Next Article in Journal
Phenolic Profile and Bioactivity Changes of Lotus Seedpod and Litchi Pericarp Procyanidins: Effect of Probiotic Bacteria Biotransformation
Previous Article in Journal
Amyloid β-Oligomers Inhibit the Nuclear Ca2+ Signals and the Neuroprotective Gene Expression Induced by Gabazine in Hippocampal Neurons
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 11
10.3390/antiox12111973
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biogenic Selenium Nanoparticles Synthesized with Alginate Oligosaccharides Alleviate Heat Stress-Induced Oxidative Damage to Organs in Broilers through Activating Nrf2-Mediated Anti-Oxidation and Anti-Ferroptosis Pathways

by
Xue-Qing Ye
1,
Yan-Ru Zhu
2,
Yu-Ying Yang
1,
Sheng-Jian Qiu
1 and
Wen-Chao Liu
1,*
1
Department of Animal Science, College of Coastal Agricultural Sciences, Guangdong Ocean University, Zhanjiang 524088, China
2
Department of Animal Nutrition and Environmental Health, College of Animal Science and Technology, Northwest A&F University, Xi’an 712100, China
*
Author to whom correspondence should be addressed.
Antioxidants 2023, 12(11), 1973; https://doi.org/10.3390/antiox12111973
Submission received: 6 October 2023 / Revised: 30 October 2023 / Accepted: 3 November 2023 / Published: 6 November 2023
Browse Figures
Versions Notes

Abstract

:
Selenium (Se) is an essential trace element for maintaining health due to its ideal antioxidant properties. We previously prepared a new type of biogenic selenium nanoparticles based on alginate oligosaccharides (SeNPs-AOS), and this study aimed to investigate the protective effects of SeNPs-AOS (Se particle size = 80 nm, Se content = 8%) on organ health in broilers challenged with HS. A total of 192 21-day-old Arbor Acres broilers were randomly divided into four groups according to a 2 × 2 experimental design, including a thermoneutral zone group (TN, raised under 23 ± 1.5 °C); TN + SeNPs-AOS group (TN group supplemented 5 mg/kg SeNPS-AOS); HS group (HS, raised under 33 ± 2 °C for 10 h/day); and HS + SeNPs-AOS group (HS group supplemented 5 mg/kg SeNPS-AOS). There were six replicates in each group (eight broilers per replicate). The results showed that SeNPs-AOS improved the splenic histomorphology, enhanced the activity of catalase (CAT) and glutathione peroxidase (GSH-Px) of the spleen, as well as upregulating the splenic mRNA expression of antioxidant-related genes in broilers under HS. In addition, SeNPs-AOS reversed the pathological changes in bursa caused by HS increased the activity of GST, GSH-Px, and CAT and upregulated the mRNA expression of Nrf2 and antioxidant-related genes in the bursa of heat-stressed broilers. In addition, dietary SeNPs-AOS improved the hepatic damage, increased the activity of GSH-Px in the liver, and upregulated the mRNA expression of antioxidant-related genes while downregulating the Keap1 gene expression of the liver in broilers during HS. Moreover, dietary SeNPs-AOS upregulated the anti-ferroptosis-related genes expression of liver in broilers under HS. In conclusion, dietary SeNPs-AOS could relieve HS-induced oxidative damage to the spleen, bursa of Fabricius and liver in broilers by upregulating the Nrf2-mediated antioxidant gene expression and SeNPs-AOS could also upregulate the expression of hepatic Nrf2-related anti-ferroptosis genes in heat-stressed broilers. These findings are beneficial for the development of new nano-antioxidants in broilers.

1. Introduction

With the rise of global temperature and high-density feeding, heat stress (HS) has become the primary environmental stressor in broiler production, which has deleterious impacts on broiler productivity and health [1]. It is already clear that HS results in reduced feed intake, growth restriction, and metabolic disorders in broilers [2,3]. Meanwhile, multiple studies have found that HS-induced oxidative stress in organs, leading to organ injury and dysfunction, which is also an important reason for HS causing production losses in broilers [4,5,6]. The spleen and bursa of Fabricius are essential immune organs for broilers [7]. Besides, liver plays a pivotal role in digestion and metabolic homeostasis [8]. However, HS overproduces reactive oxygen species (ROS) and destroys the antioxidant system, which causes oxidative damage to organs [9]. It has been suggested that HS resulted in atrophy of spleen and bursa, and varying degrees damage of liver, which could be attributed to oxidative stress [10,11]. Furthermore, ferroptosis is commonly accompanied by oxidative stress, and it is an important manifestation of organ oxidative damage [12,13]. Glutathione is crucial for regulating ferroptosis, and the liver is the main biosynthesis factory for glutathione [14]. Therefore, oxidative stress is a key factor that causes organ injuries in broilers subjected to HS, and hepatocytes are more prone to ferroptosis under oxidative stress.
Selenium (Se) is one of the essential trace elements for maintaining normal physiological functions [15]. As a trace element with antioxidant effects, Se plays an indispensable role in the redox balance [16]. Studies have shown that dietary Se deficiency reduced the expression of selenoprotein genes [17]. For instance, Se deficiency sharply decreased the expression of the GPX4 gene and induced oxidative stress in organs [18]. In addition, dietary Se deficiency has been reported to increase the risk of metabolic diseases, resulting in metabolic disorders in the body [19]. As a new form of Se supplement, selenium nanoparticles (SeNPs) can maximize the beneficial effects of Se because of its high surface activity and nanoscale effect [20]. Compared with inorganic selenium, SeNPs have a higher absorption rate, higher biological titer, and lower biological toxicity [15]. Moreover, SeNPs are cheaper and have a higher stability compared to organic selenium [21]. However, ordinary SeNPs are unstable in stored and easy to form precipitation, which affects their application in practice; biogenic SeNPs may be a strategy to improve this shortcoming [22]. It is interesting that, with the development of modern green nanobiotechnology, emerging studies have synthesized biogenic SeNPs based on natural polymers, and discovered their behaviors in protecting intestinal antioxidant system of animals [23]. In addition, biogenic SeNPs have been reported to activate the Nrf2-antioxidant pathway, effectively strengthening the antioxidant capacity and relieving the oxidative stress in organs [24].
Alginate oligosaccharides (AOS) are natural polymers from marine sources with various biological activities [25,26]. In our previous study, we synthesized a novel type of biogenic selenium nanoparticle using alginate oligosaccharides (SeNPs-AOS) and found that the Se particle size and the Se content are 80 nm and 8%, respectively. We hypothesized that the preparation of biogenic SeNPs with AOS possesses both Se and AOS bioactivity [27]. In addition, the SeNPs-AOS have a nano-size effect and can increase the bioavailability of Se, thereby improving the antioxidant properties. Also, in the earlier study, we found that SeNPs-AOS promoted the growth performance, such as average daily gain (ADG) of heat-stressed broilers at 22–28 days of age [27]. Unfortunately, no studies have been reported about the protective effects of biogenic SeNPs synthesized with AOS on organ health in animals under HS. Therefore, the present study aimed to evaluate whether SeNPs-AOS can alleviate HS-induced organ oxidative damage in broilers.

2. Materials and Methods

2.1. Synthesis of SeNPs-AOS

In our study, the synthesis of SeNPs-AOS used AOS as a polymer template, followed by the reduction of sodium selenite (Na2SeO3) by ascorbic acid (Vc). AOS was provided by Qingdao Bozhi Huili Biotechnology Co., Ltd. (Qingdao, China). Na2SeO3 was produced by SIGMA Co., Ltd. (Shanghai, China). Vc was provided by Xilong Science Co., Ltd. (Shantou, China). Based on the analysis results of high-performance liquid chromatography (HPLC), the oligosaccharides are mainly composed of glucosamine (GlcN), galacturonic acid (GalA), galactosamine (GalN), glucose (Glc), and galactose (Gal) and the molar percentages of the monosaccharides are GlcN: 19.29%, GalA: 4.95%, GalN: 13.91%, Glc: 5.11%, and Gal: 56.73%. We investigated the AOS concentration, reaction time, and temperature using an orthogonal test and found that when the AOS concentration was 400 mg/mL and the reaction was conducted for half an hour at 60 °C. The particle size of SeNPs-AOS was 80 nm determined using a scanning electron microscope (SEM), and the elemental characterization based on energy dispersive spectroscopy (EDS) showed that the Se content was 8% in the SeNPs-AOS [27].

2.2. Experimental Design, Birds, and Diet

A total of 192 21-day-old unsexed Arbor Acres broilers (CP group in Zhanjiang, Guangdong, China) with similar body weight were assigned to a 2 × 2 experimental design. These were as follows: the thermoneutral zone group (TN), thermoneutral zone + SeNPs-AOS group (TN + 5 mg/kg SeNPs-AOS), heat stress group (HS), and heat stress + SeNPs-AOS group (HS + 5 mg/kg SeNPs-AOS). The experimental groups had six replicates of eight chickens per replicate (48 birds/group) and maintained for 21 days of experimentation. The ambient temperature of the TN groups was maintained at 23 ± 1.5 °C. The ambient temperature of the HS groups from 8:00 a.m. to 6:00 p.m. was maintained at 33 ± 2 °C, and the rest time was the same as TN groups. Humidity was maintained between 60–75% in all treatment groups. The basal diet was prepared according to NRC (1994). Broilers in TN and HS groups were fed the basal diet, while broilers in the additive groups were fed basal diet contained 5 mg/kg SeNPs-AOS. The content of selenium in the diet of the control group was 0.282 mg/kg, and supplementation SeNPs-AOS group was 0.696 mg/kg. Basal diet and nutrient composition are presented in Table 1.

