Encapsulated Essential Oils Improve the Growth Performance of Meat Ducks by Enhancing Intestinal Morphology, Barrier Function, Antioxidant Capacity and the Cecal Microbiota
Abstract
1. Introduction
2. Materials and Methods
2.1. Ducks Husbandry and Experimental Design
2.2. Growth Performance
2.3. Sample Collection
2.4. Serum Biochemical Parameters Analysis
2.5. Antioxidant Properties of Ileal Mucosa
2.6. RNA isolation and Quantitative Real-Time PCR
2.7. Morphological Analysis of Duodenum and Jejunum
2.8. 16S rRNA Gene Sequencing and Analysis
2.9. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Biochemical Indexes
3.3. Antioxidation of Ileal Mucosa
3.4. Duodenal and Jejunal Morphology
3.5. Effects of EO on the Gene Expression of Barrier Functional Proteins
3.6. Cecal Microbiota Analysis
3.7. Variation in Alpha and Beta Diversity
3.8. Common and Unique Microbial Populations
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- de Veras, B.O.; de Oliveira, M.B.; da Silva Oliveira, F.G.; Dos Santos, Y.Q.; de Oliveira, J.R.; de Menezes Lima, V.L.; da Silva Almeida, J.R.; Navarro, D.M.; de Oliveira Farias, J.C.; dos Santos Aguiar, J.; et al. Chemical composition and evaluation of the antinociceptive, antioxidant and antimicrobial effects of essential oil from Hymenaea cangaceira (Pinto, Mansano & Azevedo) native to Brazil: A natural medicine. J. Ethnopharmacol. 2020, 247, 112265. [Google Scholar] [CrossRef] [Scilit]
- Chouhan, S.; Sharma, K.; Guleria, S. Antimicrobial Activity of Some Essential Oils—Present Status and Future Perspectives. Medicines 2017, 4, 58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horky, P.; Skalickova, S.; Smerkova, K.; Skladanka, J. Essential Oils as a Feed Additives: Pharmacokinetics and Potential Toxicity in Monogastric Animals. Animals 2019, 9, 352. [Google Scholar] [CrossRef] [Scilit]
- Fusaro, I.; Cavallini, D.; Giammarco, M.; Serio, A.; Mammi, L.M.E.; Vettori, J.d.M.; Lanzoni, L.; Formigoni, A.; Vignola, G. Effect of Diet and Essential Oils on the Fatty Acid Composition, Oxidative Stability and Microbiological Profile of Marchigiana Burgers. Antioxidants 2022, 11, 827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, R.; Wu, J.; Zhang, L.; Liu, L.; Casper, D.P.; Jiao, T.; Liu, T.; Wang, J.; Lang, X.; Song, S.; et al. Effects of oregano essential oil on the ruminal pH and microbial population of sheep. PLoS ONE 2019, 14, e0217054. [Google Scholar] [CrossRef] [Scilit]
- Tapper, J. Natural Antibiotics and Antivirals: 18 Infection-Fighting Herbs and Essential Oils. Library J. 2018, 143, 73. [Google Scholar]
- Burt, S. Essential oils: Their antibacterial properties and potential applications in foods—A review. Int. J. Food Microbiol. 2004, 94, 223–253. [Google Scholar] [CrossRef] [Scilit]
- Masotti, V.; Juteau, F.; Bessière, J.M.; Viano, J. Seasonal and Phenological Variations of the Essential Oil from the Narrow Endemic Species Artemisia molinieri and Its Biological Activities. J. Agric. Food Chem. 2003, 51, 7115–7121. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira, J.R.; Figueira, L.W.; Sper, F.L.; Meccatti, V.M.; Camargo, S.E.A.; de Oliveira, L.D. Thymus vulgaris L. and thymol assist murine macrophages (RAW 264.7) in the control of in vitro infections by Staphylococcus aureus, Pseudomonas aeruginosa, and Candida albicans. Immunol. Res. 2017, 65, 932–943. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira, J.R.; Viegas, D.D.J.; Martins, A.P.R.; Carvalho, C.A.T.; Soares, C.P.; Camargo, S.E.A.; Jorge, A.O.C.; de Oliveira, L.D. Thymus vulgaris L. extract has antimicrobial and anti-inflammatory effects in the absence of cytotoxicity and genotoxicity. Arch. Oral Biol. 2017, 82, 271–279. [Google Scholar] [CrossRef] [Scilit]
