Olanzapine Ameliorates Ischemic Stroke-like Pathology in Gerbils and H2O2-Induced Neurotoxicity in SH-SY5Y Cells via Inhibiting the MAPK Signaling Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Animal Groups and OLNZ Treatment
2.3. Method of TI Induction in Gerbils
2.4. Tissue Processing for Histological Study
2.5. Cresyl Violet Staining
2.6. Fluoro-Jade B Histofluorescent Stain
2.7. Immunohistochemistry
2.8. RNA Isolation and Whole Transcriptome Sequencing (RNAseq)
2.9. Quantitative Real-Time PCR (qPCR) Analyses
2.10. Cell Culture and Cell Viability Assay
2.11. LDH and ROS Determination Test
2.12. Western Blot Analyses
2.13. Statistical Analyses
3. Results
3.1. Neuroprotective Effects of OLNZ against TI-Mediated Neuronal Cell Death
3.2. Neuroprotective Effects of OLNZ by Inactivation of TI-Induced Neuroglia Cells
3.3. Neuroprotective Effects of OLNZ by Inhibiting Oxidative Stress
3.4. Neuroprotective Effects of OLNZ by Blocking MAPK Pathway in the Hippocampus
3.5. Effects of OLNZ on DEGs Involved in the Ischemic Stroke Response in the Hippocampus
3.6. Effects of OLNZ on Functional Pathway Involved in the Ischemic Stroke Response in the Hippocampus
3.7. Effects of OLNZ on the Expression of Complement Component mRNA
3.8. Neuroprotective Effects of OLNZ against SH-SY5Y Cell Toxicity, LDH, and ROS Release
3.9. Anti-Oxidant Activity of OLNZ in SH-SY5Y Cells
3.10. Neuroprotective Effects of OLNZ to Prevent MAPK Cascade and NF-kB Activation
3.11. Anti-Apoptotic Effects of OLNZ in SH-SY5Y Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Hsieh, C.H.; Lin, Y.J.; Chen, W.L.; Huang, Y.C.; Chang, C.W.; Cheng, F.C.; Liu, R.S.; Shyu, W.C. HIF-1α triggers long-lasting glutamate excitotoxicity via system x(c)(-) in cerebral ischaemia-reperfusion. J. Pathol. 2017, 241, 337–349. [Google Scholar] [CrossRef] [PubMed]
- Lipton, P. Ischemic cell death in brain neurons. Physiol. Rev. 1999, 79, 1431–1568. [Google Scholar] [CrossRef]
- Sun, M.S.; Jin, H.; Sun, X.; Huang, S.; Zhang, F.L.; Guo, Z.N.; Yang, Y. Free Radical Damage in Ischemia-Reperfusion Injury: An Obstacle in Acute Ischemic Stroke after Revascularization Therapy. Oxid. Med. Cell. Longev. 2018, 2018, 3804979. [Google Scholar] [CrossRef]
- Lo, E.H.; Dalkara, T.; Moskowitz, M.A. Mechanisms, challenges and opportunities in stroke. Nat. Rev. Neurosci. 2003, 4, 399–415. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Men, L.; Sun, Y.; Wei, M.; Fan, X. Pharmacodynamic effects and molecular mechanisms of lignans from Schisandra chinensis Turcz. (Baill.), a current review. Eur. J. Pharmacol. 2021, 892, 173796. [Google Scholar] [CrossRef] [PubMed]
- Allen, C.L.; Bayraktutan, U. Oxidative stress and its role in the pathogenesis of ischaemic stroke. Int. J. Stroke 2009, 4, 461–470. [Google Scholar] [CrossRef]
- Chen, H.; Yoshioka, H.; Kim, G.S.; Jung, J.E.; Okami, N.; Sakata, H.; Maier, C.M.; Narasimhan, P.; Goeders, C.E.; Chan, P.H. Oxidative stress in ischemic brain damage: Mechanisms of cell death and potential molecular targets for neuroprotection. Antioxid. Redox Signal. 2011, 14, 1505–1517. [Google Scholar] [CrossRef]