2.3. Sample Collection

At the end of feeding experiment (42-day old), one broiler was randomly selected from each replicate for neck bloodletting until death (n = 6/treatment). Broilers were individually weighed, and collected for spleen, bursa of Fabricius and liver. Then, samples in each group were placed in an enzyme-free tube with 4% formaldehyde solution and stored at room temperature for the preparation of tissue sections. In order to be used for subsequent antioxidant determination and gene expression analysis, the remaining samples were placed in a sterile frozen tube and quickly frozen with liquid nitrogen for further analysis.

2.4. Organs Index and Histological Analysis

Complete spleens, bursae of Fabricius, and livers were taken from the broilers, then weighed and recorded to calculate the organ index. The organ index of the spleens, bursae of Fabricius and livers were calculated using the following formula: = (organ weight (g)/body weight (g)) × 100%.
For histological analysis, the spleen, bursa of Fabricius and liver samples were fixed in 10% neutral-buffered formalin for 48 h. Then, the samples were stained with hematein and eosin (H&E) by Wuhan Sevier Biotechnology Co., LTD. (Wuhan, China). At last, the slides were observed with a fluorescence microscope (GD-30REL) under 200× and 400× magnification. The image was collected by the CapStudio software (Version No. 3.8.6).

2.5. Antioxidant Parameters

The kits were purchased from the Nanjing Jiancheng Institute of Biological Engineering (Nanjing, China), and the activities of catalase (CAT), glutathione peroxidase (GSH-Px), glutathione S-transferase (GST), total superoxide dismutase (T-SOD), the levels of malondialdehyde (MDA) and total antioxidant capacity (T-AOC) were determined using the corresponding kits following the specification. The units used for the antioxidant parameters are as follows: CAT; U/mg prot, GSH-Px; U/mg prot, GST; U/mg prot, T-SOD; U/mg prot, MDA; nmol/mg prot, T-AOC; and mmol/mg prot. In particular, the “U/mg prot” in CAT represents the amount of H2O2 broken down by 1 umol per second per mg of protein, the “U” in T-SOD is a SOD activity unit, which is the amount of SOD per mg of protein when the SOD inhibition rate reaches 50% in 1 mL of reaction solution, and the “mmol/g prot” in T-AOC indicates that when a sample at a certain concentration has the same inhibition rate as Trolox, divide the molar concentration of Trolox at that concentration by the protein concentration of the samples. The units used are the same as previous studies [28,29].

2.6. Quantitative Real-Time PCR Analysis

The total RNA was extracted from spleen, bursa of Fabricius and liver using 1 mL RNA lysate (Trizol reagent) followed the manufacturer’s instructions. Then, the total RNA was reversed into complementary DNA (cDNA) by referring to the reverse transcription kit instructions of Novizan (Nanjing, China). After the reaction, it can be directly used for quantification or stored in the refrigerator at −20 °C.
According to the mRNA sequences of chicken selenoproteins, antioxidant-related genes and ferroptosis-related genes in NCBI Gene bank. The primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd. (Shanghai, China). Previous studies have found that the expression of β-actin in different tissues of broilers is relatively stable [30], therefore, real-time quantitative PCR used β-actin as the internal reference gene. The 2−ΔΔCT method was used to calculate the relative expression of the target gene. The qPCR instrument used was from Bio-Rad (Watford, UK). The sequence information of the primer is detailed in Table 2.

2.7. Statistical Analysis

Data were analyzed by 2 × 2 analysis of variance (ANOVA) using the general linear model (GLM) program from the SAS 9.4 software, and multiple comparisons were made using Tukey’s test. In this case, p < 0.05 indicates a significant difference, and 0.05 ≤ p < 0.10 indicates that it tends to be significant.

3. Results

3.1. Spleen Index and Histological Analysis

As shown in Figure 1A, HS reduced the spleen index (p < 0.01). The supplementation of SeNPs-AOS had no effect on spleen index in broilers under HS (p > 0.05). The spleen histological analysis (Figure 2) showed that HS decreased the number of spleen white pulps and had mutual fusion, increased the number of red pulps, and accompanied by a small number of inflammatory cells. Compared with the HS group, supplementation of SeNPs-AOS reduced spleen bleeding and a mass of red pulps.

3.2. Antioxidant Capacity and Relative mRNA Expression of Selenoprotein and Antioxidant-Related Genes in Spleen

As depicted in Table 3, HS decreased the T-AOC (p < 0.05) level in the spleen, whereas increased MDA (p < 0.05) content was detected. Compared with the HS group, dietary SeNPs-AOS improved the activities of CAT (p < 0.001) and GSH-Px (p < 0.05) in the spleen. Results of the relative mRNA expression levels of selenoprotein and antioxidant-related genes are illustrated in Figure 3. The relative mRNA expression levels of selenoprotein W (SELENOW), SEPP1, masculoaponeurotic fibrosarcoma K (MafK), CAT, SOD1, SOD2, and NAD (P)H: quinone oxidoreductase 1 (NQO1) genes in TN + SeNPs-AOS group were higher than TN group (p < 0.05). HS decreased SELENOW, SEPP1, MafK, CAT, GSTA3, GPX1, and nuclear factor (erythroid-derived-2)-like 2 (Nrf2) mRNA relative expression levels (p < 0.05). Compared with the HS group, supplementation of SeNPs-AOS increased the relative mRNA expression levels of the SELENOW, SEPP1, MafG, MafK, CAT, SOD1, GPX3, NQO1, GSTA3, GPX1, and Nrf2 genes (p < 0.05).

3.3. Bursa of Fabricius Index and Histological Analysis

As presented in Figure 1B, HS and SeNPs-AOS supplementation had no significant effect on the bursa index (p > 0.05). As shown in Figure 4, HS caused the boundary between the medulla and cortex in the bursa to be blurred compared to the TN group. In addition, in the HS group the number of lymphocytes decreased and the volume reduced in the bursa and a large number of vacuoles appeared in the tissue. However, the supplementation of SeNPs-AOS decreased the number of hollow vesicles in the bursa increased the number of lymphocytes and arrangement relatively tightened.

3.4. Antioxidant Capacity and Relative mRNA Expression of Selenoprotein and Antioxidant-Related Genes in Bursa of Fabricius

The effects of dietary SeNPs-AOS on the antioxidant capacity of heat-stressed broilers are presented in Table 4. The activities of GST, GSH-Px, T-SOD and the level of T-AOC (p < 0.05) were decreased, and the content of MDA (p < 0.001) was increased by HS. Compared to the HS group, the supplementation of SeNPs-AOS increased the activities of GST, GSH-Px, CAT, and the level of T-AOC (p < 0.05) and declined the content of MDA (p < 0.001). Figure 5 shows the results of genes expression in bursa. The relative mRNA expression levels of SEPP1, MafK, CAT, GSTT1, GSTA3, GPX1, Nrf2, and HO-1 in TN + SeNPs-AOS group were higher than TN group (p < 0.05). The expression of SELENOK, SELENOS, SEPP1, MafF, MafG, CAT, SOD1, GPX3, GSTO1, NQO1, GSTA3, and Nrf2 genes were decreased by HS (p < 0.05), and the mRNA relative expression level of Kelch-like ECH-associated protein 1 (Keap1) was increased by HS (p < 0.05). Compared to the HS group, dietary SeNPs-AOS improved the relative mRNA expression levels of SEPP1, MafG, SOD1, GSTT1, and Nrf2 (p < 0.05) and decreased the relative mRNA expression level of Keap1 (p < 0.05).

3.5. Liver Index and Histological Analysis

As indicated in Figure 1C, broilers in HS groups had reduced the relative weight of the liver (p < 0.05). As shown in Figure 6, histological analysis of the liver showed that there were no pathological changes in the TN group. HS caused liver cells to swell and balloon, and some liver cells had inflammatory cell infiltration. In contrast, compared with the HS group, SeNPs-AOS supplementation could improve the pathological conditions of liver cell necrosis and swelling.

3.6. Antioxidant Capacity and Relative mRNA Expression of Selenoprotein and Antioxidant-Related Genes in Liver

The results of hepatic antioxidant performance in broilers are presented in Table 5. HS decreased the activity of GSH-Px but increased the content of MDA (p < 0.001), whereas supplementation of SeNPs-AOS improved the activities of GSH-Px and GST and decreased the content of MDA (p < 0.05). As shown in Figure 7, the relative mRNA expression levels of SELENOT, MafK, MafG, SOD1, SOD2, and GSTA3 in TN + SeNPs-AOS group were higher than TN group (p < 0.05). HS reduced the relative mRNA expression of SELENOT, GSTT1, Nrf2, and GPX1 genes (p < 0.05), while dietary SeNPs-AOS upregulated the relative mRNA expression of SELENOS, SELENOT, SELENOW, SELENOP1, Nrf2, CAT, SOD1, SOD2, GSTA3, GPX1, GPX3, and GSTO1 (p < 0.05).

3.7. Relative mRNA Expression of Ferroptosis-Related Genes

As illustrated in Figure 8, HS downregulated the mRNA expression of GPX4, Texas emergency response team (TERT), solute carrier family 7 member 11 (SLC7A11), ferritin heavy polypeptide-1 (FTH1), and ferroportin 1 (Fpn1) (p < 0.05) and increased the mRNA expression of post-transcriptional gene silencing-2 (PTGS2) (p < 0.05). In contrast, the supplementation of SeNPs-AOS upregulated the mRNA expression levels of GPX4, TERT, SLC7A11, FTH1, and Fpn1 (p < 0.05).

