Novel Antioxidant Insights of Myricetin on the Performance of Broiler Chickens and Alleviating Experimental Infection with Eimeria spp.: Crosstalk between Oxidative Stress and Inflammation
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds, Experimental Design and Growth Monitoring
2.2. Experimental Challenge by Eimeria spp.
2.3. Growth Performance Parameters
2.4. Fecal Oocytes Shedding of Eimeria spp.
2.5. Intestinal Lesion Score
2.6. Biochemical Measurements
2.7. Oxidative and Antioxidant Evaluation
2.8. Gene Expression by Reverse Transcription Quantitative Real-Time PCR (RT-qPCR)
2.9. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Oxidative and Antioxidant Status in Muscle and Intestinal Tissues
3.3. Fecal Oocytes Count, Intestinal Lesion Score and Mortality Percent
3.4. Serum Inflammatory and Immune-Related Biomarkers
3.5. Intestinal and Muscles Antioxidants Gene Expression
3.6. Cytokines and Chemokines Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mishra, B.; Jha, R. Oxidative stress in the poultry gut: Potential challenges and interventions. Front. Vet. Sci. 2019, 6, 60. [Google Scholar] [CrossRef] [PubMed]
- Xing, T.; Gao, F.; Tume, R.K.; Zhou, G.; Xu, X. Stress effects on meat quality: A mechanistic perspective. Compr. Rev. Food Sci. Food Saf. 2019, 18, 380–401. [Google Scholar] [PubMed]
- Yang, T.; Sun, Z.; Li, X. Generation mechanism of oxidative stress during early weaning and Its Impacts. Chin. J. Anim. Nutr. 2013, 25, 705–714. [Google Scholar]
- Ibrahim, D.; Ismail, T.A.; Khalifa, E.; El-Kader, A.; Shaimaa, A.; Mohamed, D.I.; Mohamed, D.T.; Shahin, S.E.; El-Hamid, A.; Marwa, I. Supplementing Garlic Nanohydrogel Optimized Growth, Gastrointestinal Integrity and Economics and Ameliorated Necrotic Enteritis in Broiler Chickens Using a Clostridium perfringens Challenge Model. Animals 2021, 11, 2027. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, D.; Arisha, A.H.; Khater, S.I.; Gad, W.M.; Hassan, Z.; Abou-Khadra, S.H.; Mohamed, D.I.; Ahmed Ismail, T.; Gad, S.A.; Eid, S.A. Impact of Omega-3 Fatty Acids Nano-Formulation on Growth, Antioxidant Potential, Fillet Quality, Immunity, Autophagy-Related Genes and Aeromonas hydrophila Resistance in Nile Tilapia (Oreochromis niloticus). Antioxidants 2022, 11, 1523. [Google Scholar] [CrossRef]
- Khater, S.I.; Lotfy, M.M.; Alandiyjany, M.N.; Alqahtani, L.S.; Zaglool, A.W.; Althobaiti, F.; Ismail, T.A.; Soliman, M.M.; Saad, S.; Ibrahim, D. Therapeutic Potential of Quercetin Loaded Nanoparticles: Novel Insights in Alleviating Colitis in an Experimental DSS Induced Colitis Model. Biomedicines 2022, 10, 1654. [Google Scholar] [CrossRef] [PubMed]
- Surai, P.F. Natural Antioxidants in Avian Nutrition and Reproduction; Nottingham University Press: Nottingham, UK, 2002. [Google Scholar]
- Ibrahim, D.; Nem, A.N.A.; Ibrahim, S.M.; Eissa, H.M.; Fawzey, M.; Mostafa, D.I.; Abd El-Kader, S.A.; Khater, S.; Khater, S.I. Dual effect of Selenium loaded Chitosan Nanoparticles on growth, antioxidant, immune related genes expression, transcriptomics modulation of caspase 1, cytochrome P450 and heat shock protein and Aeromonas hydrophila resistance of Nile Tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2021, 110, 91–99. [Google Scholar]
- Ibrahim, D.; Moustafa, A.; Metwally, A.S.; Nassan, M.A.; Abdallah, K.; Eldemery, F.; Tufarelli, V.; Laudadio, V.; Kishawy, A.T. Potential Application of Cornelian Cherry Extract on Broiler Chickens: Growth, Expression of Antioxidant Biomarker and Glucose Transport Genes, and Oxidative Stability of Frozen Meat. Animals 2021, 11, 1038. [Google Scholar] [CrossRef]
- Guo, F.; Suo, X.; Zhang, G.; Shen, J. Efficacy of decoquinate against drug sensitive laboratory strains of Eimeria tenella and field isolates of Eimeria spp. in broiler chickens in China. Vet. Parasitol. 2007, 147, 239–245. [Google Scholar] [CrossRef]
- Naidoo, V.; McGaw, L.J.; Bisschop, S.; Duncan, N.; Eloff, J.N. The value of plant extracts with antioxidant activity in attenuating coccidiosis in broiler chickens. Vet. Parasitol. 2008, 153, 214–219. [Google Scholar] [CrossRef]
