Chlorogenic Acid Alleviated AFB1-Induced Hepatotoxicity by Regulating Mitochondrial Function, Activating Nrf2/HO-1, and Inhibiting Noncanonical NF-κB Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Determination of Lactate Dehydrogenase (LDH), Aspartate Aminotransferase (AST), and Alanine Aminotransferase (ALT) Activity
2.5. RNA-Seq Analysis
2.6. Oxidative Stress Analysis
2.7. Mitochondrial Membrane Potential Determination
2.8. Quantitative Real-Time PCR
2.9. Western Blotting
2.10. Molecular Docking of CGA with the KELCH-like ECH-Associated Protein1 (Keap-1)-Nrf2 Complex
2.11. Statistical Analyses
3. Results
3.1. CGA Attenuated AFB1-Induced L-02 Cell Cytotoxicity
3.2. RNA-Seq Analysis
3.3. CGA Alleviated AFB1-Induced Oxidative Damage by Activating Nrf2/Heme Oxygenase-1 (HO-1) Signaling Pathway in L-02 Cells
3.4. CGA Alleviated AFB1-Induced Inflammatory Response by Preventing Noncanonical Nuclear Factor Kappa-B (NF-κB) Pathway in L-02 Cells
3.5. CGA Alleviated AFB1-Induced Apoptosis in L-02 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Song, C.; Yang, J.; Wang, Y.; Ding, G.; Guo, L.; Qin, J. Mechanisms and transformed products of aflatoxin B1 degradation under multiple treatments: A review. Crit. Rev. Food Sci. Nutr. 2022, 1–13. [Google Scholar] [CrossRef]
- Zhu, Y.; Xu, Y.; Yang, Q. Antifungal properties and AFB(1) detoxification activity of a new strain of Lactobacillus plantarum. J. Hazard. Mater. 2021, 414, 125569. [Google Scholar] [CrossRef]
- Abdel-Daim, M.M.; Abdeen, A.; Jalouli, M.; Abdelkader, A.; Megahed, A.; Alkahtane, A.; Almeer, R.; Alhoshani, N.M.; Al-Johani, N.S.; Alkahtani, S.; et al. Fucoidan supplementation modulates hepato-renal oxidative stress and DNA damage induced by aflatoxin B1 intoxication in rats. Sci. Total Environ. 2021, 768, 144781. [Google Scholar] [CrossRef]
- Bodega, G.; Alique, M.; Puebla, L.; Carracedo, J.; Ramirez, R.M. Microvesicles: ROS scavengers and ROS producers. J. Extracell. Vesicles 2019, 8, 1626654. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, W. Aflatoxin B1 impairs mitochondrial functions, activates ROS generation, induces apoptosis and involves Nrf2 signal pathway in primary broiler hepatocytes. Anim. Sci. J. 2016, 87, 1490–1500. [Google Scholar] [CrossRef]
- Cheng, L.; Qin, Y.; Hu, X.; Ren, L.; Zhang, C.; Wang, X.; Wang, W.; Zhang, Z.; Hao, J.; Guo, M.; et al. Melatonin protects in vitro matured porcine oocytes from toxicity of Aflatoxin B1. J. Pineal Res. 2019, 66, e12543. [Google Scholar] [CrossRef]
- Xu, Q.; Shi, W.; Lv, P.; Meng, W.; Mao, G.; Gong, C.; Chen, Y.; Wei, Y.; He, X.; Zhao, J.; et al. Critical role of caveolin-1 in aflatoxin B1-induced hepatotoxicity via the regulation of oxidation and autophagy. Cell Death Dis. 2020, 11, 6. [Google Scholar] [CrossRef]
- Wu, B.; Mughal, M.J.; Fang, J.; Peng, X. The Protective Role of Selenium Against AFB(1)-Induced Liver Apoptosis by Death Receptor Pathway in Broilers. Biol. Trace Elem. Res. 2019, 191, 453–463. [Google Scholar] [CrossRef]
- Abdel-Hamid, A.A.; Firgany Ael, D. Vitamin E supplementation ameliorates aflatoxin B1-induced nephrotoxicity in rats. Acta Histochem. 2015, 117, 767–779. [Google Scholar] [CrossRef]