4. Discussion

4.1. Effects of Dietary SeNPs-AOS Supplementation on the Spleen of Heat-Stressed Broilers

The spleen is an important peripheral immune organ for broilers. An increase in spleen weight represents an enhancement of splenic function, thereby enhancing the tolerance to oxidative damage [31]. It has been demonstrated that HS inhibited the development of the spleen and even caused the splenic damage [32]. As the HS time increases, an enema occurs in the spleen tissue [33]. The results of this study are consistent with previous studies, which found that HS decreased the relative weight of spleen and caused the spleen pulp to fuse together and the number of white pulps to decrease, whereas the number of red pulps were increased and accompanied by a small number of inflammatory cells in the spleen [34]. In our previous trial, supplementation with 5 mg/kg SeNPs-AOS had a significant anti-HS effect through in vivo experiment [27]. Interestingly, dietary 5 mg/kg SeNPs-AOS supplementation reduced spleen bleeding and a mass of red pulps, protected the normal morphological structure of the spleen. It has been reported that natural polymers play a key role in the formation and enhancement of the SeNPs stability, the AOS was used as the polymer template in this experiment, and the hydrogen bonds between AOS molecules were used to interact with the surface of SeNPs, which provides higher surface activity and reduction ability to the SeNPs, thereby Se could better exert its antioxidant capacity [35,36]. Alian et al. [37] suggested that SeNPs could not only increase the spleen index, but also improve the antioxidant status of broilers. Several studies have shown that dietary Se could alleviate injuries described histomorphologically that tissue lipid oxidation and inflammatory cell infiltration in heat-stressed broilers [38,39]. We speculated that the reason for improving this damage may be due to the combined antioxidant effect of AOS and Se. Also, the high surface activity and nanoscale effects enable biogenic SeNPs to have good organ protection efficiency [24], so we previously observed that SeNPs-AOS improved growth performance of heat-stressed broilers [27]. However, in the future, further determinations of inflammatory cytokine-related indicators should be conducted to better explain the role of SeNPs-AOS.
Free radicals produced by HS led to a suppression of antioxidant enzymes activity, thus destroying the structure and function of organs [40]. The antioxidant enzymes include CAT, SOD, GST, GSH-Px, etc. SOD is an important antioxidant enzyme in animals, which can clear the superoxide anion free radicals and protect cells from damaging [41,42]. T-AOC is a crucial parameter to evaluate the overall antioxidant status of cells [43]. Notably, Se usually plays its physiological role in the form of selenoproteins, the proteins synthesized using selenocysteines [44]. Relevant studies have shown that selenoproteins could drive the body’s biological reaction processes to enhance antioxidant ability in broilers [45,46]. Among them, it is worth noting that SELENOM participates in the synthesis of disulfide bonds, increases the activity of GSH-Px, and maintains redox homeostasis [47]. As we know, Nrf2 signaling pathway is the main antioxidant pathway, but Keap1 inhibits the expression of Nrf2 protein [48]. In addition, Nrf2 and Maf proteins can form dimers, which subsequently bind to Maf-recognizing elements, thereby inducing Maf proteins to encode antioxidant enzymes, and the relative expression of Nrf2 and Maf increased, the body’s antioxidant capacity is enhanced [49]. Consistent with previous reports, HS resulted in a decrease in the activity of antioxidant enzymes and the downregulation of Nrf2 and antioxidant-related genes in the spleen. It is interesting that SeNPs-AOS has exerted superior antioxidant effects in our study. The specific performances of SeNPs-AOS were the improved activities of CAT and GSH-Px, and the elevated mRNA expression of the SELENOW, SEPP1, MafG, MafK, CAT, SOD1, GPX3, NQO1, and Nrf2 genes. Similarly, earlier studies have shown that dietary supplementation of SeNPs effectively ameliorated the adverse effects of oxidative stress [50,51]. Hence, it is reasonable to speculate that SeNPs-AOS could activate the Nrf2 pathway to mitigate HS-induced oxidative damage in spleen.

4.2. Effects of Dietary SeNPs-AOS Supplementation on the Bursa of Heat-Stressed Broilers

The bursa is an immune organ unique to birds and it is pivotal for broilers [52]. The development of the bursa is closely related to lymphocytes. It has been documented that the destruction of lymphocytes leads to the deficiency of bursal function [53]. Numerous studies have shown that HS inhibited the production of antibodies while increasing the expression of inflammatory factor genes, resulting in a compromised immune system and an inhibition of antioxidant ability [54,55]. HS reduces the follicular area of the bursa vessel, the structure is loose and disordered, and vacuoles appear in the medulla [56]. Also, previous a study suggested that HS led to pathological changes, lymphocyte necrosis, cellular structure injury, and extensive infiltration of inflammatory cells in the bursa of broilers [57]. The above studies are in accordance with the present results, and we found that HS caused morphological lesions of bursa in broilers. Unfortunately, there was no statistical difference in the organ index of bursa of Fabricius in broilers under the conditions of this experiment. Liu et al. [57] and Hosseini et al. [58] also found that HS had no significant effect on the organ index of bursa of Fabricius in broilers. Furthermore, this study observed that SeNPs-AOS supplementation could improve the bursal damage of heat-stressed broilers, and the vacuolization phenomenon and inflammatory cell infiltration were reduced by SeNPs-AOS. Similarly, Sun et al. [59] indicated that organic Se sources promoted the expression of various selenoproteins and maintained the integrity of immune organs. However, there is lack of researches on the protective effect of biogenic SeNPs on poultry bursa currently, so direct comparison is incapable. Such beneficial roles of SeNPs-AOS may be associated with the regulation of antioxidant related selenoproteins synthesis in bursa. It should be noted that more research is needed on the expression of immune-related genes to further reveal the mechanism of SeNPs-AOS in alleviating HS-induced impairment of the bursa.
HS causes an imbalance between oxidation and antioxidant defense system, and leads to the body to produce a large amount of ROS, whereas excess ROS can damage cells and tissues, ultimately resulting in serious oxidative damage to organs [60]. The ability of scavenging free radicals is mainly determined by the activities of antioxidant enzymes such as GST, while the content of MDA reflects the degree of lipid peroxidation [61]. We found that HS led to low activities of antioxidant enzyme in bursa and reduced the expression of antioxidant-related genes, which indicated that the bursal damage was occurred by oxidative stress, this is similar to the results by Truong et al. [62] and Li et al. [63]. GSH-Px is known for the antioxidant function, while Se directly affects its activity [64]. In addition, Se exerts a variety of antioxidant functions by regulating the synthesis of multiple antioxidant enzymes and glutathione, and participates in antioxidant biological pathways in vivo [17]. Specifically, Se can be converted to hydrogen selenide for further Se-cystine synthesis, which provides cysteine to glutathione and allow it to exert its antioxidant function [65]. Past studies have revealed that selenoproteins could be involved in biological responses such as antioxidant, anti-inflammatory, etc. [46]. For instance, SELENOK reduces ROS activity in mouse cardiomyocytes and resists hydrogen peroxide (H2O2)-induced cytotoxicity [66]. Aligning with this, dietary SeNPs-AOS enhanced enzyme activities of GST, GSH-PX, and CAT possibly through promoting the synthesis of antioxidant selenoproteins, such as SEPP1 and GSTT1, thus easing the oxidative damage to the bursa caused by HS.

4.3. Effects of Dietary SeNPs-AOS Supplementation on the Liver of Heat-Stressed Broilers

The liver is a key metabolic organ, the abnormal liver index and histopathological changes result in hepatic dysfunction, which negatively affects nutrient metabolism and animal health [67]. Under HS conditions, pathological changes will occur in the liver, including cell necrosis and structure destruction, inflammatory cell infiltration, and lipid vacuolation [68,69]. It has been confirmed that the liver is more vulnerable to damage than other organs during HS [70]. Consistently, we found that HS reduced the relative weight and caused morphological damage of liver in broilers. Dietary antioxidants were reported to improve the liver function in broilers under HS [50]. Previous studies have also demonstrated that supplementation of SeMet could promote liver function [71]. It has been shown that dietary Se could reverse liver damage, and alleviated oxidative stress in hepatocytes via regulating Keap1/Nrf2 pathway [72]. In the present study, SeNPs-AOS supplementation relieved the pathological conditions of liver by reducing cell necrosis and swelling. Suggesting that dietary SeNPs-AOS is beneficial for the liver health of broilers raised in a thermal environment. In addition, we have previously found that dietary SeNPs-AOS could improve the growth performance of heat-stressed broilers, this may also be attributed to the relieving effect of SeNPs-AOS on liver injury [27].
To confirm the restorative effect of SeNPs-AOS on hepatic injury in heat-stressed broilers, we determined the antioxidant performance and expression of related signaling molecules in the liver. The current findings showed that HS reduced GSH-Px activity and increased MDA content, and downregulated the expression of SELENOT, GSTT1, GPX1 and HO-1 genes of liver. Actually, numerous studies have indicated that HS suppressed the antioxidant enzymes activities in liver and other organs [73,74]. Cao et al. [75] and Sahin et al. [76] found that HS resulted in a decline in mRNA expression level of Nrf2, SOD, GST, HO-1, etc. Conversely, previous studies showed that selenomethionine supplements enhanced the level of T-AOC and the ability of T-SOD in H2O2-induced liver damage model [77]. Wan et al. [78] verified that selenomethionine could improve the glutathione system to enhance the antioxidant capacity of liver. It’s worth noting that, in this study, dietary SeNPs-AOS improved the antioxidant enzymes activities and upregulated the mRNA expression levels of SELENOS, SELENOT, SELENOW, SELENOP1, GPX3, GSTO1, MafK, CAT, SOD1, SOD2, GSTT1, GSTA3, GPX1, HO-1, and Nrf2 genes in liver of heat-stressed broilers. This is consistent with previous literature that supplementation of Se could upregulate the mRNA levels of Nrf2 and its downstream genes (NQO1 and HO-1) to mitigate oxidative stress caused by excess H2O2 [79]. Meanwhile, we noticed that oligosaccharides also have antioxidant functions. Unsurprisingly, Liu et al. [28] found that oligosaccharides could act as free radical scavenger according to their chemical structure, and exert antioxidant function. Therefore, Se and AOS may both contribute to SeNPs-AOS in alleviating hepatic oxidative stress, and, unlike traditional forms of selenium, its unique nanoscale effect may enhance the protective effect.
Ferroptosis is caused by a large accumulation of lipid peroxides, which is also an important adverse consequence of oxidative stress and can exacerbate organ damage [80]. Wei et al. [81] have demonstrated that ferroptosis usually occurs in hepatocytes under oxidative conditions, because oxidative stress inhibited the expression of anti-ferroptosis genes, thus inducing more severe hepatic damage. In this study, HS decreased the mRNA expression of GPX4 and SLC7A11, and increased the expression of PTGS2 gene, which is consistent with previous studies [82]. It is well known that GPX4 is one of the key regulators of ferroptosis, and when GPX4 is inactivated, it triggers the accumulation of lipid peroxides [83]. SLC7A11 is one of the most critical upstream regulators of ferroptosis and able to enhance the anti-ferroptosis activity of GPX4, and Nrf2 can bind to the promoter regions of GPX4 and SLC7A11 to relieve ferroptosis [84]. Moreover, FTH1 and TERT protect cells from the effects of GPX4 inhibitors. As an iron transporter, Fpn1 can alleviate ferroptosis by reducing the excessive accumulation of Fe2+ in the cells [85]. Previously, Zhao et al. [86] have shown that supplementation of Se reduced ferroptosis in heart cells. It has been found that dietary Se could activate the Nrf2/SLC7A11/GPX4 signaling pathway to suppress ferroptosis [87,88]. Similarly, as shown in present study, dietary SeNPs-AOS upregulated the relative mRNA expression levels of GPX4, SLC7A11, TERT, FTH1, and Fpn1 in the liver of broilers under HS. Indicating that SeNPs-AOS could not only alleviate hepatic oxidative stress through Nrf2-mediated antioxidant pathway, but also upregulate the expression of anti-ferroptosis molecules that related to Nrf2/SLC7A11/GPX4 and transferrin pathways. However, this experimental bottleneck is that it has neither Prussian blue staining with tissues nor intracellular iron accumulation trial, so the anti-ferroptosis effect of SeNPs-AOS is still needed further research and verification.