- Ibrahim, D.; Moustafa, A.; Shahin, S.; Sherief, W.; Farag, M.; Nassan, M. Impact of fermented or enzymatically fermented dried olive pomace on growth, expression of digestive enzymes and glucose transporters genes, oxidative stability of frozen meat and economic efficiency of broiler chickens. Front. Vet. Sci. 2021, 8, 442. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Li, Y.; Luo, L. Effect of myricetin on primary open-angle glaucoma. Transl. Neurosci. 2018, 9, 132–141. [Google Scholar] [CrossRef]
- Georgieva, N.; Koinarski, V.; Gadjeva, V. Antioxidant status during the course of Eimeria tenella infection in broiler chickens. Vet. J. 2006, 172, 488–492. [Google Scholar] [CrossRef] [PubMed]
- Bozkurt, M.; Giannenas, I.; Küçükyilmaz, K.; Christaki, E.; Florou-Paneri, P. An update on approaches to controlling coccidia in poultry using botanical extracts. Br. Poult. Sci. 2013, 54, 713–727. [Google Scholar] [CrossRef]
- Tsiouris, V.; Giannenas, I.; Bonos, E.; Papadopoulos, E.; Stylianaki, I.; Sidiropoulou, E.; Lazari, D.; Tzora, A.; Ganguly, B.; Georgopoulou, I. Efficacy of a Dietary Polyherbal Formula on the Performance and Gut Health in Broiler Chicks after Experimental Infection with Eimeria spp. Pathogens 2021, 10, 524. [Google Scholar] [CrossRef]
- Jang, S.I.; Jun, M.-H.; Lillehoj, H.S.; Dalloul, R.A.; Kong, I.-K.; Kim, S.; Min, W. Anticoccidial effect of green tea-based diets against Eimeria maxima. Vet. Parasitol. 2007, 144, 172–175. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, D.; Sewid, A.H.; Arisha, A.H.; Abd El-Fattah, A.H.; Abdelaziz, A.M.; Al-Jabr, O.A.; Kishawy, A.T. Influence of Glycyrrhiza glabra Extract on Growth, Gene Expression of Gut Integrity, and Campylobacter jejuni Colonization in Broiler Chickens. Front. Vet. Sci. 2020, 7, 612063. [Google Scholar] [CrossRef] [PubMed]
- Amber, K.; Nofel, R.; Ghanem, R.; Sayed, S.; Farag, S.A.; Shukry, M.; Dawood, M.A. Enhancing the growth rate, biochemical blood indices, and antioxidative capacity of broilers by including aloe vera gel in drinking water. Front. Vet. Sci. 2021, 7, 632666. [Google Scholar] [CrossRef]
- Abou-Elkhair, R.; Gaafar, K.M.; Elbahy, N.; Helal, M.A.; Mahboub, H.; Sameh, G. Bioactive effect of dietary supplementation with essential oils blend of oregano, thyme and garlic oils on performance of broilers infected with Eimeria species. Glob. Vet. 2014, 13, 977–985. [Google Scholar]
- Shehata, A.A.; Yalçın, S.; Latorre, J.D.; Basiouni, S.; Attia, Y.A.; Abd El-Wahab, A.; Visscher, C.; El-Seedi, H.R.; Huber, C.; Hafez, H.M. Probiotics, prebiotics, and phytogenic substances for optimizing gut health in poultry. Microorganisms 2022, 10, 395. [Google Scholar] [CrossRef]
- Muthamilselvan, T.; Kuo, T.-F.; Wu, Y.-C.; Yang, W.-C. Herbal remedies for coccidiosis control: A review of plants, compounds, and anticoccidial actions. Evid.-Based Complement. Altern. Med. Ecam 2016, 2016, 2657981. [Google Scholar] [CrossRef] [PubMed]
- Qureshi, N.A. In vitro Anticoccidial, Antioxidant Activities and Biochemical Screening of Methanolic and Aqueous Leaves Extracts of Selected Plants. Pak. Vet. J. 2021, 41, 57–63. [Google Scholar]
- Igwe, E.O.; Charlton, K.E. A systematic review on the health effects of plums (Prunus domestica and Prunus salicina). Phytother. Res. 2016, 30, 701–731. [Google Scholar] [CrossRef] [PubMed]
- Abbas, A.; Iqbal, Z.; Abbas, R.Z.; Khan, M.K.; Khan, J.A. In-vitro anticoccidial potential of Saccharum officinarum extract against Eimeria oocysts. Bol. Latinoam. Caribe Plantas Med. Y Aromat. 2015, 14, 456–461. [Google Scholar]
- Ugwuoke, G.M.; Pewan, S. Effect of methanol extract of Parkia biglobosa root bark on organ and carcass weight and histopathological changes in Eimeria tenella infected broiler chickens. Anim. Res. Int. 2020, 17, 3587–3595. [Google Scholar]
- Ong, K.C.; Khoo, H.-E. Biological effects of myricetin. Gen. Pharmacol. Vasc. Syst. 1997, 29, 121–126. [Google Scholar] [CrossRef]