- Di Vito, M.; Cacaci, M.; Barbanti, L.; Martini, C.; Sanguinetti, M.; Benvenuti, S.; Tosi, G.; Fiorentini, L.; Scozzoli, M.; Bugli, F.; et al. Origanum vulgare Essential Oil vs. a Commercial Mixture of Essential Oils: In Vitro Effectiveness on Salmonella spp. from Poultry and Swine Intensive Livestock. Antibiotics 2020, 9, 763. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reichling, J.; Schnitzler, P.; Suschke, U.; Saller, R. Essential Oils of Aromatic Plants with Antibacterial, Antifungal, Antiviral, and Cytotoxic Properties—An Overview. Forsch Komplementmed 2009, 16, 79–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassan, F.; Awad, A. Impact of thyme powder (Thymus vulgaris L.) supplementation on gene expression profiles of cytokines and economic efficiency of broiler diets. Environ. Sci. Pollut. Res. 2017, 24, 15816–15826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, Z.; Zhang, S.; Wang, H.; Piao, X. Essential oil and aromatic plants as feed additives in non-ruminant nutrition: A review. J. Anim. Sci. Biotechnol. 2015, 6, 7. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Zhang, L.-L.; Xu, J.-G. Antioxidant, DNA damage protective, antibacterial activities and nitrite scavenging ability of essential oil of Amomum kravanh from China. Nat. Prod. Res. 2021, 35, 5415–5419. [Google Scholar] [CrossRef] [Scilit]
- Shi, S.; Qi, Z.; Jiang, W.; Quan, S.; Sheng, T.; Tu, J.; Shao, Y.; Qi, K. Effects of probiotics on cecal microbiome profile altered by duck Escherichia coli 17 infection in Cherry Valley ducks. Microb. Pathog. 2020, 138, 103849. [Google Scholar] [CrossRef] [Scilit]
- Celi, P.; Cowieson, A.; Fru-Nji, F.; Steinert, R.; Kluenter, A.-M.; Verlhac, V. Gastrointestinal functionality in animal nutrition and health: New opportunities for sustainable animal production. Anim. Feed. Sci. Technol. 2017, 234, 88–100. [Google Scholar] [CrossRef] [Scilit]
- Li, A.; Ni, W.; Zhang, Q.; Li, Y.; Zhang, X.; Wu, H.; Du, P.; Hou, J.; Zhang, Y. Effect of cinnamon essential oil on gut microbiota in the mouse model of dextran sodium sulfate-induced colitis. Microbiol. Immunol. 2020, 64, 23–32. [Google Scholar] [CrossRef] [Scilit]
- Zhai, H.; Liu, H.; Wang, S.; Wu, J.; Kluenter, A.-M. Potential of essential oils for poultry and pigs. Anim. Nutr. 2018, 4, 179–186. [Google Scholar] [CrossRef] [Scilit]
- Franz, C.; Baser, K.; Windisch, W. Essential oils and aromatic plants in animal feeding–a European perspective. A review. Flavour Fragr. J. 2010, 25, 327–340. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Liu, R.; Qi, C.; Li, W.; Rifky, M.; Zhang, M.; Xiao, P.; Wu, T.; Sui, W. Mixing Oil-Based Microencapsulation of Garlic Essential Oil: Impact of Incorporating Three Commercial Vegetable Oils on the Stability of Emulsions. Foods 2021, 10, 1637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Júnior, O.T.; Kuhn, F.; Padilha, P.J.M.; Vicente, L.R.M.; Costa, S.W.; Boligon, A.A.; Scapinello, J.; Nesi, C.N.; Magro, J.D.; Castellví, S.L. Microencapsulation of essential thyme oil by spray drying and its antimicrobial evaluation against Vibrio alginolyticus and Vibrio parahaemolyticus. Braz. J. Biol. 2018, 78, 311–317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manobhavan, M.; Elangovan, A.V.; Sridhar, M.; Shet, D.; Ajith, S.; Pal, D.T.; Gowda, N. Effect of super dosing of phytase on growth performance, ileal digestibility and bone characteristics in broilers fed corn-soy-based diets. J. Anim. Physiol. Anim. Nutr. 2016, 100, 93–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shang, Y.; Regassa, A.; Kim, J.H.; Kim, W.K. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci. 2015, 94, 2887–2897. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Liu, L.; Long, S.; Pan, L.; Piao, X. Effect of organic acids and essential oils on performance, intestinal health and digestive enzyme activities of weaned pigs. Anim. Feed Sci. Technol. 2018, 235, 110–119. [Google Scholar] [CrossRef] [Scilit]
- Fouad, A.M.; Ruan, D.; Wang, S.; Chen, W.; Xia, W.; Zheng, C. Nutritional requirements of meat-type and egg-type ducks: What do we know? J. Anim. Sci. Biotechnol. 2018, 9, 1. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Kuczynski, J.; Stombaugh, J.; Walters, W.A.; Gonzalez, A.H.; Caporaso, J.G.; Knight, R. Using QIIME to Analyze 16S rRNA Gene Sequences from Microbial Communities. Curr. Protoc. Microbiol 2012, 1, Unit-1E.5. [Google Scholar] [CrossRef] [Scilit]
- Peng, Q.; Li, J.; Li, Z.; Duan, Z.; Wu, Y. Effects of dietary supplementation with oregano essential oil on growth performance, carcass traits and jejunal morphology in broiler chickens. Anim. Feed. Sci. Technol. 2016, 214, 148–153. [Google Scholar] [CrossRef] [Scilit]
- Mohiti-Asli, M.; Ghanaatparast-Rashti, M. Comparing the effects of a combined phytogenic feed additive with an individual essential oil of oregano on intestinal morphology and microflora in broilers. J. Appl. Anim. Res. 2018, 46, 184–189. [Google Scholar] [CrossRef] [Scilit]
- Mohiti-Asli, M.; Ghanaatparast-Rashti, M. Comparison of the effect of two phytogenic compounds on growth performance and immune response of broilers. J. Appl. Anim. Res. 2017, 45, 603–608. [Google Scholar] [CrossRef] [Scilit]
- Ruan, D.; Fan, Q.; Fouad, A.M.; Sun, Y.; Huang, S.; Wu, A.; Lin, C.; Kuang, Z.; Zhang, C.; Jiang, S. Effects of dietary oregano essential oil supplementation on growth performance, intestinal antioxidative capacity, immunity, and intestinal microbiota in yellow-feathered chickens. J. Anim. Sci. 2021, 99, skab033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Youssef, I.M.I.; Männer, K.; Zentek, J. Effect of essential oils or saponins alone or in combination on productive performance, intestinal morphology and digestive enzymes’ activity of broiler chickens. J. Anim. Physiol. Anim. Nutr. 2021, 105, 99–107. [Google Scholar] [CrossRef] [Scilit]
- Park, J.H.; Kang, S.N.; Shin, D.; Shim, K.S. Antioxidant Enzyme Activity and Meat Quality of Meat Type Ducks Fed with Dried Oregano (Origanum vulgare L.) Powder. Asian-Australas. J. Anim. Sci. 2015, 28, 79–85. [Google Scholar] [CrossRef] [Scilit]
- Hashemipour, H.; Kermanshahi, H.; Golian, A.; Veldkamp, T. Effect of thymol and carvacrol feed supplementation on performance, antioxidant enzyme activities, fatty acid composition, digestive enzyme activities, and immune response in broiler chickens. Poult. Sci. 2013, 92, 2059–2069. [Google Scholar] [CrossRef] [Scilit]