- Chan, P.H. Reactive oxygen radicals in signaling and damage in the ischemic brain. J. Cereb. Blood Flow Metab. 2001, 21, 2–14. [Google Scholar] [CrossRef]
- Xu, Q.L.; Wu, J. Effects of Txk-mediated activation of NF-κB signaling pathway on neurological deficit and oxidative stress after ischemia-reperfusion in rats. Mol. Med. Rep. 2021, 24, 524. [Google Scholar] [CrossRef]
- Zhao, H.; Zhang, R.; Yan, X.; Fan, K. Superoxide dismutase nanozymes: An emerging star for anti-oxidation. J. Mater. Chem. B 2021, 9, 6939–6957. [Google Scholar] [CrossRef]
- Kwon, S.H.; Kim, J.A.; Hong, S.I.; Jung, Y.H.; Kim, H.C.; Lee, S.Y.; Jang, C.G. Loganin protects against hydrogen peroxide-induced apoptosis by inhibiting phosphorylation of JNK, p38, and ERK 1/2 MAPKs in SH-SY5Y cells. Neurochem. Int. 2011, 58, 533–541. [Google Scholar] [CrossRef] [PubMed]
- Fan, Z.; Wang, X.; Zhang, M.; Zhao, C.; Mei, C.; Li, P. MAPK Pathway Inhibitors Attenuated Hydrogen Peroxide Induced Damage in Neural Cells. Biomed. Res. Int. 2019, 2019, 5962014. [Google Scholar] [CrossRef]
- Yue, J.; López, J.M. Understanding MAPK Signaling Pathways in Apoptosis. Int. J. Mol. Sci. 2020, 21, 2346. [Google Scholar] [CrossRef] [PubMed]
- Cagnol, S.; Chambard, J.C. ERK and cell death: Mechanisms of ERK-induced cell death—Apoptosis, autophagy and senescence. Febs. J. 2010, 277, 2–21. [Google Scholar] [CrossRef]
- Green, D.R.; Llambi, F. Cell Death Signaling. Cold Spring Harb. Perspect. Biol. 2015, 7, a006080. [Google Scholar] [CrossRef] [PubMed]
- Dambrova, M.; Zvejniece, L.; Skapare, E.; Vilskersts, R.; Svalbe, B.; Baumane, L.; Muceniece, R.; Liepinsh, E. The anti-inflammatory and antinociceptive effects of NF-κB inhibitory guanidine derivative ME10092. Int. Immunopharmacol. 2010, 10, 455–460. [Google Scholar] [CrossRef] [PubMed]
- Khandelwal, N.; Simpson, J.; Taylor, G.; Rafique, S.; Whitehouse, A.; Hiscox, J.; Stark, L.A. Nucleolar NF-κB/RelA mediates apoptosis by causing cytoplasmic relocalization of nucleophosmin. Cell Death Differ. 2011, 18, 1889–1903. [Google Scholar] [CrossRef] [PubMed]
- Lingappan, K. NF-κB in Oxidative Stress. Curr. Opin. Toxicol. 2018, 7, 81–86. [Google Scholar] [CrossRef]
- Cowell, R.M.; Plane, J.M.; Silverstein, F.S. Complement activation contributes to hypoxic-ischemic brain injury in neonatal rats. J. Neurosci. 2003, 23, 9459–9468. [Google Scholar] [CrossRef]
- Schäfer, M.K.; Schwaeble, W.J.; Post, C.; Salvati, P.; Calabresi, M.; Sim, R.B.; Petry, F.; Loos, M.; Weihe, E. Complement C1q is dramatically up-regulated in brain microglia in response to transient global cerebral ischemia. J. Immunol. 2000, 164, 5446–5452. [Google Scholar] [CrossRef] [Green Version]
- Van Beek, J.; Bernaudin, M.; Petit, E.; Gasque, P.; Nouvelot, A.; MacKenzie, E.T.; Fontaine, M. Expression of receptors for complement anaphylatoxins C3a and C5a following permanent focal cerebral ischemia in the mouse. Exp. Neurol. 2000, 161, 373–382. [Google Scholar] [CrossRef] [PubMed]