- Lin, H.-H.; Huang, C.-Y. Characterization of flavonol inhibition of DnaB helicase: Real-time monitoring, structural modeling, and proposed mechanism. J. Biomed. Biotechnol. 2012, 2012, 735368. [Google Scholar] [CrossRef]
- Huang, P.; Zhou, M.; Cheng, S.; Hu, Y.; Gao, M.; Ma, Y.; Limpanont, Y.; Zhou, H.; Dekumyoy, P.; Cheng, Y. Myricetin possesses anthelmintic activity and attenuates hepatic fibrosis via modulating TGFβ1 and Akt signaling and shifting Th1/Th2 balance in Schistosoma japonicum-infected mice. Front. Immunol. 2020, 11, 593. [Google Scholar] [CrossRef]
- Imran, M.; Saeed, F.; Hussain, G.; Imran, A.; Mehmood, Z.; Gondal, T.A.; El-Ghorab, A.; Ahmad, I.; Pezzani, R.; Arshad, M.U. Myricetin: A comprehensive review on its biological potentials. Food Sci. Nutr. 2021, 9, 5854–5868. [Google Scholar] [CrossRef]
- Cho, B.O.; Yin, H.H.; Park, S.H.; Byun, E.B.; Ha, H.Y.; Jang, S.I. Anti-inflammatory activity of myricetin from Diospyros lotus through suppression of NF-κB and STAT1 activation and Nrf2-mediated HO-1 induction in lipopolysaccharide-stimulated RAW264. 7 macrophages. Biosci. Biotechnol. Biochem. 2016, 80, 1520–1530. [Google Scholar] [CrossRef]
- Dörr, R.; Müller-Wieland, D.; Tschoepe, D. Diabetes and the Heart-a Never-ending Story. Herz 2010, 35, 129. [Google Scholar] [CrossRef][Green Version]
- Kan, X.; Liu, J.; Chen, Y.; Guo, W.; Xu, D.; Cheng, J.; Cao, Y.; Yang, Z.; Fu, S. Myricetin protects against H2O2-induced oxidative damage and apoptosis in bovine mammary epithelial cells. J. Cell. Physiol. 2021, 236, 2684–2695. [Google Scholar] [CrossRef]
- Aviagen, W. Ross 308: Broiler Nutrition Specification; Aviagen Inc.: Huntsville, AL, USA, 2014. [Google Scholar]
- Aviagen, W. Ross 308: Broiler Nutrition Specification; Aviagen Inc.: Huntsville, AL, USA, 2022. [Google Scholar]
- AOAC. Official Methods of Analysis of AOAC International, Association of Official Analytical Chemists; AOAC: Rockville, MD, USA, 2012. [Google Scholar]
- Kishawy, A.T.; Al-Khalaifah, H.S.; Nada, H.S.; Roushdy, E.M.; Zaglool, A.W.; Ahmed Ismail, T.; Ibrahim, S.M.; Ibrahim, D. Black Pepper or Radish Seed Oils in a New Combination of Essential Oils Modulated Broiler Chickens’ Performance and Expression of Digestive Enzymes, Lipogenesis, Immunity, and Autophagy-Related Genes. Vet. Sci. 2022, 9, 43. [Google Scholar] [CrossRef] [PubMed]
- Christaki, E.; Florou-Paneri, P.; Giannenas, I.; Papazahariadou, M.; Botsoglou, N.A.; Spais, A.B. Effect of a mixture of herbal extracts on broiler chickens infected with Eimeria tenella. Anim. Res. 2004, 53, 137–144. [Google Scholar] [CrossRef]
- Johnson, J.; Reid, W.M. Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970, 28, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.R.; Oomah, D.B.; Diarra, M.S. Potential immunomodulatory effects of non-dialyzable materials of cranberry extract in poultry production. Poult. Sci. 2017, 96, 341–350. [Google Scholar] [CrossRef]
- Ahn, D.; Olson, D.; Jo, C.; Love, J.; Jin, S. Volatiles production and lipid oxidation in irradiated cooked sausage as related to packaging and storage. J. Food Sci. 1999, 64, 226–229. [Google Scholar] [CrossRef]
- Loreto, F.; Velikova, V. Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes. Plant Physiol. 2001, 127, 1781–1787. [Google Scholar] [CrossRef]
- LeBel, C.P.; Ischiropoulos, H.; Bondy, S.C. Evaluation of the probe 2′, 7′-dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem. Res. Toxicol. 1992, 5, 227–231. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Georgieva, N.; Gabrashanska, M.; Koinarski, V.; Ermidou-Pollet, S. Antioxidant status in Eimeria acervulina infected chickens after dietary selenium treatment. Trace Elem. Electrolytes 2011, 28, 42. [Google Scholar] [CrossRef]