- Abouelezz, K.; Abou-Hadied, M.; Yuan, J.; Elokil, A.A.; Wang, G.; Wang, S.; Wang, J.; Bian, G. Nutritional impacts of dietary oregano and Enviva essential oils on the performance, gut microbiota and blood biochemicals of growing ducks. Animal 2019, 13, 2216–2222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, F.; Shi, L.; Li, Y.; Ni, A.; Ma, H.; Sun, Y.; Chen, J. Effects of replacing dietary Aureomycin with a combination of plant essential oils on production performance and gastrointestinal health of broilers. Poult. Sci. 2020, 99, 4521–4529. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, T. Regulation of the intestinal barrier by nutrients: The role of tight junctions. Anim. Sci. J. 2020, 91, e13357. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Long, S.; Wang, J.; Gao, J.; Piao, X. Microencapsulated essential oils combined with organic acids improves immune antioxidant capacity and intestinal barrier function as well as modulates the hindgut microbial community in piglets. J. Anim. Sci. Biotechnol. 2022, 13, 16. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Song, M.; Yun, W.; Lee, J.; Lee, C.; Kwak, W.; Han, N.; Kim, H.; Cho, J. Effects of oral administration of different dosages of carvacrol essential oils on intestinal barrier function in broilers. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1257–1265. [Google Scholar] [CrossRef] [Scilit]
- Zhu, N.; Wang, J.; Yu, L.; Zhang, Q.; Chen, K.; Liu, B. Modulation of Growth Performance and Intestinal Microbiota in Chickens Fed Plant Extracts or Virginiamycin. Front. Microbiol. 2019, 10, 1333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, Y.; Hu, Y.; Yao, X.; He, Y.; Chen, J.; Wu, J.; Wu, S.; Zhang, H.; He, X.; Song, Z. Dietary essential oils improves the growth performance, antioxidant properties and intestinal permeability by inhibiting bacterial proliferation, and altering the gut microbiota of yellow-feather broilers. Poult. Sci. 2022, 101, 102087. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Y.; Xiang, Y.; Zhou, W.; Chen, J.; Li, K.; Yang, H. Microbial community mapping in intestinal tract of broiler chicken. Poult. Sci. 2017, 96, 1387–1393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tremaroli, V.; Bäckhed, F. Functional interactions between the gut microbiota and host metabolism. Nature 2012, 489, 242–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flint, H.J.; Duncan, S.H. Bacteroides and Prevotella. In Encyclopedia of Food Microbiology, 2nd ed.; Batt, C.A., Tortorello, M.L., Eds.; Academic Press: Cambridge, MA, USA, 2014; pp. 203–208. [Google Scholar] [CrossRef] [Scilit]




| Items | Day 1–21 | Day 22–42 |
|---|---|---|
| Ingredients (%) | ||
| Corn | 45.83 | 46.00 |
| Rice barn | 7.50 | 10.00 |
| Wheat meal | 12.00 | 10.00 |
| Wheat bran | 3.00 | 5.00 |
| Soybean meal | 15.70 | 6.20 |
| Corn gluten meal | 3.00 | 4.50 |
| Peanut meal | 2.50 | 2.50 |
| Soybean oil | 0.30 | 3.00 |
| DDGS | 5.50 | 8.00 |
| CaHPO4 | 0.72 | 0.75 |
| Limestone | 1.40 | 1.40 |
| Lysine | 0.05 | 0.15 |
| Premix 1 | 2.50 | 2.50 |
| Total | 100.00 | 100.00 |
| Calculated Values | ||
| Gross energy (MJ/kg) | 11.8 | 12.5 |
| Crude protein (%) | 19.50 | 18.50 |
| Calcium (%) | 0.85 | 0.75 |
| Available phosphorus (%) | 0.38 | 0.33 |
| Lysine | 1.20 | 1.15 |
| Methionine (%) | 0.60 | 0.40 |
| Methionine + Cystine (%) | 0.95 | 0.71 |
| Primer Name | Sequence (5′–3′) | Amlicon Size (bp) | Gene ID |
|---|---|---|---|
| β-actin | CAGCCAGCCATGGATGATGA | 137 | NM_205518.2 |
| ACCAACCATCACACCCTGAT | |||
| CLDN1 | CATACTCCTGGGTCTGGTTGGT | 100 | CP100563.1 |
| GACAGCCATCCGCATCTTCT | |||
| OCLN | ACGGCAGCACCTACCTCAA | 945 | CP100582.1 |
| GGGCGAAGAAGCAGATGAG | |||
| ZO-1 | CCACTGCCTACACCACCATCTC | 138 | CP100564.1 |
| CGTGTCACTGGGGTCCTTCAT |
| Items 1 | CON | ANT | HEO | LEO |
|---|---|---|---|---|
| D 1–21 | ||||