- Gasque, P.; Dean, Y.D.; McGreal, E.P.; VanBeek, J.; Morgan, B.P. Complement components of the innate immune system in health and disease in the CNS. Immunopharmacology 2000, 49, 171–186. [Google Scholar] [CrossRef]
- Gasque, P.; Thomas, A.; Fontaine, M.; Morgan, B.P. Complement activation on human neuroblastoma cell lines in vitro: Route of activation and expression of functional complement regulatory proteins. J. Neuroimmunol. 1996, 66, 29–40. [Google Scholar] [CrossRef]
- Komotar, R.J.; Starke, R.M.; Arias, E.J.; Garrett, M.C.; Otten, M.L.; Merkow, M.B.; Hassid, B.; Mocco, J.; Sughrue, M.E.; Kim, G.H.; et al. The complement cascade: New avenues in stroke therapy. Curr. Vasc. Pharmacol. 2009, 7, 287–292. [Google Scholar] [CrossRef]
- Moore, N.A.; Tye, N.C.; Axton, M.S.; Risius, F.C. The behavioral pharmacology of olanzapine, a novel “atypical” antipsychotic agent. J. Pharmacol. Exp. Ther. 1992, 262, 545–551. [Google Scholar] [PubMed]
- Bymaster, F.P.; Rasmussen, K.; Calligaro, D.O.; Nelson, D.L.; DeLapp, N.W.; Wong, D.T.; Moore, N.A. In vitro and in vivo biochemistry of olanzapine: A novel, atypical antipsychotic drug. J. Clin. Psychiatry 1997, 58 (Suppl. 10), 28–36. [Google Scholar]
- Al-Chalabi, B.M.; Thanoon, I.A.; Ahmed, F.A. Potential effect of olanzapine on total antioxidant status and lipid peroxidation in schizophrenic patients. Neuropsychobiology 2009, 59, 8–11. [Google Scholar] [CrossRef]
- Del Campo, A.; Salamanca, C.; Fajardo, A.; Díaz-Castro, F.; Bustos, C.; Calfío, C.; Troncoso, R.; Pastene-Navarrete, E.R.; Acuna-Castillo, C.; Milla, L.A.; et al. Anthocyanins from Aristotelia chilensis Prevent Olanzapine-Induced Hepatic-Lipid Accumulation but Not Insulin Resistance in Skeletal Muscle Cells. Molecules 2021, 26, 6149. [Google Scholar] [CrossRef]
- Pereira, A.; Sugiharto-Winarno, A.; Zhang, B.; Malcolm, P.; Fink, G.; Sundram, S. Clozapine induction of ERK1/2 cell signalling via the EGF receptor in mouse prefrontal cortex and striatum is distinct from other antipsychotic drugs. Int. J. Neuropsychopharmacol. 2012, 15, 1149–1160. [Google Scholar] [CrossRef]
- Lu, X.H.; Bradley, R.J.; Dwyer, D.S. Olanzapine produces trophic effects in vitro and stimulates phosphorylation of Akt/PKB, ERK1/2, and the mitogen-activated protein kinase p38. Brain Res. 2004, 1011, 58–68. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.J.; Song, Y.Z.; Zhu, Y.; Zuo, W.Q.; Zhao, Y.F.; Shen, X.; Wang, W.J.; Liu, Y.L.; Wu, J.C.; Liang, Z.Q. Neuroprotective effects of olanzapine against rotenone-induced toxicity in PC12 cells. Acta Pharmacol. Sin. 2020, 41, 508–515. [Google Scholar] [CrossRef] [PubMed]
- Yue, L.F.; Zhong, Z.X.; Ma, J.; Wang, N. The Protective Effect of Olanzapine on the Hippocampal Neuron of Depression Model Rats via Inhibiting NLRP3 Inflammasome Activation. Sichuan Da Xue Xue Bao Yi Xue Ban 2019, 50, 672–678. [Google Scholar] [PubMed]