- Reddy, L.; Odhav, B.; Bhoola, K. Aflatoxin B1-induced toxicity in HepG2 cells inhibited by carotenoids: Morphology, apoptosis and DNA damage. Biol. Chem. 2006, 387, 87–93. [Google Scholar] [CrossRef]
- Choi, K.C.; Chung, W.T.; Kwon, J.K.; Yu, J.Y.; Jang, Y.S.; Park, S.M.; Lee, S.Y.; Lee, J.C. Inhibitory effects of quercetin on aflatoxin B1-induced hepatic damage in mice. Food Chem. Toxicol. 2010, 48, 2747–2753. [Google Scholar] [CrossRef]
- Li, Y.; Shi, W.; Li, Y.; Zhou, Y.; Hu, X.; Song, C.; Ma, H.; Wang, C.; Li, Y. Neuroprotective effects of chlorogenic acid against apoptosis of PC12 cells induced by methylmercury. Environ. Toxicol. Pharmacol. 2008, 26, 13–21. [Google Scholar] [CrossRef]
- Ali, N.; Rashid, S.; Nafees, S.; Hasan, S.K.; Shahid, A.; Majed, F.; Sultana, S. Protective effect of Chlorogenic acid against methotrexate induced oxidative stress, inflammation and apoptosis in rat liver: An experimental approach. Chem. Biol. Interact. 2017, 272, 80–91. [Google Scholar] [CrossRef]
- Liu, Y.J.; Zhou, C.Y.; Qiu, C.H.; Lu, X.M.; Wang, Y.T. Chlorogenic acid induced apoptosis and inhibition of proliferation in human acute promyelocytic leukemia HL-60 cells. Mol. Med. Rep. 2013, 8, 1106–1110. [Google Scholar] [CrossRef]
- Gong, W.; Li, J.; Zhu, G.; Wang, Y.; Zheng, G.; Kan, Q. Chlorogenic acid relieved oxidative stress injury in retinal ganglion cells through IncRNA-TUG1/Nrf2. Cell Cycle 2019, 18, 1549–1559. [Google Scholar] [CrossRef]
- Buko, V.; Zavodnik, I.; Budryn, G.; Zaklos-Szyda, M.; Belonovskaya, E.; Kirko, S.; Zyzelewicz, D.; Zakrzeska, A.; Bakunovich, A.; Rusin, V.; et al. Chlorogenic Acid Protects against Advanced Alcoholic Steatohepatitis in Rats via Modulation of Redox Homeostasis, Inflammation, and Lipogenesis. Nutrients 2021, 13, 4155. [Google Scholar] [CrossRef]
- Wang, X.; Fan, X.; Yuan, S.; Jiao, W.; Liu, B.; Cao, J.; Jiang, W. Chlorogenic acid protects against aluminium-induced cytotoxicity through chelation and antioxidant actions in primary hippocampal neuronal cells. Food Funct. 2017, 8, 2924–2934. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lennicke, C.; Cocheme, H.M. Redox metabolism: ROS as specific molecular regulators of cell signaling and function. Mol. Cell 2021, 81, 3691–3707. [Google Scholar] [CrossRef]
- Zhang, Q.; Liu, J.; Duan, H.; Li, R.; Peng, W.; Wu, C. Activation of Nrf2/HO-1 signaling: An important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J. Adv. Res. 2021, 34, 43–63. [Google Scholar] [CrossRef]
- Cohen, I.; Castedo, M.; Kroemer, G. Tantalizing Thanatos: Unexpected links in death pathways. Trends Cell Biol. 2002, 12, 293–295. [Google Scholar] [CrossRef]
- Bertheloot, D.; Latz, E.; Franklin, B.S. Necroptosis, pyroptosis and apoptosis: An intricate game of cell death. Cell Mol. Immunol. 2021, 18, 1106–1121. [Google Scholar] [CrossRef]
- Rushing, B.R.; Selim, M.I. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem. Toxicol. 2019, 124, 81–100. [Google Scholar] [CrossRef]
- Rong, X.; Sun-Waterhouse, D.; Wang, D.; Jiang, Y.; Li, F.; Chen, Y.; Zhao, S.; Li, D. The Significance of Regulatory MicroRNAs: Their Roles in Toxicodynamics of Mycotoxins and in the Protection Offered by Dietary Therapeutics Against Mycotoxin-Induced Toxicity. Compr. Rev. Food Sci. Food Saf. 2019, 18, 48–66. [Google Scholar] [CrossRef]