5. Conclusions

In summary, we prepared the biogenic SeNPs-AOS to have good antioxidant activity in broilers, which was specifically manifested in alleviating oxidative damage of organs caused by HS, upregulating the expression of antioxidant-related genes and downregulating the expression of keap1 gene, this is association with the activation of Nrf2 signaling pathway and the promotion of selenoproteins synthesis. At the same time, dietary SeNPs-AOS could upregulate the expression of anti-ferroptosis related genes belonging to Nrf2/SLC7A11/GPX4 and transferrin pathways. These findings not only provide a foundation for further reference on the anti-HS of biogenic SeNPs in broilers, but also offer novel insights into studying SeNPs-AOS as a new type of antioxidants to protect organs from oxidative damage.

Author Contributions

Conceptualization, X.-Q.Y. and W.-C.L.; methodology, X.-Q.Y., Y.-R.Z., Y.-Y.Y. and S.-J.Q.; formal analysis, X.-Q.Y., Y.-R.Z. and Y.-Y.Y.; data curation, X.-Q.Y.; writing—original draft preparation, X.-Q.Y.; writing—review and editing, W.-C.L.; supervision, W.-C.L.; project administration, W.-C.L.; funding acquisition, W.-C.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Natural Science Foundation of Guangdong Province of China (2022A1515010496).