- Ruff, J.; Tellez, G., Jr.; Forga, A.J.; Señas-Cuesta, R.; Vuong, C.N.; Greene, E.S.; Hernandez-Velasco, X.; Uribe, Á.J.; Martínez, B.C.; Angel-Isaza, J.A. Evaluation of three formulations of essential oils in broiler chickens under cyclic heat stress. Animals 2021, 11, 1084. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Suo, X.; Gu, J.; Zhang, W.; Fang, Q.; Wang, X. Influence of grape seed proanthocyanidin extract in broiler chickens: Effect on chicken coccidiosis and antioxidant status. Poult. Sci. 2008, 87, 2273–2280. [Google Scholar] [CrossRef] [PubMed]
- Abu Hafsa, S.; Ibrahim, S. Effect of dietary polyphenol-rich grape seed on growth performance, antioxidant capacity and ileal microflora in broiler chicks. J. Anim. Physiol. Anim. Nutr. 2018, 102, 268–275. [Google Scholar] [CrossRef] [PubMed]
- Abolfathi, M.-E.; Tabeidian, S.A.; Foroozandeh Shahraki, A.D.; Tabatabaei, S.N.; Habibian, M. Comparative effects of n-hexane and methanol extracts of elecampane (Inula helenium L.) rhizome on growth performance, carcass traits, feed digestibility, intestinal antioxidant status and ileal microbiota in broiler chickens. Arch. Anim. Nutr. 2019, 73, 88–110. [Google Scholar] [CrossRef] [PubMed]
- Nath, S.; Kumar.k, A. Role of Flavonoids in Poultry Nutrition. Acta Sci. Vet. Sci. 2021, 3, 88–91. [Google Scholar] [CrossRef]
- Semwal, D.K.; Semwal, R.B.; Combrinck, S.; Viljoen, A. Myricetin: A Dietary Molecule with Diverse Biological Activities. Nutrients 2016, 8, 90. [Google Scholar] [CrossRef]
- Bozkurt, M.; Aysul, N.; Küçükyilmaz, K.; Aypak, S.; Ege, G.; Catli, A.; Akşit, H.; Çöven, F.; Seyrek, K.; Çınar, M. Efficacy of in-feed preparations of an anticoccidial, multienzyme, prebiotic, probiotic, and herbal essential oil mixture in healthy and Eimeria spp.-infected broilers. Poult. Sci. 2014, 93, 389–399. [Google Scholar] [CrossRef]
- Liu, H.; Chen, P.; Lv, X.; Zhou, Y.; Li, X.; Ma, S.; Zhao, J. Effects of chlorogenic acid on performance, anticoccidial indicators, immunity, antioxidant status, and intestinal barrier function in coccidia-infected broilers. Animals 2022, 12, 963. [Google Scholar] [CrossRef]
- Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essential oils—A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar]
- Kim, D.K.; Lillehoj, H.S.; Lee, S.H.; Lillehoj, E.P.; Bravo, D. Improved resistance to Eimeria acervulina infection in chickens due to dietary supplementation with garlic metabolites. Br. J. Nutr. 2013, 109, 76–88. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Lillehoj, H.S.; Jang, S.I.; Lee, K.W.; Park, M.S.; Bravo, D.; Lillehoj, E.P. Cinnamaldehyde enhances in vitro parameters of immunity and reduces in vivo infection against avian coccidiosis. Br. J. Nutr. 2011, 106, 862–869. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.L.; Chung, C.-Y.; Kuo, C.-H.; Kuo, T.-F.; Yang, C.-W.; Yang, W.-C. Beneficial effect of Bidens pilosa on body weight gain, food conversion ratio, gut bacteria and coccidiosis in chickens. PLoS ONE 2016, 11, e0146141. [Google Scholar] [CrossRef] [PubMed]
- Pop, L.M.; Varga, E.; Coroian, M.; Nedișan, M.E.; Mircean, V.; Dumitrache, M.O.; Farczádi, L.; Fülöp, I.; Croitoru, M.D.; Fazakas, M. Efficacy of a commercial herbal formula in chicken experimental coccidiosis. Parasites Vectors 2019, 12, 343. [Google Scholar] [CrossRef]
- Allen, P. Avian Dis.: Anticoccidial effects of xanthohumol. J. Avian Med. Surg. 2007, 21, 241–242. [Google Scholar]
- Sharma, U.N.S.; Fernando, D.D.; Wijesundara, K.K.; Manawadu, A.; Pathirana, I.; Rajapakse, R.J. Anticoccidial effects of Phyllanthus emblica (Indian gooseberry) extracts: Potential for controlling avian coccidiosis. Vet. Parasitol. Reg. Stud. Rep. 2021, 25, 100592. [Google Scholar] [CrossRef]
- Koutsos, E.; Arias, V. Intestinal ecology: Interactions among the gastrointestinal tract, nutrition, and the microflora. J. Appl. Poult. Res. 2006, 15, 161–173. [Google Scholar] [CrossRef]
- Mountzouris, K.; Paraskevas, V.; Tsirtsikos, P.; Palamidi, I.; Steiner, T.; Schatzmayr, G.; Fegeros, K. Assessment of a phytogenic feed additive effect on broiler growth performance, nutrient digestibility and caecal microflora composition. Anim. Feed. Sci. Technol. 2011, 168, 223–231. [Google Scholar] [CrossRef]