- Guo, Y.; Qin, X.; Tang, Y.; Ma, Q.; Zhang, J.; Zhao, L. CotA laccase, a novel aflatoxin oxidase from Bacillus licheniformis, transforms aflatoxin B(1) to aflatoxin Q(1) and epi-aflatoxin Q(1). Food Chem. 2020, 325, 126877. [Google Scholar] [CrossRef]
- Guo, Y.; Zhao, L.; Ma, Q.; Ji, C. Novel strategies for degradation of aflatoxins in food and feed: A review. Food Res. Int. 2021, 140, 109878. [Google Scholar] [CrossRef]
- Ma, J.; Liu, Y.; Guo, Y.; Ma, Q.; Ji, C.; Zhao, L. Transcriptional Profiling of Aflatoxin B1-Induced Oxidative Stress and Inflammatory Response in Macrophages. Toxins 2021, 13, 401. [Google Scholar] [CrossRef]
- Goiran, T.; Duplan, E.; Rouland, L.; El Manaa, W.; Lauritzen, I.; Dunys, J.; You, H.; Checler, F.; Alves da Costa, C. Nuclear p53-mediated repression of autophagy involves PINK1 transcriptional down-regulation. Cell Death Differ. 2018, 25, 873–884. [Google Scholar] [CrossRef]
- Mary, V.S.; Theumer, M.G.; Arias, S.L.; Rubinstein, H.R. Reactive oxygen species sources and biomolecular oxidative damage induced by aflatoxin B1 and fumonisin B1 in rat spleen mononuclear cells. Toxicology 2012, 302, 299–307. [Google Scholar] [CrossRef]
- Upadhyay, R.; Mohan Rao, L.J. An outlook on chlorogenic acids-occurrence, chemistry, technology, and biological activities. Crit. Rev. Food Sci. Nutr. 2013, 53, 968–984. [Google Scholar] [CrossRef]
- Xu, X.; Chang, J.; Wang, P.; Yin, Q.; Liu, C.; Li, M.; Song, A.; Zhu, Q.; Lu, F. Effect of chlorogenic acid on alleviating inflammation and apoptosis of IPEC-J2 cells induced by deoxyniyalenol. Ecotoxicol. Environ. Saf. 2020, 205, 111376. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef]
- Li, S.; Muhammad, I.; Yu, H.; Sun, X.; Zhang, X. Detection of Aflatoxin adducts as potential markers and the role of curcumin in alleviating AFB1-induced liver damage in chickens. Ecotoxicol. Environ. Saf. 2019, 176, 137–145. [Google Scholar] [CrossRef]
- Muhammad, I.; Wang, H.; Sun, X.; Wang, X.; Han, M.; Lu, Z.; Cheng, P.; Hussain, M.A.; Zhang, X. Dual Role of Dietary Curcumin Through Attenuating AFB(1)-Induced Oxidative Stress and Liver Injury via Modulating Liver Phase-I and Phase-II Enzymes Involved in AFB(1) Bioactivation and Detoxification. Front. Pharmacol. 2018, 9, 554. [Google Scholar] [CrossRef]
- Cho, Y.H.; Bahuguna, A.; Kim, H.H.; Kim, D.I.; Kim, H.J.; Yu, J.M.; Jung, H.G.; Jang, J.Y.; Kwak, J.H.; Park, G.H.; et al. Potential effect of compounds isolated from Coffea arabica against UV-B induced skin damage by protecting fibroblast cells. J. Photochem. Photobiol. B 2017, 174, 323–332. [Google Scholar] [CrossRef]
- Zhao, X.L.; Yu, L.; Zhang, S.D.; Ping, K.; Ni, H.Y.; Qin, X.Y.; Zhao, C.J.; Wang, W.; Efferth, T.; Fu, Y.J. Cryptochlorogenic acid attenuates LPS-induced inflammatory response and oxidative stress via upregulation of the Nrf2/HO-1 signaling pathway in RAW 264.7 macrophages. Int. Immunopharmacol. 2020, 83, 106436. [Google Scholar] [CrossRef]
- Kobayashi, E.H.; Suzuki, T.; Funayama, R.; Nagashima, T.; Hayashi, M.; Sekine, H.; Tanaka, N.; Moriguchi, T.; Motohashi, H.; Nakayama, K.; et al. Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription. Nat. Commun. 2016, 7, 11624. [Google Scholar] [CrossRef]