- Wakade, C.G.; Mahadik, S.P.; Waller, J.L.; Chiu, F.C. Atypical neuroleptics stimulate neurogenesis in adult rat brain. J. Neurosci. Res. 2002, 69, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Yulug, B.; Yildiz, A.; Hüdaoglu, O.; Kilic, E.; Cam, E.; Schäbitz, W.R. Olanzapine attenuates brain damage after focal cerebral ischemia in vivo. Brain Res. Bull. 2006, 71, 296–300. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.C.; Park, J.H.; Kim, I.H.; Cho, G.S.; Ahn, J.H.; Tae, H.J.; Choi, S.Y.; Cho, J.H.; Kim, D.W.; Kwon, Y.G.; et al. Neuroprotection of ischemic preconditioning is mediated by thioredoxin 2 in the hippocampal CA1 region following a subsequent transient cerebral ischemia. Brain Pathol. 2017, 27, 276–291. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.S.; Shin, H.Y.; Yoo, Y.J.; Lee, E.Y.; Kim, R.; Jang, Y.J.; Akanda, M.R.; Tae, H.J.; Kim, I.S.; Ahn, D.; et al. Fermented Mentha arvensis administration provides neuroprotection against transient global cerebral ischemia in gerbils and SH-SY5Y cells via downregulation of the MAPK signaling pathway. BMC Complement. Med. Ther. 2022, 22, 172. [Google Scholar] [CrossRef] [PubMed]
- Schmued, L.C.; Hopkins, K.J. Fluoro-Jade B: A high affinity fluorescent marker for the localization of neuronal degeneration. Brain Res. 2000, 874, 123–130. [Google Scholar] [CrossRef]
- Park, J.H.; Shin, B.N.; Chen, B.H.; Kim, I.H.; Ahn, J.H.; Cho, J.H.; Tae, H.J.; Lee, J.C.; Lee, C.H.; Kim, Y.M.; et al. Neuroprotection and reduced gliosis by atomoxetine pretreatment in a gerbil model of transient cerebral ischemia. J. Neurol. Sci. 2015, 359, 373–380. [Google Scholar] [CrossRef]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxid. Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef]
- Brannan, T.; Weinberger, J.; Knott, P.; Taff, I.; Kaufmann, H.; Togasaki, D.; Nieves-Rosa, J.; Maker, H. Direct evidence of acute, massive striatal dopamine release in gerbils with unilateral strokes. Stroke 1987, 18, 108–110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Surmeier, D.J.; Bargas, J.; Hemmings, H.C., Jr.; Nairn, A.C.; Greengard, P. Modulation of calcium currents by a D1 dopaminergic protein kinase/phosphatase cascade in rat neostriatal neurons. Neuron 1995, 14, 385–397. [Google Scholar] [CrossRef]
- Khan, F.H.; Saha, M.; Chakrabarti, S. Dopamine induced protein damage in mitochondrial-synaptosomal fraction of rat brain. Brain Res. 2001, 895, 245–249. [Google Scholar] [CrossRef]
- Reinhard, J.F., Jr.; Liebmann, J.E.; Schlosberg, A.J.; Moskowitz, M.A. Serotonin neurons project to small blood vessels in the brain. Science 1979, 206, 85–87. [Google Scholar] [CrossRef]
- Bever, K.A.; Perry, P.J. Olanzapine: A serotonin-dopamine-receptor antagonist for antipsychotic therapy. Am. J. Health Syst. Pharm. 1998, 55, 1003–1016. [Google Scholar] [CrossRef] [PubMed]
- Noh, Y.; Ahn, J.H.; Lee, J.-W.; Hong, J.; Lee, T.-K.; Kim, B.; Kim, S.-S.; Won, M.-H. Brain Factor-7® improves learning and memory deficits and attenuates ischemic brain damage by reduction of ROS generation in stroke in vivo and in vitro. Lab. Anim. Res. 2020, 36, 24. [Google Scholar] [CrossRef]