- Abdel-Moneim, A.-M.E.; Shehata, A.M.; Alzahrani, S.O.; Shafi, M.E.; Mesalam, N.M.; Taha, A.E.; Swelum, A.A.; Arif, M.; Fayyaz, M.; Abd El-Hack, M.E. The role of polyphenols in poultry nutrition. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1851–1866. [Google Scholar] [CrossRef]
- Nweze, N.; Obiwulu, I. Anticoccidial effects of Ageratum conyzoides. J. Ethnopharmacol. 2009, 122, 6–9. [Google Scholar] [CrossRef]
- Lipiński, K.; Mazur, M.; Antoszkiewicz, Z.; Purwin, C. Polyphenols in monogastric nutrition—A review. Ann. Anim. Sci. 2017, 17, 41–58. [Google Scholar] [CrossRef]
- Liang, Y.; Zhou, J.; Ji, K.; Liu, H.; Degen, A.; Zhai, M.; Jiao, D.; Guo, J.; Zhao, Z.; Yang, G. Protective effect of resveratrol improves systemic inflammation responses in LPS-injected lambs. Animals 2019, 9, 872. [Google Scholar] [CrossRef] [PubMed]
- Badran, A.M. Effect of dietary curcumin and curcumin nanoparticles supplementation on growth performance, immune response and antioxidant of broilers chickens. Egypt. Poult. Sci. J. 2020, 40, 325–343. [Google Scholar] [CrossRef]
- Yan, X.; Han, W.; Liu, X.; Suo, X. Exogenous nitric oxide stimulates early egress of Eimeria tenella sporozoites from primary chicken kidney cells in vitro. Parasite 2021, 28, 11. [Google Scholar] [CrossRef]
- Shen, Z.-J.; Zhu, B.-L.; Jiang, J.-S. The effect of NO during E. tenella or E. acervulina infection of broilers. Acta Vet. Zootech. Sin. 2002, 33, 395–399. [Google Scholar]
- Evans, P.; Halliwell, B. Micronutrients: Oxidant/antioxidant status. Br. J. Nutr. 2001, 85, S67–S74. [Google Scholar] [CrossRef]
- O’Reilly, E.; Eckersall, D. Acute phase proteins: A review of their function, behaviour and measurement in chickens. World’s Poult. Sci. J. 2014, 70, 27–43. [Google Scholar] [CrossRef]
- Sproston, N.R.; Ashworth, J.J. Role of C-reactive protein at sites of inflammation and infection. Front. Immunol. 2018, 9, 754. [Google Scholar] [CrossRef] [PubMed]
- Klebanoff, S.J. Myeloperoxidase: Friend and foe. J. Leukoc. Biol. 2005, 77, 598–625. [Google Scholar] [PubMed]
- Castro, R.; Lamas, J.; Morais, P.; Sanmartín, M.L.; Orallo, F.; Leiro, J. Resveratrol modulates innate and inflammatory responses in fish leucocytes. Vet. Immunol. Immunopathol. 2008, 126, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.Y.; Choi, D.-K.; Lee, D.K.; Hong, Y.J.; Park, E.J. Resveratrol confers protection against rotenone-induced neurotoxicity by modulating myeloperoxidase levels in glial cells. PLoS ONE 2013, 8, e60654. [Google Scholar] [CrossRef]
- Sharman, P.A.; Smith, N.C.; Wallach, M.G.; Katrib, M. Chasing the golden egg: Vaccination against poultry coccidiosis. Parasite Immunol. 2010, 32, 590–598. [Google Scholar] [CrossRef]
- Schwager, J.; Richard, N.; Widmer, F.; Raederstorff, D. Resveratrol distinctively modulates the inflammatory profiles of immune and endothelial cells. BMC Complement. Altern. Med. 2017, 17, 309. [Google Scholar] [CrossRef] [PubMed]
- Moraes, P.O.; Andretta, I.; Cardinal, K.M.; Ceron, M.; Vilella, L.; Borille, R.; Frazzon, A.P.; Frazzon, J.; Santin, E.; Ribeiro, A.M.L. Effect of functional oils on the immune response of broilers challenged with Eimeria spp. Animal 2019, 13, 2190–2198. [Google Scholar] [CrossRef] [PubMed]
- Allen, P.C.; Fetterer, R. Recent advances in biology and immunobiology of Eimeria species and in diagnosis and control of infection with these coccidian parasites of poultry. Clin. Microbiol. Rev. 2002, 15, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Arendt, M.; Elissa, J.; Schmidt, N.; Michael, E.; Potter, N.; Cook, M.; Knoll, L.J. Investigating the role of interleukin 10 on Eimeria intestinal pathogenesis in broiler chickens. Vet. Immunol. Immunopathol. 2019, 218, 109934. [Google Scholar] [CrossRef]
- Cyktor, J.C.; Turner, J. Interleukin-10 and immunity against prokaryotic and eukaryotic intracellular pathogens. Infect. Immun. 2011, 79, 2964–2973. [Google Scholar] [CrossRef]
- Ren, M.; Guo, Q.; Guo, L.; Lenz, M.; Qian, F.; Koenen, R.R.; Xu, H.; Schilling, A.B.; Weber, C.; Ye, R.D. Polymerization of MIP-1 chemokine (CCL3 and CCL4) and clearance of MIP-1 by insulin-degrading enzyme. EMBO J. 2010, 29, 3952–3966. [Google Scholar] [CrossRef]