- Campbell, N.K.; Fitzgerald, H.K.; Dunne, A. Regulation of inflammation by the antioxidant haem oxygenase 1. Nat. Rev. Immunol. 2021, 21, 411–425. [Google Scholar] [CrossRef]
- Yin, X.; He, X.; Wu, L.; Yan, D.; Yan, S. Chlorogenic Acid, the Main Antioxidant in Coffee, Reduces Radiation-Induced Apoptosis and DNA Damage via NF-E2-Related Factor 2 (Nrf2) Activation in Hepatocellular Carcinoma. Oxid. Med. Cell Longev. 2022, 2022, 4566949. [Google Scholar] [CrossRef]
- Bao, L.; Li, J.; Zha, D.; Zhang, L.; Gao, P.; Yao, T.; Wu, X. Chlorogenic acid prevents diabetic nephropathy by inhibiting oxidative stress and inflammation through modulation of the Nrf2/HO-1 and NF-kB pathways. Int. Immunopharmacol. 2018, 54, 245–253. [Google Scholar] [CrossRef]
- Shi, A.; Shi, H.; Wang, Y.; Liu, X.; Cheng, Y.; Li, H.; Zhao, H.; Wang, S.; Dong, L. Activation of Nrf2 pathway and inhibition of NLRP3 inflammasome activation contribute to the protective effect of chlorogenic acid on acute liver injury. Int. Immunopharmacol. 2018, 54, 125–130. [Google Scholar] [CrossRef]
- McGarry, T.; Biniecka, M.; Veale, D.J.; Fearon, U. Hypoxia, oxidative stress and inflammation. Free Radic. Biol. Med. 2018, 125, 15–24. [Google Scholar] [CrossRef]
- He, Y.; Hwang, S.; Ahmed, Y.A.; Feng, D.; Li, N.; Ribeiro, M.; Lafdil, F.; Kisseleva, T.; Szabo, G.; Gao, B. Immunopathobiology and therapeutic targets related to cytokines in liver diseases. Cell Mol. Immunol. 2021, 18, 18–37. [Google Scholar] [CrossRef]
- Wu, K.; Jia, S.; Xue, D.; Rajput, S.A.; Liu, M.; Qi, D.; Wang, S. Dual effects of zearalenone on aflatoxin B1-induced liver and mammary gland toxicity in pregnant and lactating rats. Ecotoxicol. Environ. Saf. 2022, 245, 114115. [Google Scholar] [CrossRef]
- Vukelic, I.; Detel, D.; Pucar, L.B.; Potocnjak, I.; Buljevic, S.; Domitrovic, R. Chlorogenic acid ameliorates experimental colitis in mice by suppressing signaling pathways involved in inflammatory response and apoptosis. Food Chem. Toxicol. 2018, 121, 140–150. [Google Scholar] [CrossRef]
- Wang, D.; Tian, L.; Lv, H.; Pang, Z.; Li, D.; Yao, Z.; Wang, S. Chlorogenic acid prevents acute myocardial infarction in rats by reducing inflammatory damage and oxidative stress. Biomed. Pharmacother. 2020, 132, 110773. [Google Scholar] [CrossRef]
- Zhou, X.; Zhang, B.; Zhao, X.; Lin, Y.; Wang, J.; Wang, X.; Hu, N.; Wang, S. Chlorogenic acid supplementation ameliorates hyperuricemia, relieves renal inflammation, and modulates intestinal homeostasis. Food Funct. 2021, 12, 5637–5649. [Google Scholar] [CrossRef]
- Gray, C.M.; Remouchamps, C.; McCorkell, K.A.; Solt, L.A.; Dejardin, E.; Orange, J.S.; May, M.J. Noncanonical NF-kappaB signaling is limited by classical NF-kappaB activity. Sci. Signal 2014, 7, ra13. [Google Scholar] [CrossRef][Green Version]
- Sun, S.C. The noncanonical NF-kappaB pathway. Immunol. Rev. 2012, 246, 125–140. [Google Scholar] [CrossRef]
- Dougan, M.; Dranoff, G.; Dougan, S.K. GM-CSF, IL-3, and IL-5 Family of Cytokines: Regulators of Inflammation. Immunity 2019, 50, 796–811. [Google Scholar] [CrossRef]