- Lee, T.K.; Kim, H.; Song, M.; Lee, J.C.; Park, J.H.; Ahn, J.H.; Yang, G.E.; Kim, H.; Ohk, T.G.; Shin, M.C.; et al. Time-course pattern of neuronal loss and gliosis in gerbil hippocampi following mild, severe, or lethal transient global cerebral ischemia. Neural Regen. Res. 2019, 14, 1394–1403. [Google Scholar] [CrossRef]
- Yoo, D.Y.; Lee, K.Y.; Park, J.H.; Jung, H.Y.; Kim, J.W.; Yoon, Y.S.; Won, M.H.; Choi, J.H.; Hwang, I.K. Glucose metabolism and neurogenesis in the gerbil hippocampus after transient forebrain ischemia. Neural Regen. Res. 2016, 11, 1254–1259. [Google Scholar] [CrossRef]
- Pulsinelli, W.A. Selective neuronal vulnerability: Morphological and molecular characteristics. Prog. Brain Res. 1985, 63, 29–37. [Google Scholar] [CrossRef]
- Wang, H.D.; Deutch, A.Y. Dopamine depletion of the prefrontal cortex induces dendritic spine loss: Reversal by atypical antipsychotic drug treatment. Neuropsychopharmacology 2008, 33, 1276–1286. [Google Scholar] [CrossRef]
- Csernansky, J.G.; Martin, M.V.; Czeisler, B.; Meltzer, M.A.; Ali, Z.; Dong, H. Neuroprotective effects of olanzapine in a rat model of neurodevelopmental injury. Pharmacol. Biochem. Behav. 2006, 83, 208–213. [Google Scholar] [CrossRef] [PubMed]
- Dheen, S.T.; Kaur, C.; Ling, E.A. Microglial activation and its implications in the brain diseases. Curr. Med. Chem. 2007, 14, 1189–1197. [Google Scholar] [CrossRef] [PubMed]
- Pekny, M.; Nilsson, M. Astrocyte activation and reactive gliosis. Glia 2005, 50, 427–434. [Google Scholar] [CrossRef]
- Lambertsen, K.L.; Gregersen, R.; Meldgaard, M.; Clausen, B.H.; Heibøl, E.K.; Ladeby, R.; Knudsen, J.; Frandsen, A.; Owens, T.; Finsen, B. A role for interferon-gamma in focal cerebral ischemia in mice. J. Neuropathol. Exp. Neurol. 2004, 63, 942–955. [Google Scholar] [CrossRef] [PubMed]
- Yoo, K.Y.; Yoo, D.Y.; Hwang, I.K.; Park, J.H.; Lee, C.H.; Choi, J.H.; Kwon, S.H.; Her, S.; Lee, Y.L.; Won, M.H. Time-course alterations of Toll-like receptor 4 and NF-κB p65, and their co-expression in the gerbil hippocampal CA1 region after transient cerebral ischemia. Neurochem. Res. 2011, 36, 2417–2426. [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, Y.; Xu, H.; Wang, L.; Adilijiang, A.; Wang, J.; Hartle, K.; Zhang, Z.; Zhang, D.; Tan, Q.; et al. Olanzapine ameliorates neuropathological changes and increases IGF-1 expression in frontal cortex of C57BL/6 mice exposed to cuprizone. Psychiatry Res. 2014, 216, 438–445. [Google Scholar] [CrossRef]
- Yung, S.C.; Farber, J.M. Chapter 89—Chemokines. In Handbook of Biologically Active Peptides (Second Edition); Kastin, A.J., Ed.; Academic Press: Boston, MA, USA, 2013; pp. 656–663. [Google Scholar] [CrossRef]
- De Maria, R.; Cifone, M.G.; Trotta, R.; Rippo, M.R.; Festuccia, C.; Santoni, A.; Testi, R. Triggering of human monocyte activation through CD69, a member of the natural killer cell gene complex family of signal transducing receptors. J. Exp. Med. 1994, 180, 1999–2004. [Google Scholar] [CrossRef]