- Von Stebut, E.; Metz, M.; Milon, G.; Knop, J.R.; Maurer, M. Early macrophage influx to sites of cutaneous granuloma formation is dependent on MIP-1α/β released from neutrophils recruited by mast cell–derived TNFα. Blood J. Am. Soc. Hematol. 2003, 101, 210–215. [Google Scholar] [CrossRef]
- Maurer, M.; Von Stebut, E. Macrophage inflammatory protein-1. Int. J. Biochem. Cell Biol. 2004, 36, 1882–1886. [Google Scholar] [CrossRef]
- Dal Pont, G.C.; Lee, A.; Bortoluzzi, C.; Farnell, Y.; Gougoulias, C.; Kogut, M. Novel model for chronic intestinal inflammation in chickens: (2) Immunologic mechanism behind the inflammatory response. Dev. Comp. Immunol. 2023, 138, 104524. [Google Scholar] [CrossRef] [PubMed]
- Razmkhah, M.; Talei, A.-R.; Doroudchi, M.; Khalili-Azad, T.; Ghaderi, A. Stromal cell-derived factor-1 (SDF-1) alleles and susceptibility to breast carcinoma. Cancer Lett. 2005, 225, 261–266. [Google Scholar] [CrossRef] [PubMed]
- Martin, L.M.; Johnson, P.J.; Amorim, J.R.; Honaker, A.R.; Donaldson, R.S.; DeClue, A.E. Investigation of the potential immunomodulatory effects of resveratrol on equine whole blood: An in vitro investigation. Res. Vet. Sci. 2016, 106, 97–99. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, D.; Kishawy, A.T.Y.; Khater, S.I.; Khalifa, E.; Ismail, T.A.; Mohammed, H.A.; Elnahriry, S.S.; Tolba, H.A.; Sherief, W.R.I.A.; Farag, M.F.M.; et al. Interactive effects of dietary quercetin nanoparticles on growth, flesh antioxidant capacity and transcription of cytokines and Aeromonas hydrophila quorum sensing orchestrating genes in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2021, 119, 478–489. [Google Scholar] [CrossRef]
- Zhao, C.; Nguyen, T.; Liu, L.; Sacco, R.E.; Brogden, K.A.; Lehrer, R.I. Gallinacin-3, an inducible epithelial β-defensin in the chicken. Infect. Immun. 2001, 69, 2684–2691. [Google Scholar] [CrossRef]
- Zhao, B.-C.; Lin, H.-C.; Yang, D.; Ye, X.; Li, Z.-G. Disulfide bridges in defensins. Curr. Top. Med. Chem. 2016, 16, 206–219. [Google Scholar] [CrossRef]
- Yu, H.Y.; Kim, K.-S.; Lee, Y.-C.; Moon, H.-I.; Lee, J.-H. Oleifolioside A, a new active compound, attenuates LPS-stimulated iNOS and COX-2 expression through the downregulation of NF-κB and MAPK activities in RAW 264.7 macrophages. Evid. Based Complement. Altern. Med. 2012, 2012, 637512. [Google Scholar] [CrossRef]
- Vladimirov, Y.A. Reactive oxygen and nitrogen species: Diagnostic, preventive and therapeutic values. Biochemistry 2004, 69, 1. [Google Scholar] [CrossRef]
- Koinarski, V.; Georgieva, N.; Gadjeva, V.; Petkov, P. Antioxidant status of broiler chickens, infected with Eimeria acervulina. Rev. Méd. Vét. 2005, 156, 498. [Google Scholar]
- Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef]
- Abbas, R.; Iqbal, Z.; Mansoor, M.; Sindhu, Z.; Zia, M.; Khan, J. Role of natural antioxidants for the control of coccidiosis in poultry. Pak. Vet. J. 2013, 33, 401–407. [Google Scholar]
- Idris, M.; Abbas, R.; Masood, S.; Rehman, T.; Farooq, U.; Babar, W.; Hussain, R.; Raza, A.; Riaz, U. The potential of antioxidant rich essential oils against avian coccidiosis. World’s Poult. Sci. J. 2017, 73, 89–104. [Google Scholar] [CrossRef]
Ingredients g/kg | Starter (0–10 Day) | Grower (11–24 Day) | Finisher (25–42 Day) |
---|---|---|---|
Yellow corn grain | 57.00 | 60.60 | 62.00 |
Soybean meal, 47.5% | 35.00 | 29.00 | 25.00 |
Corn gluten, 60% | 2.80 | 4.50 | 4.00 |
Wheat bran | -- | -- | 1.90 |
Soybean oil | 1.20 | 2.00 | 3.66 |
Calcium carbonate | 1.00 | 1.00 | 0.90 |
Dicalciumphosphate | 1.96 | 1.90 | 1.60 |
Common salt | 0.30 | 0.30 | 0.30 |
Premix * | 0.30 | 0.30 | 0.30 |
DL-Methionine, 98% | 0.18 | 0.14 | 0.11 |
Lysine, Hcl, 78% | 0.16 | 0.16 | 0.13 |
Anti-mycotoxin | 0.10 | 0.10 | 0.10 |
Analyzed chemical composition | |||
Metabolic energy, Kcal/Kg | 3000.40 | 3104.52 | 3202.02 |
Crude protein, % | 23.02 | 21.44 | 19.57 |