| ADFI, g/d | 79.43 ± 4.04 | 83.22 ± 1.13 | 85.93 ± 2.29 | 83.60 ± 3.38 |
| ADG, g/d | 51.39 ± 1.41 c | 55.60 ± 0.66 b | 60.31 ± 1.43 a | 56.27 ± 0.68 b |
| FCR | 1.53 ± 0.01 a | 1.50 ± 0.01 a | 1.43 ± 0.02 b | 1.49 ± 0.01 a |
| D 22–42 | ||||
| ADFI, g/d | 268.51 ± 2.36 | 268.57 ± 2.66 | 277.28 ± 4.39 | 267.54 ± 1.44 |
| ADG, g/d | 144.21 ± 0.49 | 145.71 ± 0.73 | 148.09 ± 1.12 | 144.50 ± 0.97 |
| FCR | 1.90 ± 0.03 | 1.87 ± 0.02 | 1.87 ± 0.03 | 1.89 ± 0.02 |
| D 1–42 | ||||
| ADFI, g/d | 171.66 ± 1.15 b | 173.64 ± 1.30 b | 179.12 ± 1.76 a | 174.30 ± 0.93 b |
| ADG, g/d | 96.67 ± 0.56 c | 99.56 ± 0.60 b | 102.27 ± 0.39 a | 99.31 ± 0.42 b |
| BW, kg | 4.01 ± 0.02 c | 4.13 ± 0.02 b | 4.24 ± 0.02 a | 4.12 ± 0.02 b |
| FCR | 1.82 ± 0.02 a | 1.77 ± 0.01 b | 1.76 ± 0.01 b | 1.79 ± 0.02 ab |
| Items | CON | ANT | HEO | LEO |
|---|---|---|---|---|
| GLU | 8.40 ± 0.27 | 8.71 ± 0.27 | 8.85 ± 0.07 | 9.05 ± 0.25 |
| TG | 0.84 ± 0.06 b | 0.79 ± 0.06 b | 0.72 ± 0.04 ab | 0.60 ± 0.04 a |
| CHOL | 5.52 ± 0.23 a | 5.63 ± 0.13 ab | 6.07 ± 0.17 b | 6.00 ± 0.10 ab |
| TP | 47.73 ± 1.14 | 49.61± 0.97 | 47.88 ± 0.8 | 47.91 ± 0.66 |
| BUN | 0.64 ± 0.03 | 0.66 ± 0.06 | 0.60 ± 0.05 | 0.71 ± 0.09 |
| ALT | 54.29 ± 3.26 | 52.13 ± 4.25 | 49.88 ± 1.91 | 51.14 ± 2.58 |
| AST | 19.29 ± 1.43 b | 18.88 ± 2.82 ab | 13.88 ± 1.27 a | 17.43 ± 0.78 ab |
| ALP | 33.71 ± 4.82 ab | 28.13 ± 2.67 a | 33.63 ± 1.81 ab | 38.71 ± 4.73 b |
| LDH | 411.71 ± 36.19 | 418.00 ± 48.84 | 370.00 ± 21.50 | 403.43 ± 26.69 |
| Phylum | ANT | CON | HEO | LEO |
|---|---|---|---|---|
| Firmicutes | 51.10 ± 13.70 | 55.43 ± 14.33 | 23.22 ± 3.05 ** | 27.33 ± 7.36 * |
| Bacteroidetes | 2.46 ± 1.72 | 3.53 ± 3.62 | 49.41 ± 3.47 ** | 47.23 ± 13.86 ** |
| Verrucomicrobia | 36.90 ± 16.24 | 24.25 ± 20.23 | 3.34 ± 4.52 | 10.61 ± 7.73 |
| Proteobacteria | 1.59 ± 0.44 | 2.38 ± 0.72 | 16.97 ± 4.75 ** | 10.70 ± 1.73 ** |
| Actinobacteria | 7.45 ± 8.19 | 13.86 ± 7.54 | 1.38 ± 1.56 * | 1.90 ± 3.11 * |
| Fusobacteria | 0.04 ± 0.05 | 0.006 ± 0.01 | 2.77 ± 3.21 * | 0.81 ± 0.63 |
| Deferribacteres | 0.11 ± 0.15 | 0.13 ± 0.14 | 1.67 ± 1.63 | 1.26 ± 1.17 |
| Unassigned | 0.24 ± 0.10 | 0.34 ± 0.19 | 0.12 ± 0.35 | 0.09 ± 0.05 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bao, H.; Xue, Y.; Zhang, Y.; Tu, F.; Wang, R.; Cao, Y.; Lin, Y. Encapsulated Essential Oils Improve the Growth Performance of Meat Ducks by Enhancing Intestinal Morphology, Barrier Function, Antioxidant Capacity and the Cecal Microbiota. Antioxidants 2023, 12, 253. https://doi.org/10.3390/antiox12020253
Bao H, Xue Y, Zhang Y, Tu F, Wang R, Cao Y, Lin Y. Encapsulated Essential Oils Improve the Growth Performance of Meat Ducks by Enhancing Intestinal Morphology, Barrier Function, Antioxidant Capacity and the Cecal Microbiota. Antioxidants. 2023; 12(2):253. https://doi.org/10.3390/antiox12020253
Chicago/Turabian StyleBao, Hongduo, Yongqiang Xue, Yingying Zhang, Feng Tu, Ran Wang, Yu Cao, and Yong Lin. 2023. "Encapsulated Essential Oils Improve the Growth Performance of Meat Ducks by Enhancing Intestinal Morphology, Barrier Function, Antioxidant Capacity and the Cecal Microbiota" Antioxidants 12, no. 2: 253. https://doi.org/10.3390/antiox12020253
APA StyleBao, H., Xue, Y., Zhang, Y., Tu, F., Wang, R., Cao, Y., & Lin, Y. (2023). Encapsulated Essential Oils Improve the Growth Performance of Meat Ducks by Enhancing Intestinal Morphology, Barrier Function, Antioxidant Capacity and the Cecal Microbiota. Antioxidants, 12(2), 253. https://doi.org/10.3390/antiox12020253