- Bernimoulin, M.P.; Zeng, X.-L.; Abbal, C.; Giraud, S.; Martinez, M.; Michielin, O.; Schapira, M.; Spertini, O. Molecular Basis of Leukocyte Rolling on PSGL-1: Predominant Role Of Core-2 O-Glycans And Of Tyrosine Sulfate Residue 51. J. Biol. Chem. 2003, 278, 37–47. [Google Scholar] [CrossRef]
- Tian, R.; Zuo, X.; Jaoude, J.; Mao, F.; Colby, J.; Shureiqi, I. ALOX15 as a suppressor of inflammation and cancer: Lost in the link. Prostaglandins Other Lipid Mediat. 2017, 132, 77–83. [Google Scholar] [CrossRef]
- Wang, M.; Wang, J.; Liu, M.; Chen, G. Fluvastatin protects neuronal cells from hydrogen peroxide-induced toxicity with decreasing oxidative damage and increasing PI3K/Akt/mTOR signalling. J. Pharm. Pharmacol. 2021, 73, 515–521. [Google Scholar] [CrossRef]
- Gao, J.; Xu, Y.; Zhang, J.; Shi, J.; Gong, Q. Lithocarpus polystachyus Rehd. leaves aqueous extract protects against hydrogen peroxide-induced SH-SY5Y cells injury through activation of Sirt3 signaling pathway. Int. J. Mol. Med. 2018, 42, 3485–3494. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.C.; Lung, F.W. Neuroprotection of paliperidone on SH-SY5Y cells against β-amyloid peptide(25-35), N-methyl-4-phenylpyridinium ion, and hydrogen peroxide-induced cell death. Psychopharmacology 2011, 217, 397–410. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Xu, H.; Dyck, L.E.; Li, X.M. Olanzapine and quetiapine protect PC12 cells from beta-amyloid peptide(25-35)-induced oxidative stress and the ensuing apoptosis. J. Neurosci. Res. 2005, 81, 572–580. [Google Scholar] [CrossRef]
- Cavallucci, V.; D’Amelio, M.; Cecconi, F. Aβ Toxicity in Alzheimer’s Disease. Mol. Neurobiol. 2012, 45, 366–378. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Jeon, Y.M.; Jo, M.; Kim, H.J. Overexpression of SIRT3 Suppresses Oxidative Stress-induced Neurotoxicity and Mitochondrial Dysfunction in Dopaminergic Neuronal Cells. Exp. Neurobiol. 2021, 30, 341–355. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.E.; Tae, H.J.; Lee, T.K.; Park, Y.E.; Cho, J.H.; Kim, D.W.; Park, J.H.; Ahn, J.H.; Ryoo, S.; Kim, Y.M.; et al. Risperidone Treatment after Transient Ischemia Induces Hypothermia and Provides Neuroprotection in the Gerbil Hippocampus by Decreasing Oxidative Stress. Int. J. Mol. Sci. 2019, 20, 4621. [Google Scholar] [CrossRef]
- Gilgun-Sherki, Y.; Melamed, E.; Offen, D. Oxidative stress induced-neurodegenerative diseases: The need for antioxidants that penetrate the blood brain barrier. Neuropharmacology 2001, 40, 959–975. [Google Scholar] [CrossRef]
- Li, X.M.; Chlan-Fourney, J.; Juorio, A.V.; Bennett, V.L.; Shrikhande, S.; Keegan, D.L.; Qi, J.; Boulton, A.A. Differential effects of olanzapine on the gene expression of superoxide dismutase and the low affinity nerve growth factor receptor. J. Neurosci. Res. 1999, 56, 72–75. [Google Scholar] [CrossRef]
- Brinholi, F.F.; Farias, C.C.; Bonifácio, K.L.; Higachi, L.; Casagrande, R.; Moreira, E.G.; Barbosa, D.S. Clozapine and olanzapine are better antioxidants than haloperidol, quetiapine, risperidone and ziprasidone in in vitro models. Biomed. Pharmacother 2016, 81, 411–415. [Google Scholar] [CrossRef]