Ether extract, % | 3.72 | 4.60 | 6.24 |
Crude fiber, % | 2.66 | 2.55 | 2.63 |
Calcium, % | 1.01 | 0.98 | 0.86 |
Available phosphorus, % | 0.50 | 0.48 | 0.41 |
Lysine, % | 1.38 | 1.22 | 1.10 |
Methionine, % | 0.56 | 0.52 | 0.46 |
Specificity/Target Gene | Primer Sequence (5′-3′) | Accession No. |
---|---|---|
CAT | F-GGGGAGCTGTTTACTGCAAG | NM_001031215.2 |
R-GGGGAGCTGTTTACTGCAAG | ||
SOD | F-GGCAATGTGACTGCAAAGGG | NM_205064.1 |
R-CCCCTCTACCCAGGTCATCA | ||
GSH-Px | F-AACCAATTCGGGCACCAG | HM590226 |
R-CCGTTCACCTCGCACTTCTC | ||
HO-1 | F-AAGAGCCAGGAGAACGGTCA | NM_205344 |
R-AAGAGCCAGGAGAACGGTCA | ||
NQO1 | F-TCGCCGAGCAGAAGAAGATTGAAG | NM_001277620.1 |
R-CGGTGGTGAGTGACAGCATGG | ||
COX-2 | F-TGTCCTTTCACTGCTTTCCAT | NM_0,011,67718.1 |
R-TTCCATTGCTGTGTTTGAGGT | ||
IL-6 | F-AGGACGAGATGTGCAAGAAGTTC | NM_204,628 |
R-TTGGGCAGGTTGAGGTTGTT | ||
IL-1β | GCTCTACATGTCGTGTGTGATGAG | NM_204,524 |
TGTCGATGTCCCGCATGA | ||
TNF-α | F-CCCCTACCCTGTCCCACAA | XM_046900549.1 |
R-ACTGCGGAGGGTTCATTCC | ||
CCL4 | F: GCAGTTGTTCTCGCTCTTC | NM_204720.1 |
R: GCGCTCCTTCTTTGTGAT | ||
CCL20 | F: AGGCAGCGAAGGAGCAC | NM_204438 |
R: GCAGAGAAGCCAAAATCAAAC | ||
CXCL13 | F: GCCTGTGCCTGGTGCTC | NM_001348657.1 |
R: TGCCCCCTTCCCCTAAC | ||
AVBD6 | F:GCCCTACTTTTCCAGCCCTATT | NM 001001193.1 |
R: GGCCCAGGAATGCAGACA | ||
AVBD12 | F:TGTAACCACGACAGGGGATTG | NM 001001607.2 |
R: GGGAGTTGGTGACAGAGGTTT | ||
GAPDH | F: GGTGGTGCTAAGCGTGTTA | NM205518 |
R: CCCTCCACAATGCCAA |
Myricetin (mg/kg Diet) | |||||||
---|---|---|---|---|---|---|---|
Parameters | NC | IC | Myc 200 | Myc 400 | Myc 600 | p-Value | SEM |
Starter period (0–10 day) | |||||||
Initial BW (g/bird) | 44.40 | 44.40 | 44.40 | 44.20 | 44.40 | 0.979 | 0.11 |
BW (g/bird) | 269.20 d | 268.80 d | 280.60 c | 286.60 b | 291.00 a | <0.001 | 1.87 |
BWG (g/bird) | 224.80 d | 224.40 d | 236.20 c | 242.40 b | 246.60 a | <0.001 | 1.88 |
FI (g/bird) | 311.60 b | 310.80 b | 318.40 a | 324.00 a | 320.40 a | <0.001 | 1.24 |
FCR | 1.39 a | 1.39 a | 1.35 b | 1.34 b | 1.30 c | <0.001 | 0.01 |
Grower period (11–24 day) | |||||||
BW (g/bird) | 1130.40 a | 1065.80 d | 1083.40 c | 1097.00 b | 1127.40 a | <0.001 | 5.15 |
BWG (g/bird) | 861.20 a | 797.00 d | 802.80 d | 810.40 c | 836.40 b | <0.001 | 4.96 |
FI (g/bird) | 1281.20 cd | 1356.40 a | 1329.20 b | 1286.40 c | 1266.40 d | <0.001 | 7.09 |
FCR | 1.49 e | 1.70 a | 1.66 b | 1.59 c | 1.51 d | <0.001 | 0.02 |
Finisher period (25–42 day) | |||||||
BW (g/bird) | 2602.33 a | 2145.67 d | 2267.33 c | 2459.67 b | 2496.67 b | <0.001 | 34.00 |
BWG (g/bird) | 1471.93 a | 1079.87 d | 1183.93 c | 1362.67 b | 1369.27 b | <0.001 | 29.24 |
FI (g/bird) | 2595.73 a | 2360.00 c | 2342.67 c | 2483.67 b | 2416.67 bc | <0.001 | 22.23 |
FCR | 1.76 c | 2.19 a | 1.98 b | 1.82 c | 1.76 c | <0.001 | 0.03 |
Overall performance (0–42 day) | |||||||
Final BW (g/bird) | 2602.33 a | 2145.67 d | 2267.33 c | 2459.67 b | 2496.67 b | <0.001 | 34.00 |
Total BWG (g/bird) | 2557.93 a | 2101.27 d | 2222.93 c | 2415.47 b | 2452.27 b | <0.001 | 34.01 |
Total FI (g/bird) | 4188.53 a | 4027.20 b | 3990.27 b | 4093.73 ab | 4003.47 b | <0.001 | 19.29 |
Overall FCR | 1.64 d | 1.92 a | 1.80 b | 1.69 c | 1.63 d | <0.001 | 0.02 |
Myricetin (mg/kg Diet) | |||||||
---|---|---|---|---|---|---|---|
Parameters | NC | IC | Myc 200 | Myc 400 | Myc 600 | p-Value | SEM |
Muscle Tissues | |||||||
T-AOC (U/mg of protein) | 1.79 c | 1.62 c | 2.46 b | 2.98 ab | 3.35 a | <0.001 | 0.69 |
MDA (nmol/g tissue) | 19.96 b | 21.69 a | 19.10 b | 18.32 c | 16.20 d | <0.001 | 1.29 |
ROS | 63.47 b | 86.14 a | 64.12 b | 63.52 b | 57.66 c | <0.001 | 3.03 |
H2O2 (µmoL/g tissue) | 2.69 b | 3.85 a | 2.31 c | 2.21 cd | 2.01 d | <0.001 | 0.53 |
Intestinal Tissues (Jejunum) | |||||||
T-AOC (U/mg of protein) | 1.13 c | 0.63 d | 1.26 b | 1.29 b | 1.39 a | <0.001 | 0.022 |
MDA (nmol/g tissue) | 15.32 b | 21.69 a | 13.55 c | 12.90 d | 12.11 e | <0.001 | 1.36 |
ROS (μL/g tissue) | 58.17 b | 66.10 a | 58.18 b | 55.12 c | 51.60 d | <0.001 | 5.15 |
H2O2 (µmoL/g tissue) | 2.23 b | 3.99 a | 1.96 c | 1.78 cd | 1.61 d | <0.001 | 0.50 |