Institutional Review Board Statement

The animal care, feeding and sampling procedures of the present animal study were approved by Department of Animal Science of Guangdong Ocean University (Approve no. 20211213).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, X.L.; Zeng, Y.B.; Liu, L.X. Effects of dietary chromium propionate on laying performance, egg quality, serum biochemical parameters and antioxidant status of laying ducks under heat stress. Animal 2021, 15, 100081. [Google Scholar] [CrossRef] [PubMed]
  2. Liu, Y.; Liu, Z.; Xing, T.; Li, J.; Zhang, L.; Zhao, L.; Gao, F. Effect of chronic heat stress on the carbonylation of glycolytic enzymes in breast muscle and its correlation with the growth performance of broilers. Poult. Sci. 2023, 102, 103103. [Google Scholar] [CrossRef] [PubMed]
  3. Zhao, Y.; Wang, H.; Wang, H.; Liu, H.; Zhang, Y.; Zhang, J.; Pi, Y.; Yang, P.; Wang, Q. Sulfide causes histological damage, oxidative stress, metabolic disorders and gut microbiota dysbiosis in juvenile sea cucumber Apostichopus japonicus Selenka. Aquat. Toxicol. 2023, 258, 106439. [Google Scholar] [CrossRef] [PubMed]
  4. Liu, H.-S.; Zhou, M.-Y.; Zhang, X.; Li, Y.-L.; Kong, J.-W.; Gao, X.; Ge, D.-Y.; Liu, J.-J.; Ma, P.-G.; Peng, G.-Y.; et al. Sagittaria sagittifolia polysaccharide protects against six-heavy-metal-induced hepatic injury associated with the activation of Nrf2 pathway to regulate oxidative stress and apoptosis. J. Inorg. Biochem. 2022, 232, 111810. [Google Scholar] [CrossRef] [PubMed]
  5. Qin, Q.; Li, Z.; Zhang, M. Effects of melittin on production performance, antioxidant function, immune function, heat shock protein, intestinal morphology, and cecal microbiota in heat-stressed quails. Poult. Sci. 2023, 102, 102713. [Google Scholar] [CrossRef] [PubMed]
  6. Majdeddin, M.; Braun, U.; Lemme, A. Effects of feeding guanidinoacetic acid on oxidative status and creatine metabolism in broilers subjected to chronic cyclic heat stress in the finisher phase. Poult. Sci. 2023, 102, 102653. [Google Scholar] [CrossRef]
  7. Guo, Y.; Balasubramanian, B.; Zhao, Z.H. Marine algal polysaccharides alleviate aflatoxin B1-induced bursa of Fabricius injury by regulating redox and apoptotic signaling pathway in broilers. Poult. Sci. 2021, 100, 844–857. [Google Scholar] [CrossRef] [PubMed]
  8. Gao, X.; Yuaner, Z.; Shuqiang, L.; Shuling, W. Acute stress show great influences on liver function and the expression of hepatic genes associated with lipid metabolism in rats. Lipids Health Dis. 2013, 12, 118. [Google Scholar] [CrossRef] [PubMed]
  9. Belhadj Slimen, I.; Najar, T.; Ghram, A.; Abdrrabba, M. Heat stress effects on livestock: Molecular, cellular and metabolic aspects, a review. J. Anim. Physiol. Anim. Nutr. 2016, 100, 401–412. [Google Scholar] [CrossRef] [PubMed]
  10. Emami, N.K.; Jung, U.; Voy, B.; Dridi, S. Radical Response: Effects of Heat Stress-Induced Oxidative Stress on Lipid Metabolism in the Avian Liver. Antioxidants 2020, 10, 35. [Google Scholar] [CrossRef] [PubMed]
  11. Ohtsu, H.; Yamazaki, M.; Abe, H.; Murakami, H.; Toyomizu, M. Heat Stress Modulates Cytokine Gene Expression in the Spleen of Broiler Chickens. J. Poult. Sci. 2015, 52, 282–287. [Google Scholar] [CrossRef]
  12. Liu, Y.; Wan, Y.; Jiang, Y.; Zhang, L.; Cheng, W. GPX4: The hub of lipid oxidation, ferroptosis, disease and treatment. Biochim. Biophys. Acta Rev. Cancer 2023, 1878, 188890. [Google Scholar] [CrossRef]
  13. Li, D.; Pi, W.; Sun, Z.; Liu, X.; Jiang, J. Ferroptosis and its role in cardiomyopathy. Biomed. Pharmacother. 2022, 153, 113279. [Google Scholar] [CrossRef]
  14. Ookhtens, M.; Kaplowitz, N. Role of the Liver in Interorgan Homeostasis of Glutathione and Cyst(e)ine. Semin. Liver Dis. 1998, 18, 313–329. [Google Scholar] [CrossRef] [PubMed]
  15. Al-Quwaie, D.A. The influence of bacterial selenium nanoparticles biosynthesized by Bacillus subtilus DA20 on blood constituents, growth performance, carcass traits, and gut microbiota of broiler chickens. Poult. Sci. 2023, 102, 102848. [Google Scholar] [CrossRef] [PubMed]
  16. Bao, B.W.; Kang, Z.; Zhang, Y.; Li, K.; Xu, R.; Guo, M.Y. Selenium Deficiency Leads to Reduced Skeletal Muscle Cell Differentiation by Oxidative Stress in Mice. Biol. Trace Elem. Res. 2023, 201, 1878–1887. [Google Scholar] [CrossRef]
  17. Dalgaard, T.S.; Briens, M.; Engberg, R.M.; Lauridsen, C. The influence of selenium and selenoproteins on immune responses of poultry and pigs. Anim. Feed. Sci. Technol. 2018, 238, 73–83. [Google Scholar] [CrossRef]
  18. Zhao, L.; Feng, Y.; Deng, J.; Zhang, N.-Y.; Zhang, W.-P.; Liu, X.-L.; Rajput, S.A.; Qi, D.-S.; Sun, L.-H. Selenium Deficiency Aggravates Aflatoxin B1–Induced Immunotoxicity in Chick Spleen by Regulating 6 Selenoprotein Genes and Redox/Inflammation/Apoptotic Signaling. J. Nutr. 2019, 149, 894–901. [Google Scholar] [CrossRef]
  19. Rayman, M.P. Selenium and human health. Lancet 2012, 379, 1256–1268. [Google Scholar] [CrossRef] [PubMed]
  20. Devi, M.S.; Srinivasan, S.; Muthuvel, A. Selenium nanomaterial is a promising nanotechnology for biomedical and environmental remediation: A detailed review. Biocatal. Agric. Biotechnol. 2023, 51, 102766. [Google Scholar] [CrossRef]
  21. Kumar, A.; Prasad, K.S. Role of nano-selenium in health and environment. J. Biotechnol. 2021, 325, 152–163. [Google Scholar] [CrossRef]
  22. Song, D.; Cheng, Y.; Li, X.; Wang, F.; Lu, Z.; Xiao, X.; Wang, Y. Biogenic nano-selenium particles effectively attenuate oxidative stress-induced intestinal epithelial barrier injury by activating the Nrf2 antioxidant pathway. J. Anim. Sci. Biotechnol. 2017, 95, 20–21. [Google Scholar] [CrossRef]
  23. AbdEl-Kader, M.F.; El-Kassas, S.; Abd-Elghany, M.F.; Abo-Al-Ela, H.G.; El-Naggar, K.; Al Wakeel, R.A.; Zaki, A.G.; Grana, Y.S.; El-Saftawy, H.A.M. Dietary selenium nanoparticles positively modulate the growth and immunity of seabream (Sparus aurata) fingerlings exposed to low salinity stress and Vibrio parahaemolyticus challenge. Aquaculture 2023, 576, 739893. [Google Scholar] [CrossRef]
  24. Xiao, X.; Song, D.; Cheng, Y.; Hu, Y.; Wang, F.; Lu, Z.; Wang, Y. Biogenic nanoselenium particles activate Nrf2-ARE pathway by phosphorylating p38, ERK1-2, and AKT on IPEC-J2 cells. Cell Physiol. 2018, 234, 11227–11234. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, Y.; Ren, K.; Tan, J. Alginate oligosaccharide alleviates aging-related intestinal mucosal barrier dysfunction by blocking FGF1-mediated TLR4/NF-kappaB p65 pathway. Phytomedicine 2023, 116, 154806. [Google Scholar] [CrossRef]
  26. Lu, S.; Na, K.; Wei, J. Alginate oligosaccharides: The structure-function relationships and the directional preparation for application. Carbohydr. Polym. 2022, 284, 119225. [Google Scholar] [CrossRef]
  27. Qiu, S.J. Effects of Nanoselenium-Fucoidan Oligosaccharides on Growth Performance and Intestinal Mechanical Barrier in heat-Stressed Broilers. Master’s Thesis, Guangdong Ocean University, Zhanjiang, China, 2023. [Google Scholar]
  28. Liu, H.W.; Dong, X.F.; Tong, J.M.; Zhang, Q. Alfalfa polysaccharides improve the growth performance and antioxidant status of heat-stressed rabbits. Livest. Sci. 2010, 131, 88–93. [Google Scholar] [CrossRef]
  29. Won, S.Y.; Han, G.P.; Kwon, C.H.; Lee, E.C.; Kil, D.Y. Effect of individual or combination of dietary betaine and glycine on productive performance, stress response, liver health, and intestinal barrier function in broiler chickens raised under heat stress conditions. Poult. Sci. 2023, 102, 102771. [Google Scholar] [CrossRef]
  30. Liu, W.C.; Zhuang, D.P.; Zhao, Y.; Balamuralikrishnan, B.; Zhao, Z.H. Seaweed-Derived Polysaccharides Attenuate Heat Stress-Induced Splenic Oxidative Stress and Inflammatory Response via Regulating Nrf2 and NF-κB Signaling Pathways. Mar. Drugs 2022, 20, 358. [Google Scholar] [CrossRef]
  31. Bożena, K.; Stanisław, G.; Jarosław, K. Investigation of the immune effects of Scutellaria baicalensis on blood leukocytes and selected organs of the chicken’s lymphatic system. J. Anim. Sci. Biotechnol. 2017, 8, 22. [Google Scholar]
  32. Ahmed, B.M.S.; Younas, U.; Asar, T.O.; Monteiro, A.P.A.; Hayen, M.J.; Tao, S.; Dahl, G.E. Maternal heat stress reduces body and organ growth in calves: Relationship to immune status. JDS Commun. 2021, 2, 295–299. [Google Scholar] [CrossRef] [PubMed]
  33. Tang, L.-P.; Liu, Y.-L.; Ding, K.-N.; Hou, X.-J.; Qin, J.-J.; Zhang, Y.-A.; Liu, H.-X.; Shen, X.-L.; He, Y.-M. Chai Hu oral liquid enhances the immune functions of both spleen and bursa of Fabricius in heat-stressed broilers through strengthening TLR4-TBK1 signaling pathway. Poult. Sci. 2021, 100, 101302. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, C.; Kaikai, C.; Xiaohui, Z. Protective effects of resveratrol against high ambient temperature-induced spleen dysplasia in broilers through modulating splenic redox status and apoptosis. J. Sci. Food Agric. 2018, 98, 5409–5417. [Google Scholar] [CrossRef]
  35. Jha, N.; Esakkiraj, P.; Annamalai, A.; Lakra, A.K.; Naik, S.; Arul, V. Synthesis, optimization, and physicochemical characterization of selenium nanoparticles from polysaccharide of mangrove Rhizophora mucronata with potential bioactivities. J. Trace Elem. Miner. 2022, 2, 100019. [Google Scholar] [CrossRef]
