375 | 60 |
| Reverse | TTCCTGCAGTTGAACCAGCT | ||||
| MMP-2 | NM_004530.6 | Forward | GCGGTCACAGCTACTTCTTC | 153 | 59 |
| Reverse | TATCGAAGGCAGTGGAGAGG | ||||
| MMP-10 | NM_002425.3 | Forward | TTGCAGTTAAAGAACATGGAGACT | 181 | 59 |
| Reverse | GAGTGGCCAAGTTCATGAGC | ||||
| MMP-14 | NM_004995.4 | Forward | TCCAGCAACTTTATGGGGGT | 130 | 59 |
| Reverse | TTCCCGTCACAGATGTTGGG | ||||
| TIMP-1 | NM_003254.3 | Forward | AGAGACACCAGAGAACCCACC | 373 | 61 |
| Reverse | GCAAGAGTCCATCCTGCAGT | ||||
| TIMP-2 | NM_003255.5 | Forward | CAGATGTAGTGATCAGGGCCAA | 201 | 59 |
| Reverse | TCTTTCCTCCAACGTCCAGC | ||||
| AT1R | NM_000685.5 | Forward | TCGGCACCAGGTGTATTT | 245 | 60 |
| Reverse | GCCACAGTCTTCAGCTTCAT | ||||
| AT2R | NM_000686.5 | Forward | GAAGAAGGCATAAGAACTAGGAGC | 384 | 60 |
| Reverse | CACAGGTCCAAAGAGCCAGT | ||||
| GAPDH | NM_001289726.1 | Forward | CCAAGGTCATCCATGACAAC | 157 | 59 |
| Reverse | TGTCATACCAGGAAATGAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marqués, J.; Ainzúa, E.; Orbe, J.; Martínez-Azcona, M.; Martínez-González, J.; Zalba, G. NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells. Antioxidants 2024, 13, 1199. https://doi.org/10.3390/antiox13101199
Marqués J, Ainzúa E, Orbe J, Martínez-Azcona M, Martínez-González J, Zalba G. NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells. Antioxidants. 2024; 13(10):1199. https://doi.org/10.3390/antiox13101199
Chicago/Turabian StyleMarqués, Javier, Elena Ainzúa, Josune Orbe, María Martínez-Azcona, José Martínez-González, and Guillermo Zalba. 2024. "NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells" Antioxidants 13, no. 10: 1199. https://doi.org/10.3390/antiox13101199
APA StyleMarqués, J., Ainzúa, E., Orbe, J., Martínez-Azcona, M., Martínez-González, J., & Zalba, G. (2024). NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells. Antioxidants, 13(10), 1199. https://doi.org/10.3390/antiox13101199