Myricetin (mg/kg Diet) | |||||||
---|---|---|---|---|---|---|---|
Parameters | NC | IC | Myc 200 | Myc 400 | Myc 600 | p-Value | SEM |
Fecal oocytes count (×103/g feces) | |||||||
7 dpi | ND | 355.40 a | 352.20 a | 340.00 b | 339.60 b | <0.001 | 28.36 |
14 dpi | ND | 227.60 a | 212.80 b | 169.60 c | 135.20 d | <0.001 | 16.62 |
21 dpi | ND | 74.20 a | 54.40 b | 44.00 c | 34.80 d | <0.001 | 5.03 |
Intestinal lesion score 7 dpi | |||||||
Duodenal lesion score | ND | 3.40 a | 3.00 b | 2.80 b | 2.60 c | <0.001 | 0.27 |
Jujenal lesion score | ND | 3.80 a | 3.60 a | 3.20 a | 2.20 b | <0.001 | 0.29 |
Ileal lesion score | ND | 3.80 a | 3.40 a | 3.40 a | 2.00 b | <0.001 | 0.30 |
Cecal lesion score | ND | 3.60 a | 3.20 a | 3.20 a | 2.20 b | <0.001 | 0.28 |
Mortality % overall the experimental period | |||||||
Mortality % 7 dpi | -- e | 18.00 a | 10.00 b | 8.80 c | 7.40 d | <0.001 | 1.20 |
Mortality % 14 dpi | 0.80 d | 11.00 a | 8.00 b | 5.00 c | 5.00 c | <0.001 | 0.76 |
Mortality % 21 dpi | -- e | 5.00 a | 4.00 b | 3.00 c | 2.00 d | <0.001 | 0.45 |
Myricetin (mg/kg Diet) | |||||||
---|---|---|---|---|---|---|---|
Parameters | NC | IC | Myc 200 | Myc 400 | Myc 600 | p-Value | SEM |
Pre infection (4 days pre coccidian infection) | |||||||
NO (µmol/L) | 0.64 | 0.64 | 0.63 | 0.60 | 0.59 | <0.07 | 0.01 |
CRP (mg/L) | 3.51 a | 3.51 a | 3.32 b | 3.01 c | 2.73 d | <0.001 | 0.06 |
MPO (µmol/L, OD 450 nm) | 0.45 | 0.45 | 0.42 | 0.44 | 0.47 | 0.013 | 0.06 |
IgG (mg/dL) | 1.67 c | 1.67 c | 1.81 b | 1.86 b | 2.38 a | <0.001 | 0.06 |
14 days post infection | |||||||
NO (µmol/L) | 0.65 d | 1.28 a | 0.99 b | 0.99 b | 0.87 c | <0.001 | 0.04 |
CRP (mg/L) | 3.51 d | 10.58 a | 8.60 b | 8.67 b | 6.92 c | <0.001 | 0.49 |
MPO (µmol/L, OD 450 nm) | 0.46 d | 1.67 a | 1.50 b | 1.49 b | 1.25 c | <0.001 | 0.09 |
IgG (mg/dL) | 1.70 d | 5.50 c | 6.67 b | 6.78 b | 7.46 a | <0.001 | 0.42 |
21 days post infection | |||||||
NO (µmol/L) | 0.65 e | 1.02 a | 0.85 b | 0.79 c | 0.72 d | <0.001 | 0.03 |
CRP (mg/L) | 3.49 d | 7.16 a | 5.46 b | 5.45 b | 4.58 c | <0.001 | 0.25 |
MPO (µmol/L, OD 450 nm) | 0.44 d | 1.25 a | 0.90 b | 0.80 b | 0.66 c | <0.001 | 0.06 |
IgG (mg/dL) | 1.66 d | 6.40 c | 7.80 b | 7.71 b | 8.64 a | <0.001 | 0.51 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Ghareeb, W.R.; Kishawy, A.T.Y.; Anter, R.G.A.; Aboelabbas Gouda, A.; Abdelaziz, W.S.; Alhawas, B.; Meligy, A.M.A.; Abdel-Raheem, S.M.; Ismail, H.; Ibrahim, D. Novel Antioxidant Insights of Myricetin on the Performance of Broiler Chickens and Alleviating Experimental Infection with Eimeria spp.: Crosstalk between Oxidative Stress and Inflammation. Antioxidants 2023, 12, 1026. https://doi.org/10.3390/antiox12051026
El-Ghareeb WR, Kishawy ATY, Anter RGA, Aboelabbas Gouda A, Abdelaziz WS, Alhawas B, Meligy AMA, Abdel-Raheem SM, Ismail H, Ibrahim D. Novel Antioxidant Insights of Myricetin on the Performance of Broiler Chickens and Alleviating Experimental Infection with Eimeria spp.: Crosstalk between Oxidative Stress and Inflammation. Antioxidants. 2023; 12(5):1026. https://doi.org/10.3390/antiox12051026
Chicago/Turabian StyleEl-Ghareeb, Waleed Rizk, Asmaa T. Y. Kishawy, Reham G. A. Anter, Asmaa Aboelabbas Gouda, Walaa S. Abdelaziz, Bassam Alhawas, Ahmed M. A. Meligy, Sherief M. Abdel-Raheem, Hesham Ismail, and Doaa Ibrahim. 2023. "Novel Antioxidant Insights of Myricetin on the Performance of Broiler Chickens and Alleviating Experimental Infection with Eimeria spp.: Crosstalk between Oxidative Stress and Inflammation" Antioxidants 12, no. 5: 1026. https://doi.org/10.3390/antiox12051026
APA StyleEl-Ghareeb, W. R., Kishawy, A. T. Y., Anter, R. G. A., Aboelabbas Gouda, A., Abdelaziz, W. S., Alhawas, B., Meligy, A. M. A., Abdel-Raheem, S. M., Ismail, H., & Ibrahim, D. (2023). Novel Antioxidant Insights of Myricetin on the Performance of Broiler Chickens and Alleviating Experimental Infection with Eimeria spp.: Crosstalk between Oxidative Stress and Inflammation. Antioxidants, 12(5), 1026. https://doi.org/10.3390/antiox12051026