- Topf, U.; Suppanz, I.; Samluk, L.; Wrobel, L.; Boser, A.; Sakowska, P.; Knapp, B.; Pietrzyk, M.K.; Chacinska, A.; Warscheid, B. Quantitative proteomics identifies redox switches for global translation modulation by mitochondrially produced reactive oxygen species. Nat. Commun. 2018, 9, 324. [Google Scholar] [CrossRef]
- Davinelli, S.; De Stefani, D.; De Vivo, I.; Scapagnini, G. Polyphenols as Caloric Restriction Mimetics Regulating Mitochondrial Biogenesis and Mitophagy. Trends Endocrinol. Metab. 2020, 31, 536–550. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, L.; Ruan, Z.; Mi, S.; Jiang, M.; Li, X.; Wu, X.; Deng, Z.; Yin, Y. Chlorogenic acid ameliorates intestinal mitochondrial injury by increasing antioxidant effects and activity of respiratory complexes. Biosci. Biotechnol. Biochem. 2016, 80, 962–971. [Google Scholar] [CrossRef]
- Lakhani, S.A.; Masud, A.; Kuida, K.; Porter, G.A., Jr.; Booth, C.J.; Mehal, W.Z.; Inayat, I.; Flavell, R.A. Caspases 3 and 7: Key mediators of mitochondrial events of apoptosis. Science 2006, 311, 847–851. [Google Scholar] [CrossRef]
- Dey, D.K.; Kang, S.C. Aflatoxin B1 induces reactive oxygen species-dependent caspase-mediated apoptosis in normal human cells, inhibits Allium cepa root cell division, and triggers inflammatory response in zebrafish larvae. Sci. Total Environ. 2020, 737, 139704. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Gene Accession Number |
---|---|---|---|
Caspase-3 | CCAAAGATCATACATGGAAGCG | CTGAATGTTTCCCTGAGGTTTG | XM_054350958.1 |
Caspase-8 | CAAACTTCACAGCATTAGGGAC | ATGTTACTGTGGTCCATGAGTT | NM_033355.4 |
Caspase-9 | TCCAGGAAGGTTTGAGGACC | CCCTTTCACCGAAACAGCAT | XM_011542273.4 |
Bax | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT | XM_047439168.1 |
Bcl-2 | GACTTCGCCGAGATGTCCAG | GAACTCAAAGAAGGCCACAATC | XM_054318967.1 |
GAPDH | CTCTGCTCCTCCTGTTCGAC | TTAAAAGCAGCCCTGGTGAC | NM_001357943.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Liu, T.; Koci, M.; Wang, Y.; Fu, Y.; Ma, M.; Ma, Q.; Zhao, L. Chlorogenic Acid Alleviated AFB1-Induced Hepatotoxicity by Regulating Mitochondrial Function, Activating Nrf2/HO-1, and Inhibiting Noncanonical NF-κB Signaling Pathway. Antioxidants 2023, 12, 2027. https://doi.org/10.3390/antiox12122027
Wang Q, Liu T, Koci M, Wang Y, Fu Y, Ma M, Ma Q, Zhao L. Chlorogenic Acid Alleviated AFB1-Induced Hepatotoxicity by Regulating Mitochondrial Function, Activating Nrf2/HO-1, and Inhibiting Noncanonical NF-κB Signaling Pathway. Antioxidants. 2023; 12(12):2027. https://doi.org/10.3390/antiox12122027
Chicago/Turabian StyleWang, Qianqian, Tianxu Liu, Matthew Koci, Yanan Wang, Yutong Fu, Mingxin Ma, Qiugang Ma, and Lihong Zhao. 2023. "Chlorogenic Acid Alleviated AFB1-Induced Hepatotoxicity by Regulating Mitochondrial Function, Activating Nrf2/HO-1, and Inhibiting Noncanonical NF-κB Signaling Pathway" Antioxidants 12, no. 12: 2027. https://doi.org/10.3390/antiox12122027
APA StyleWang, Q., Liu, T., Koci, M., Wang, Y., Fu, Y., Ma, M., Ma, Q., & Zhao, L. (2023). Chlorogenic Acid Alleviated AFB1-Induced Hepatotoxicity by Regulating Mitochondrial Function, Activating Nrf2/HO-1, and Inhibiting Noncanonical NF-κB Signaling Pathway. Antioxidants, 12(12), 2027. https://doi.org/10.3390/antiox12122027