- Ci, X.; Ren, R.; Xu, K.; Li, H.; Yu, Q.; Song, Y.; Wang, D.; Li, R.; Deng, X. Schisantherin A exhibits anti-inflammatory properties by down-regulating NF-kappaB and MAPK signaling pathways in lipopolysaccharide-treated RAW 264.7 cells. Inflammation 2010, 33, 126–136. [Google Scholar] [CrossRef]
- Lee, K.M.; Lee, A.S.; Choi, I. Melandrii Herba Extract Attenuates H₂O₂-Induced Neurotoxicity in Human Neuroblastoma SH-SY5Y Cells and Scopolamine-Induced Memory Impairment in Mice. Molecules 2017, 22, 1646. [Google Scholar] [CrossRef] [PubMed]
- Mansouri, A.; Ridgway, L.D.; Korapati, A.L.; Zhang, Q.; Tian, L.; Wang, Y.; Siddik, Z.H.; Mills, G.B.; Claret, F.X. Sustained activation of JNK/p38 MAPK pathways in response to cisplatin leads to Fas ligand induction and cell death in ovarian carcinoma cells. J. Biol. Chem. 2003, 278, 19245–19256. [Google Scholar] [CrossRef] [PubMed]
- Jóźwiak-Bębenista, M.; Jasińska-Stroschein, M.; Kowalczyk, E. Involvement of vascular endothelial growth factor (VEGF) and mitogen-activated protein kinases (MAPK) in the mechanism of neuroleptic drugs. Pharmacol. Rep. 2018, 70, 1032–1039. [Google Scholar] [CrossRef] [PubMed]
- Kowalchuk, C.; Kanagasundaram, P.; Belsham, D.D.; Hahn, M.K. Antipsychotics differentially regulate insulin, energy sensing, and inflammation pathways in hypothalamic rat neurons. Psychoneuroendocrinology 2019, 104, 42–48. [Google Scholar] [CrossRef] [PubMed]
- Han, S.M.; Kim, J.M.; Park, K.K.; Chang, Y.C.; Pak, S.C. Neuroprotective effects of melittin on hydrogen peroxide-induced apoptotic cell death in neuroblastoma SH-SY5Y cells. BMC Complement. Altern. Med. 2014, 14, 286. [Google Scholar] [CrossRef]
- Shamas-Din, A.; Kale, J.; Leber, B.; Andrews, D.W. Mechanisms of action of Bcl-2 family proteins. Cold Spring Harb. Perspect. Biol. 2013, 5, a008714. [Google Scholar] [CrossRef] [Green Version]
Genes | Primers Name | Primer Sequence (5′-3′) | Gene Accession Number |
---|---|---|---|
C1q | C1q-F | AGGTCATCACCAACCAGGAG | XM_021631449 |
C1q-R | CTTGGAGACCACTTGGAAGG | ||
C2 | C2-F | CCTTGCAGAGGAGAATCTGG | XM_021655902 |
C2-R | GGAGGCTTCCTTCGAGAGTT | ||
C3 | C3-F | AGGTGAGGGTGGAACTGTTG | XM_021631821 |
C3R | AAGGGCACGATGACATAAGG | ||
C4a | C4a-F | TCCTCCGTTCCTACAACGTC | XM_021655869 |
C4a-R | CGTTGGCTTCCCTTGTGTAT | ||
C9 | C9-F | TGTAAACATCACCCGCGATA | XM_021654489 |
C9-R | CAACGGTCTTGGCTTCTCTC | ||
GAPDH | GAPDH-F | AGAACATCATCCCTGCATCC | XM_021636934 |
GAPDH-R | GATCCACGACAGACACGTTG | ||
SOD-1 | SOD-1-F | AGGCCGTGTGCGTGCTGAAG | NM_000454 |
SOD-1-R | CACCTTTGCCCAAGTCATCTGC | ||
SOD-2 | SOD-2-F | CTGCTCCCCGCGCTTTCTTA | NM_001024466 |
SOD-1-R | CACGTTTGATGGCTTCCAGC | ||
GAPDH | GAPDH-F | TTCACCACCATGGAGAAGGC | NM_001357943 |
GAPDH-R | GGCATGGACTGTGGTCATGA |
Gene Symbol | Differentially Expressed Genes Upregulated by Stroke (Log2FC) | Symbol of Genes | Differentially Expressed Genes Downregulated by Stroke+ OLNZ Treatment (Log2FC) |
---|---|---|---|
Cxcl10 | 8.26 | Ccl8 | −6.29 |