  36. Shi, X.D.; Tian, Y.Q.; Wu, J.L.; Wang, S.Y. Synthesis, characterization, and biological activity of selenium nanoparticles conjugated with polysaccharides. Crit. Rev. Food Sci. Nutr. 2020, 61, 2225–2236. [Google Scholar] [CrossRef] [PubMed]
  37. Alian, H.A.; Samy, H.M.; Ibrahim, M.T.; Mahmoud, M.M.A. Nanoselenium effect on growth performance, carcass traits, antioxidant activity, and immune status of broilers. Environ. Sci. Pollut. Res. Int. 2020, 27, 38607–38616. [Google Scholar] [CrossRef]
  38. Aderao, G.N.; Jadhav, S.E.; Pattanaik, A.K.; Gupta, S.K.; Ramakrishnan, S.; Lokesha, E.; Chaudhary, P.; Vaswani, S.; Singh, A.; Panigrahi, M.; et al. Dietary selenium levels modulates antioxidant, cytokine and immune response and selenoproteins mRNA expression in rats under heat stress condition. J. Trace Elem. Med. Biol. 2023, 75, 127105. [Google Scholar] [CrossRef]
  39. Wang, W.; Kang, R.; Liu, M.; Wang, Z.; Zhao, L.; Zhang, J.; Huang, S.; Ma, Q. Effects of Different Selenium Sources on the Laying Performance, Egg Quality, Antioxidant, and Immune Responses of Laying Hens under Normal and Cyclic High Temperatures. Animals 2022, 12, 1006. [Google Scholar] [CrossRef] [PubMed]
  40. Chen, S.; Liu, H.; Zhang, J.; Zhou, B.; He, X.; Wang, T.; Wang, C. Dietary rutin improves breast meat quality in heat-stressed broilers and protects mitochondria from oxidative attack via the AMPK/PINK1–Parkin pathway. J. Sci. Food Agric. 2023, 103, 2367–2377. [Google Scholar] [CrossRef]
  41. Lee, Y.-S.; Je, C.I.; Wan, K.J. Hepatoprotective effects of blue honeysuckle on CCl4-induced acute liver damaged mice. Food Sci. Nutr. 2019, 7, 322–338. [Google Scholar] [CrossRef]
  42. Wang, J.; Guo, H.; Zhang, J.; Wang, X.; Zhao, B.; Yao, J.; Wang, Y. Sulfated modification, characterization and structure–antioxidant relationships of Artemisia sphaerocephala polysaccharides. Carbohydr. Polym. 2010, 81, 897–905. [Google Scholar] [CrossRef]
  43. Karkhanei, B.; Ghane, E.T.; Mehri, F. Evaluation of oxidative stress level total antioxidant capacity, total oxidant status and glutathione activity in patients with COVID-19. New Microbes New Infect. 2021, 42, 100897. [Google Scholar] [CrossRef] [PubMed]
  44. Turanov, A.A.; Xu, X.M.; Carlson, B.A.; Yoo, M.H.; Gladyshev, V.N.; Hatfield, D.L. Biosynthesis of selenocysteine, the 21st amino acid in the genetic code, and a novel pathway for cysteine biosynthesis. Adv. Nutr. 2011, 2, 122–128. [Google Scholar] [CrossRef] [PubMed]
  45. Huang, Z.; Rose, A.H.; Hoffmann, P.R. The role of selenium in inflammation and immunity: From molecular mechanisms to therapeutic opportunities. Antioxid. Redox Signal. 2012, 16, 705–743. [Google Scholar] [CrossRef] [PubMed]
  46. Vanda, P.L.; Jun, L.; Arne, H.; Kum, K.K. From selenium to selenoproteins: Synthesis, identity, and their role in human health. Antioxid. Redox Signal. 2007, 9, 775–806. [Google Scholar]
  47. Guariniello, S.; Colonna, G.; Raucci, R.; Costantini, M.; Di Bernardo, G.; Bergantino, F.; Castello, G.; Costantini, S. Structure–function relationship and evolutionary history of the human selenoprotein M (SelM) found over-expressed in hepatocellular carcinoma. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2014, 1844, 447–456. [Google Scholar] [CrossRef] [PubMed]
  48. Ding, K.N.; Lu, M.H.; Guo, Y.N.; Liang, S.S.; Mou, R.W.; He, Y.M.; Tang, L.P. Resveratrol relieves chronic heat stress-induced liver oxidative damage in broilers by activating the Nrf2-Keap1 signaling pathway. Ecotoxicol. Environ. Saf. 2023, 249, 114411. [Google Scholar] [CrossRef]
  49. Zhang, H.; Zhang, S.; Wang, J.; Sun, B. Wheat bran feruloyl oligosaccharides protect against AAPH-induced oxidative injury via p38MAPK/PI3K-Nrf2/Keap1-MafK pathway. J. Funct. Foods 2017, 29, 53–59. [Google Scholar] [CrossRef]
  50. Bahrampour, K.; Ziaei, N.; Esmaeilipour, O.A. Feeding nano particles of vitamin C and zinc oxide: Effect on growth performance, immune response, intestinal morphology and blood constituents in heat stressed broiler chickens. Livest. Sci. 2021, 253, 104719. [Google Scholar] [CrossRef]
  51. Bami, M.K.; Afsharmanesh, M.; Salarmoini, M.; Ebrahimnejad, H. Effects of selenium-chitosan on growth performance, carcass traits, meat quality, and blood indices of broiler chickens. Livest. Sci. 2021, 250, 104562. [Google Scholar] [CrossRef]
  52. Ratcliffe, M.J.H.; Härtle, S. Avian Immunology, 3rd ed.; Kaspers, B., Schat, K.A., Göbel, T.W., Vervelde, L., Eds.; Academic Press: Cambridge, MA, USA, 2022; pp. 71–99. [Google Scholar]
  53. Zhang, L.; Hu, T.J.; Liu, H.L.; Shuai, X.H. Inhibitory effect of Sargassum polysaccharide on oxidative stress induced by infectious bursa disease virus in chicken bursal lymphocytes. Int. J. Biol. Macromol. 2011, 49, 607–615. [Google Scholar] [CrossRef]
  54. Chauhan, S.S.; Rashamol, V.P.; Bagath, M.; Sejian, V.; Dunshea, F.R. Impacts of heat stress on immune responses and oxidative stress in farm animals and nutritional strategies for amelioration. Int. J. Biometeorol. 2021, 65, 1231–1244. [Google Scholar] [CrossRef]
  55. Ryota, H.; Siti, N.; Kyohei, F. Heat Stress Causes Immune Abnormalities via Massive Damage to Effect Proliferation and Differentiation of Lymphocytes in Broiler Chickens. Front. Vet. Sci. 2020, 7, 46. [Google Scholar]
  56. Zhang, C.; Wang, L.; Zhao, X.H.; Chen, X.Y.; Yang, L.; Geng, Z.Y. Dietary resveratrol supplementation prevents transport-stress-impaired meat quality of broilers through maintaining muscle energy metabolism and antioxidant status. Poult. Sci. 2017, 96, 2219–2225. [Google Scholar] [CrossRef] [PubMed]
  57. Liu, W.C.; Ou, B.H.; Liang, Z.L. Algae-derived polysaccharides supplementation ameliorates heat stress-induced impairment of bursa of Fabricius via modulating NF-kappaB signaling pathway in broilers. Poult. Sci. 2021, 100, 101139. [Google Scholar] [CrossRef]
  58. Hosseini-Vashan, S.J.; Raei-Moghadam, M.S. Antioxidant and immune system status, plasma lipid, abdominal fat, and growth performance of broilers exposed to heat stress and fed diets supplemented with pomegranate pulp (Punica granatum L.). J. Appl. Anim. Res. 2019, 47, 521–531. [Google Scholar] [CrossRef]
  59. Sun, H.; Zhao, L.; Xu, Z.-J.; De Marco, M.; Briens, M.; Yan, X.-H.; Sun, L.-H. Hydroxy-Selenomethionine Improves the Selenium Status and Helps to Maintain Broiler Performances under a High Stocking Density and Heat Stress Conditions through a Better Redox and Immune Response. Antioxidants 2021, 10, 1542. [Google Scholar] [CrossRef]
  60. Han, J.C.; Zhang, J.L.; Zhang, N.; Yang, X.; Qu, H.X.; Guo, Y.; Shi, C.X.; Yan, Y.F. Age, phosphorus, and 25-hydroxycholecalciferol regulate mRNA expression of vitamin D receptor and sodium-phosphate cotransporter in the small intestine of broiler chickens. Poult. Sci. 2018, 97, 1199–1208. [Google Scholar] [CrossRef]
  61. Marta, C.; Karolina, M.; Marek, Z. Today’s oxidative stress markers. Med. Pr. 2015, 66, 393–405. [Google Scholar]
  62. Truong, L.; King, A.J. Lipid oxidation and antioxidant capacity in multigenerational heat stressed Japanese quail (Coturnix coturnix japonica). Poult. Sci. 2023, 102, 103005. [Google Scholar] [CrossRef]
  63. Li, H.; Cong, X.; Yu, W.; Jiang, Z.; Fu, K.; Cao, R.; Tian, W.; Feng, Y. Baicalin inhibits oxidative injures of mouse uterine tissue induced by acute heat stress through activating the Keap1/Nrf2 signaling pathway. Res. Vet. Sci. 2022, 152, 717–725. [Google Scholar] [CrossRef] [PubMed]
  64. Dalto, D.B.; Lapointe, J.; Matte, J.-J. Assessment of antioxidative and selenium status by seleno-dependent glutathione peroxidase activity in different blood fractions using a pig model: Issues for clinical nutrition and research. J. Anim. Physiol. Anim. Nutr. 2018, 102, 184–193. [Google Scholar] [CrossRef]
  65. Burk, R.F.; Hill, K.E. Regulation of Selenium Metabolism and Transport. Annu. Rev. Nutr. 2015, 35, 109–134. [Google Scholar] [CrossRef] [PubMed]
  66. Lu, C.; Qiu, F.; Zhou, H.; Peng, Y.; Hao, W.; Xu, J.; Yuan, J.; Wang, S.; Qiang, B.; Xu, C.; et al. Identification and characterization of selenoprotein K: An antioxidant in cardiomyocytes. FEBS Lett. 2006, 580, 5189–5197. [Google Scholar] [CrossRef] [PubMed]
  67. Chen, X.; Ishfaq, M.; Wang, J. Effects of Lactobacillus salivarius supplementation on the growth performance, liver function, meat quality, immune responses and Salmonella Pullorum infection resistance of broilers challenged with Aflatoxin B1. Poult. Sci. 2022, 101, 101651. [Google Scholar] [CrossRef] [PubMed]
  68. Ma, B.; Xing, T.; Li, J.; Zhang, L.; Jiang, Y.; Gao, F. Chronic heat stress causes liver damage via endoplasmic reticulum stress-induced apoptosis in broilers. Poult. Sci. 2022, 101, 102063. [Google Scholar] [CrossRef] [PubMed]
  69. Liu, L.L.; He, J.H.; Xie, H.B.; Yang, Y.S.; Li, J.C.; Zou, Y. Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens. Poult. Sci. 2014, 93, 54–62. [Google Scholar] [CrossRef]
  70. Wolfenson, D.; Frei, Y.F.; Snapir, N.; Berman, A. Heat stress effects on capillary blood flow and its redistribution in the laying hen. Pflug. Arch. Eur. J. Physiol. 1981, 390, 86–93. [Google Scholar] [CrossRef]
  71. Liu, Y.; Yin, S.; Tang, J.; Liu, Y.; Jia, G.; Liu, G.; Tian, G.; Chen, X.; Cai, J.; Kang, B.; et al. Hydroxy Selenomethionine Improves Meat Quality through Optimal Skeletal Metabolism and Functions of Selenoproteins of Pigs under Chronic Heat Stress. Antioxidants 2021, 10, 1558. [Google Scholar] [CrossRef]