Ccl5 | 7.43 | Cd69 | −5.24 |
Ccl2 | 7.43 | Ciita | −5.09 |
Ccl8 | 7.32 | Ccl7 | −4.81 |
Cd69 | 6.85 | AA467197 | −4.79 |
Oasl1 | 6.73 | Sell | −4.64 |
Cxcl11 | 6.53 | Mrgbp | −4.58 |
Sell | 6.25 | Ccr7 | −4.53 |
Ifit1 | 5.97 | Cxcl13 | −4.41 |
Ifit2 | 5.88 | A930017K11Rik | −4.37 |
Ccl7 | 5.84 | Msr1 | −4.09 |
Isg15 | 5.80 | Slamf9 | −4.05 |
Ccl12 | 5.69 | Tmprss13 | −3.88 |
Hcar2 | 5.67 | Lcn2 | −3.84 |
Il1b | 5.67 | Cks2 | −3.79 |
Ttr | 5.65 | Cplx3 | −3.74 |
Oas2 | 5.60 | Slc30a2 | −3.69 |
Rsad2 | 5.48 | Fzd10 | −3.58 |
Gpr171 | 5.08 | Neurl3 | −3.58 |
Hk3 | 5.04 | Nkg7 | −3.53 |
C1qa | 2.04 | C1qa | −0.64 |
C2 | 2.88 | C2 | −1.09 |
C3 | 1.68 | C3 | −0.83 |
C4b | 1.82 | C4b | −0.04 |
C9 | 0.09 | C9 | 0 |
Gene Symbol | Differentially Expressed Genes Downregulated by Stroke (Log2FC) | Symbol of Genes | Differentially Expressed Genes Upregulated by Stroke + OLNZ Treatment (Log2FC) |
---|---|---|---|
Eif2s3y | −7.93 | Eif2s3y | 5.21 |
Rec8 | −3.26 | AGTR1 | 3.44 |
1700067K01Rik | −3.26 | Mlph | 2.70 |
Nyx | −3.26 | Fam71d | 2.58 |
Kcnj15 | −3.26 | Fabp4 | 2.44 |
Kcnk3 | −3.26 | Slc7a9 | 2.34 |
Nanos1 | −3.09 | Prr29 | 2.32 |
Dmrta1 | −3.09 | Rec8 | 2.12 |
Ccdc71l | −3.09 | Slc5a7 | 1.99 |
Alx3 | −3.09 | Ttll9 | 1.97 |
Tbx2 | −2.90 | Rerg | 1.80 |
Alx1 | −2.67 | Dcdc2b | 1.70 |
Cnr2 | −2.67 | Alox15 | 1.70 |
Mpo | −2.67 | Tctex1d1 | 1.70 |
Cfap157 | −2.59 | Cavin3 | 1.70 |
Slc4a1 | −2.41 | Tmc5 | 1.60 |
Icam4 | −2.20 | Susd1 | 1.49 |
St8sia2 | −2.09 | Ppbp | 1.49 |
Nphs1 | −1.93 | Crhr2 | 1.47 |
Alox15 | −1.85 | Det1 | 1.44 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.S.; Shin, H.-Y.; Yoo, Y.-J.; Kim, R.; Jang, Y.-J.; Akanda, M.R.; Tae, H.-J.; Kim, I.-S.; Ahn, D.; Park, B.-Y. Olanzapine Ameliorates Ischemic Stroke-like Pathology in Gerbils and H2O2-Induced Neurotoxicity in SH-SY5Y Cells via Inhibiting the MAPK Signaling Pathway. Antioxidants 2022, 11, 1697. https://doi.org/10.3390/antiox11091697
Islam MS, Shin H-Y, Yoo Y-J, Kim R, Jang Y-J, Akanda MR, Tae H-J, Kim I-S, Ahn D, Park B-Y. Olanzapine Ameliorates Ischemic Stroke-like Pathology in Gerbils and H2O2-Induced Neurotoxicity in SH-SY5Y Cells via Inhibiting the MAPK Signaling Pathway. Antioxidants. 2022; 11(9):1697. https://doi.org/10.3390/antiox11091697
Chicago/Turabian StyleIslam, Md Sadikul, Ha-Young Shin, Yeo-Jin Yoo, Ryunhee Kim, Young-Jin Jang, Md Rashedunnabi Akanda, Hyun-Jin Tae, In-Shik Kim, Dongchoon Ahn, and Byung-Yong Park. 2022. "Olanzapine Ameliorates Ischemic Stroke-like Pathology in Gerbils and H2O2-Induced Neurotoxicity in SH-SY5Y Cells via Inhibiting the MAPK Signaling Pathway" Antioxidants 11, no. 9: 1697. https://doi.org/10.3390/antiox11091697
APA StyleIslam, M. S., Shin, H.-Y., Yoo, Y.-J., Kim, R., Jang, Y.-J., Akanda, M. R., Tae, H.-J., Kim, I.-S., Ahn, D., & Park, B.-Y. (2022). Olanzapine Ameliorates Ischemic Stroke-like Pathology in Gerbils and H2O2-Induced Neurotoxicity in SH-SY5Y Cells via Inhibiting the MAPK Signaling Pathway. Antioxidants, 11(9), 1697. https://doi.org/10.3390/antiox11091697