  72. Wang, Y.; Liu, B.B.; Wu, P.X.; Chu, Y.; Gui, S.S.; Zheng, Y.Z.; Chen, X.D. Dietary Selenium Alleviated Mouse Liver Oxidative Stress and NAFLD Induced by Obesity by Regulating the KEAP1/NRF2 Pathway. Antioxidants 2022, 11, 349. [Google Scholar] [CrossRef] [PubMed]
  73. Lan, R.; Zhao, Z.; Li, S. Sodium butyrate as an effective feed additive to improve performance, liver function, and meat quality in broilers under hot climatic conditions. Poult. Sci. 2020, 99, 5491–5500. [Google Scholar] [CrossRef] [PubMed]
  74. Miao, Q.; Si, X.; Xie, Y. Effects of acute heat stress at different ambient temperature on hepatic redox status in broilers. Poult. Sci. 2020, 99, 4113–4122. [Google Scholar] [CrossRef] [PubMed]
  75. Cao, X.; Guo, L.; Zhou, C.; Huang, C.; Li, G.; Zhuang, Y.; Yang, F.; Liu, P.; Hu, G.; Gao, X.; et al. Effects of N-acetyl-l-cysteine on chronic heat stress-induced oxidative stress and inflammation in the ovaries of growing pullets. Poult. Sci. 2023, 102, 102274. [Google Scholar] [CrossRef]
  76. Sahin, K.; Orhan, C.; Tuzcu, Z.; Tuzcu, M.; Sahin, N. Curcumin ameloriates heat stress via inhibition of oxidative stress and modulation of Nrf2/HO-1 pathway in quail. Food Chem. Toxicol. 2012, 50, 4035–4041. [Google Scholar] [CrossRef]
  77. Xie, L.; Xu, Y.; Ding, X.; Li, K.; Liang, S.; Li, D.; Wang, Y.; Fu, A.; Yu, W.; Zhan, X. Selenomethionine Attenuated H2O2-Induced Oxidative Stress and Apoptosis by Nrf2 in Chicken Liver Cells. Antioxidants 2023, 12, 1685. [Google Scholar] [CrossRef]
  78. Wan, X.L.; Ju, G.Y.; Xu, L. Dietary selenomethionine increases antioxidant capacity of geese by improving glutathione and thioredoxin systems. Poult. Sci. 2019, 98, 3763–3769. [Google Scholar] [CrossRef]
  79. Wang, M.; Li, Y.; Molenaar, A.; Li, Q.; Cao, Y.; Shen, Y.; Chen, P.; Yan, J.; Gao, Y.; Li, J. Vitamin-E-and-selenium-supplementation-synergistically-alleviate. Theriogenology 2021, 170, 91–106. [Google Scholar] [CrossRef] [PubMed]
  80. Pope, L.E.; Dixon, S.J. Regulation of ferroptosis by lipid metabolism. Trends Cell Biol. 2023. [Google Scholar] [CrossRef] [PubMed]
  81. Wei, S.; Bi, J.; Yang, L.; Zhang, J.; Wan, Y.; Chen, X.; Wang, Y.; Wu, Z.; Lv, Y.; Wu, R. Serum irisin levels are decreased in patients with sepsis, and exogenous irisin suppresses ferroptosis in the liver of septic mice. Clin. Transl. Med. 2020, 10, e173. [Google Scholar] [CrossRef]
  82. Chen, G.H.; Song, C.C.; Pantopoulos, K.; Wei, X.L.; Zheng, H.; Luo, Z. Mitochondrial oxidative stress mediated Fe-induced ferroptosis via the NRF2-ARE pathway. Free Radic. Biol. Med. 2022, 180, 95–107. [Google Scholar] [CrossRef]
  83. Ingold, I.; Berndt, C.; Schmitt, S. Selenium Utilization by GPX4 Is Required to Prevent Hydroperoxide-Induced Ferroptosis. Cell 2018, 172, 409–422. [Google Scholar] [CrossRef]
  84. Jiang, Y.Q.; Yang, X.Y.; Duan, D.Q.; Zhang, Y.Y.; Li, N.S.; Tang, L.J.; Peng, J.; Luo, X.J. Inhibition of MALT1 reduces ferroptosis in rat hearts following ischemia/reperfusion via enhancing the Nrf2/SLC7A11 pathway. Eur. J. Pharmacol. 2023, 950, 175774. [Google Scholar] [CrossRef] [PubMed]
  85. Schimanski, L.M.; Drakesmith, H.; Merryweather-Clarke, A.T.; Viprakasit, V.; Edwards, J.P.; Sweetland, E.; Bastin, J.M.; Cowley, D.; Chinthammitr, Y.; Robson, K.J.; et al. In vitro functional analysis of human ferroproteins (FPN) and hemochromatosis-associated FPN mutations. Blood 2005, 105, 4096–4102. [Google Scholar] [CrossRef] [PubMed]
  86. Zhao, L.; Feng, Y.; Xu, Z.J. Selenium mitigated aflatoxin B1-induced cardiotoxicity with potential regulation of 4 selenoproteins and ferroptosis signaling in chicks. Food Chem. Toxicol. 2021, 154, 112320. [Google Scholar] [CrossRef] [PubMed]
  87. Jung, Y.J.; Choi, H.; Oh, E. Selenium mitigates ferroptosis-mediated dopaminergic cell death by regulating the Nrf2/GPX4 pathway. Neurosci. Lett. 2023, 810, 137314. [Google Scholar] [CrossRef] [PubMed]
  88. Wu, H.; Luan, Y.; Wang, H. Selenium inhibits ferroptosis and ameliorates autistic-like behaviors of BTBR mice by regulating the Nrf2/GPx4 pathway. Brain Res. Bull. 2022, 183, 38–48. [Google Scholar] [CrossRef] [PubMed]
Antioxidants 12 01973 g001
Figure 1. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on spleen index (A), bursa of Fabricius index (B) and liver index (C) in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Figure 1. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on spleen index (A), bursa of Fabricius index (B) and liver index (C) in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Antioxidants 12 01973 g001
Antioxidants 12 01973 g002
Figure 2. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the spleen morphological structure of heat-stressed broilers. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. Yellow oval represents the white pith merges with each other. Red triangle represents inflammatory cell infiltration. White square represents red pulp. The scar bar is 50 μm of 200× and 25 μm of 400×.
Figure 2. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the spleen morphological structure of heat-stressed broilers. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. Yellow oval represents the white pith merges with each other. Red triangle represents inflammatory cell infiltration. White square represents red pulp. The scar bar is 50 μm of 200× and 25 μm of 400×.
Antioxidants 12 01973 g002
Antioxidants 12 01973 g003
Figure 3. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expressions of selenoprotein and antioxidant-related genes of spleen in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS; PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; and PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Figure 3. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expressions of selenoprotein and antioxidant-related genes of spleen in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS; PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; and PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Antioxidants 12 01973 g003
Antioxidants 12 01973 g004
Figure 4. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the bursa of Fabricius morphological structure of heat-stressed broilers. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; and HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. The blue ovals represent the vacuole. Red triangles represents inflammatory cell infiltration. The scar bar is 50 μm of 200× and 25 μm of 400×.
Figure 4. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the bursa of Fabricius morphological structure of heat-stressed broilers. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; and HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. The blue ovals represent the vacuole. Red triangles represents inflammatory cell infiltration. The scar bar is 50 μm of 200× and 25 μm of 400×.
Antioxidants 12 01973 g004
Antioxidants 12 01973 g005
Figure 5. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expression of selenoprotein and antioxidant-related genes of bursa of Fabricius in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS; PT, main effect of ambient temperature p value; and PSe, main effect of SeNPs-AOS p value; PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Figure 5. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expression of selenoprotein and antioxidant-related genes of bursa of Fabricius in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS; PT, main effect of ambient temperature p value; and PSe, main effect of SeNPs-AOS p value; PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Antioxidants 12 01973 g005
Antioxidants 12 01973 g006
Figure 6. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the liver morphological structure of heat-stressed broilers. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; and HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. The blue ovals represent hpatocyte ballooning; white triangles represent inflammatory cell infiltration. The scar bar is 50 μm of 200× and 25 μm of 400×.
Figure 6. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the liver morphological structure of heat-stressed broilers. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; and HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. The blue ovals represent hpatocyte ballooning; white triangles represent inflammatory cell infiltration. The scar bar is 50 μm of 200× and 25 μm of 400×.
Antioxidants 12 01973 g006
Antioxidants 12 01973 g007
Figure 7. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expression of selenoprotein and antioxidant-related genes of liver in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; and PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Figure 7. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expression of selenoprotein and antioxidant-related genes of liver in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; and PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Antioxidants 12 01973 g007
Antioxidants 12 01973 g008
Figure 8. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expression of ferroptosis-related genes of liver in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; and HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; and PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Figure 8. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on relative mRNA expression of ferroptosis-related genes of liver in broilers under heat stress. TN, thermoneutral zone group; TN + SeNPs-AOS, thermoneutral zone supplemented 5 mg/kg SeNPs-AOS; HS, heat stress group; and HS + SeNPs-AOS, heat stress supplemented 5 mg/kg SeNPs-AOS. PT, main effect of ambient temperature p value; PSe, main effect of SeNPs-AOS p value; and PT×Se, p values of interaction effect between ambient temperature and SeNPs-AOS. a,b,c Different superscript letters indicate significant differences (p < 0.05).
Antioxidants 12 01973 g008
Table 1. Basal diet composition and ingredients.
Table 1. Basal diet composition and ingredients.
ItemContents (%)
Ingredients
Corn55.00
Soybean meal34.82
Wheat bran2.00
Soybean oil5.00
Limestone0.50
CaHPO41.60
NaCl0.30
DL-Methionine0.18
L-Lysine (50%)0.10
Vitamin Premix 10.20
Mineral premix 20.30
total100
Nutrient levels
ME (MJ/kg)12.82
Crude protein (%)19.92
Ca (%)0.93
P (%)0.44
Lys (%)1.30
Met (%)0.45
Total Met + Cystine (%)0.72
Se (%) 3Measured value
1 Premix provided per kilogram of diet: 9000 IU of vitamin A, 3240 IU of vitamin D3, 6 IU of vitamin E, 30.75 mg of vitamin K, 1.5 mg of vitamin B1, 4.5 mg of vitamin B2, 1.5 mg of vitamin B6, 10 μg of vitamin B12, 9 mg of niacin, 0.45 mg of folic acid, 1000 mg of choline, and 9 mg of pantothenic acid. 2 Premix provided per kilogram of diet: 40 mg of Zn, 60 mg of Mn, 80 mg of Fe, 8 mg of Cu, 0.35 mg of I, 0.15 mg of Se. 3 Se was the mean value of three repeated tests of experimental diet samples. The content of Se in the experimental diet of the control group was 0.282 mg/kg, and that of the SeNPs-AOS group was 0.696 mg/kg.
Table 2. Primers used for quantitative real-time PCR.
Table 2. Primers used for quantitative real-time PCR.
Target GenesPrimerPrimer Sequence (5′→3′)Accession No.
SELENOMForwardGGCTTCTACCGCAAGGAGACTCNM_001277859.2
ReverseGGTGGTCCTTCTTGTCCTGTTCA
SELENOWForwardCAGGAGGTGACGGGATGGTTNM_001166327.2
ReverseTACGGGAGGGCAGCTTGGAT
SELENOSForwardCGTCGCCATCTATCTCATCGTNM_001024734.3
ReverseGCTTCTTGTCTTCTTACCACCAT
SELENOTForwardGGCACATAGCATCCTTCCTGNM_001006557.4
ReverseCCGTTGACATACACTGGTTCT
SELENOP1ForwardCCAAGTGGTCATTCACATCNM_001031609.2
ReverseATGACGACCACCCTCACGAT
SEPP1ForwardGCAGACAGCATCAGACTCTACAACNM_001031609.3
ReverseTCAGGCAGCAGTGAGCAGAC
MafFForwardCGACGACGGACGCTGAAGAANM_204757.2
ReverseGTACTTGCCACGGAGAGTGTCAA
MafKForwardGCAGCAAGAGGTGGAGAAGCNM_204756.2
ReverseACGGCACGGAACTGGATGA
MafGForwardACGCTGAAGAACCGAGGCTACNM_001079489.1
ReverseGTTCTGGCGAAGTTCTGGAGTG
CATForwardCTATCCTTCCTGGTCTTTCTACATNM_001031215.2
ReverseTCATACGCCATCTGTTCTACCT
SOD1ForwardAGGGAGGAGTGGCAGAAGTNM_205064.1
ReverseGCTAAACGAGGTCCAGCAT
NQO1ForwardACCATCTCTGACCTCTACGCCATANM_001277619.1
ReverseGCCGCTTCAATCTTCTTCTGCTC
SOD2ForwardTCCTGACCTGCCTTACGACTATGGNM_204211.1
ReverseGCGACACCTGAGCTGTAACATCAC
GPX1ForwardCAAAGTGCTGCTGGTGGTCAACNM_001277853.2
ReverseTTGGTGGCGTTCTCCTGGTG
GPX3ForwardTGGCAGAGGAGTTCGGCAACNM_001163232.2
ReverseCGTTCTTGACAGTGGCGATGTT
GSTT1ForwardCATGCTAACATCCGGGCTAANM_205365.1
ReverseAAATTGCTTCAGGGAAGTGG
GSTA3ForwardGCGGCTGCTGGAGTTGAGTTNM_001001777.1
ReverseGTAGTTGAGGATGGCTCTGGTCTG
GSTO1ForwardGGGCTGGTTCCTGTTCTGNM_001277375.1
ReverseTCTTCTGTAAGGCTCGCTCAT
Nrf2ForwardTGTGTGTGATTCAACCCGACTNM_205117.1
ReverseTTAATGGAAGCCGCACCACT
Keap1ForwardACTTCGCTGAGGTCTCCAAGNM_012289.4
ReverseCAGTCGTACTGCACCCAGTT
HO-1ForwardGCCTACACCCGCTATTTGGNM_205344.1
ReverseTCTCAAGGGCATTCATTCG
TERTForwardTTCCTCGCTCCTCCCTCAGTNM_001031007.2
ReverseCGGCATTTGTTATGGCTTGAACC
FTH1ForwardGAATGTGAACCAGTCGCTGTTAGANM_205086.2
ReverseAGGTACTCTGCCATGCCATACTT
Fpn1ForwardCCACAGCGATCACAATTCAGAGGNM_001012913.2
ReverseCGACATCAGGTTCCAGCCAGAA
PTGS2ForwardTGGTGAGACTCTGGAGAGGCAACTNM_001167718.2
ReverseGCCAAACACCTCCTGCCCAACA
GPX4ForwardACCCGCTGTGGAAGTGGATGAAGNM_001039848.4
ReverseTCACCACGCAGCCGTTCTTGT
β-actinForwardGTGATGGACTCTGGTGATGGTGTTNM_205518.1
ReverseTCTCGGCTGTGGTGGTGAAG
Table 3. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on spleen antioxidant performance of broilers under heat stress.
Table 3. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on spleen antioxidant performance of broilers under heat stress.
ParametersTNHS p-Values
CONSeNPs-AOSCONSeNPs-AOSSEMTemp.SeNPs-AOSTemp. × SeNPs-AOS
CAT, U/mg prot7.64 b20.53 a7.21 b18.93 a0.850.249<0.0010.500
GSH-Px, U/mg prot122.29 bc147.78 a108.26 c136.73 ab6.280.0600.0010.815
GST, U/mg prot246.15 ab296.24 a218.66 b223.28 b19.990.0210.1860.269
T-SOD, U/mg prot683.90 ac739.77 a602.47 c610.83 c28.670.0020.2760.417
T-AOC, mmol/g prot0.92 c0.98 a0.94 b0.94 b0.0050.290<0.001<0.001
MDA, nmol/mg prot5.66 bc3.24 c9.39 a7.07 ab1.160.0040.0540.965
TN, thermoneutral zone; HS, heat stress; CON, control group, basal diet without addition of SeNPs-AOS; SeNPs-AOS, basal diet with addition of 5 mg/kg SeNPs-AOS; SEM, standard error of the mean; CAT, catalase activities; GSH-Px, glutathione peroxidase activities; GST, glutathione S-transferase activities; T-SOD, total superoxide dismutase activities; T-AOC, total antioxidant capacity; MDA, malondialdehyde. p value of Temp., main effect of temperature p value; p value of SeNPs-AOS, main effect of SeNPs-AOS p value; p value of Temp. × SeNPs-AOS, p values of interaction effect between temperature; and SeNPs-AOS. a,b,c means assigned different lowercase superscript letters are obviously different, p < 0.05.
Table 4. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the bursa of Fabricius antioxidant performance of broilers under heat stress.
Table 4. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on the bursa of Fabricius antioxidant performance of broilers under heat stress.
ParametersTNHS p-Values
CONSeNPs-AOSCONSeNPs-AOSSEMTemp.SeNPs-AOSTemp. × SeNPs-AOS
CAT, U/mg prot21.48 b57.92 a10.50 b53.13 a5.450.163<0.0010.504
GSH-Px, U/mg prot18.30 b21.66 a8.73 c18.43 b1.02<0.001<0.0010.005
GST, U/mg prot173.60 b255.35 a82.82 c124.43 d12.52<0.001<0.001<0.001
T-SOD, U/mg prot754.94 b1240.35 a556.54 c618.32 bc58.36<0.001<0.001<0.001
T-AOC, mmol/g prot1.00 a1.01 a0.75 b0.97 a0.040.0090.025<0.001
MDA, nmol/mg prot13.21 b17.18 a16.04 a12.52 b0.96<0.001<0.001<0.001
TN, thermoneutral zone; HS, heat stress; CON, control group, basal diet without addition of SeNPs-AOS; SeNPs-AOS, basal diet with addition of 5 mg/kg SeNPs-AOS; SEM, standard error of the mean; CAT, catalase activities; GSH-Px, glutathione peroxidase activities; GST, glutathione S-transferase activities; T-SOD, total superoxide dismutase activities; T-AOC, total antioxidant capacity; MDA, malondialdehyde. P value of Temp., main effect of temperature p value; p value of SeNPs-AOS, main effect of SeNPs-AOS p value; and p value of Temp. × SeNPs-AOS, p values of interaction effect between temperature and SeNPs-AOS. a,b,c,d means assigned different lowercase superscript letters are obviously different, p < 0.05.
Table 5. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on liver antioxidant performance of broilers under heat stress.
Table 5. Effects of dietary biogenic selenium nanoparticles synthesized by alginate oligosaccharides (SeNPs-AOS) on liver antioxidant performance of broilers under heat stress.
ParametersTNHS p-Values
CONSeNPs-AOSCONSeNPs-AOSSEMTemp.SeNPs-AOSTemp. × SeNPs-AOS
CAT, U/mg prot269.29 b361.38 a232.44 b276.01 b20.400.0070.0030.248
GSH-Px, U/mg prot107.53 b127.50 a50.05 d71.59 c5.86<0.0010.0020.895
GST, U/mg prot97.30 ab106.20 a90.41 b103.26 a4.170.2520.0170.641
T-SOD, U/g prot26.64 a23.97 ab22.27 bc24.64 ab1.430.2110.9160.094
T-AOC, mmol/g prot481.74 bc498.36 ab455.15 c453.98 c15.220.0300.6170.565
MDA, nmol/mg prot12.77 a10.72 b16.67 c14.61 a0.674<0.0010.0060.996
TN, thermoneutral zone; HS, heat stress; CON, control group, basal diet without addition of SeNPs-AOS; SeNPs-AOS, basal diet with addition of 5 mg/kg SeNPs-AOS; SEM, standard error of the mean; CAT, catalase activities; GSH-Px, glutathione peroxidase activities; GST, glutathione S-transferase activities; T-SOD, total superoxide dismutase activities; T-AOC, total antioxidant capacity; MDA, malondialdehyde. p value of Temp., main effect of temperature p value; p value of SeNPs-AOS, main effect of SeNPs-AOS p value; p value of Temp. × SeNPs-AOS, p values of interaction effect between temperature and SeNPs-AOS. a,b,c,d means assigned different lowercase superscript letters are obviously different, p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ye, X.-Q.; Zhu, Y.-R.; Yang, Y.-Y.; Qiu, S.-J.; Liu, W.-C. Biogenic Selenium Nanoparticles Synthesized with Alginate Oligosaccharides Alleviate Heat Stress-Induced Oxidative Damage to Organs in Broilers through Activating Nrf2-Mediated Anti-Oxidation and Anti-Ferroptosis Pathways. Antioxidants 2023, 12, 1973. https://doi.org/10.3390/antiox12111973

AMA Style

Ye X-Q, Zhu Y-R, Yang Y-Y, Qiu S-J, Liu W-C. Biogenic Selenium Nanoparticles Synthesized with Alginate Oligosaccharides Alleviate Heat Stress-Induced Oxidative Damage to Organs in Broilers through Activating Nrf2-Mediated Anti-Oxidation and Anti-Ferroptosis Pathways. Antioxidants. 2023; 12(11):1973. https://doi.org/10.3390/antiox12111973

Chicago/Turabian Style

Ye, Xue-Qing, Yan-Ru Zhu, Yu-Ying Yang, Sheng-Jian Qiu, and Wen-Chao Liu. 2023. "Biogenic Selenium Nanoparticles Synthesized with Alginate Oligosaccharides Alleviate Heat Stress-Induced Oxidative Damage to Organs in Broilers through Activating Nrf2-Mediated Anti-Oxidation and Anti-Ferroptosis Pathways" Antioxidants 12, no. 11: 1973. https://doi.org/10.3390/antiox12111973

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop