Flavanol-Rich Cocoa Supplementation Inhibits Mitochondrial Biogenesis Triggered by Exercise
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Experimental Design, Dietary Supplementation and Intervention Compliance Control
2.3. Exercise Test and 1 km Run
2.4. Determination of Maximal Oxygen Uptake, First and Second Ventilatory Threshold, and Maximal Aerobic Speed
2.5. Sports Training Monitoring
2.6. Dietary Habits
2.7. Oxidative Stress Markers
2.7.1. Lipid Peroxidation–Thiobarbituric Acid Reactive Substances Assay
2.7.2. Protein Carbonylation Assay
2.7.3. Superoxide Dismutase Assay
2.8. Interleukin-6 Analysis
2.9. Murine Study
Mice Training Protocol
2.10. DNA Extraction from Human Blood Cells and Mouse Quadriceps Tissue
2.11. Peroxisome Proliferator-Activated Receptor-Gamma Coactivator 1 Alpha (PGC1-α) Genotyping
2.12. Mitochondrial DNA Copy Number
2.13. Nuclear Factor E2-Related Factor 2 Expression
2.14. Sample Size Calculation and Statistical Analysis
3. Results
3.1. Subject Characteristics and Genotype
3.2. Dietary Habits
3.3. Exercise Performance
3.4. Mitochondrial Biogenesis
3.5. Oxidative Stress Markers
3.6. Interleukin-6 Plasma Levels
3.7. Nuclear Factor Erythroid-Derived 2-like 2 Expression
3.8. Analysis of the Relationship between the Variables of the Human Intervention Study
4. Discussion
5. Study Limitations
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Heinonen, I.; Kalliokoski, K.K.; Hannukainen, J.C.; Duncker, D.J.; Nuutila, P.; Knuuti, J. Organ-specific physiological responses to acute physical exercise and long-term training in humans. Physiology 2014, 29, 421–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lundby, C.; Jacobs, R.A. Adaptations of skeletal muscle mitochondria to exercise training. Exp. Physiol. 2016, 101, 17–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenzuela, P.L.; Morales, J.S.; Emanuele, E.; Pareja-Galeano, H.; Lucia, A. Supplements with purported effects on muscle mass and strength. Eur. J. Nutr. 2019, 58, 2983–3008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Decroix, L.; Soares, D.D.; Meeusen, R.; Heyman, E.; Tonoli, C. Cocoa Flavanol Supplementation and Exercise: A Systematic Review. Sports Med. 2018, 48, 867–892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Watanabe, N.; Inagawa, K.; Shibata, M.; Osakabe, N. Flavan-3-ol fraction from cocoa powder promotes mitochondrial biogenesis in skeletal muscle in mice. Lipids Health Dis. 2014, 13, 64. [Google Scholar] [CrossRef] [Scilit]
- Kopustinskiene, D.M.; Savickas, A.; Vetchý, D.; Masteikova, R.; Kasauskas, A.; Bernatoniene, J. Direct effects of (-)-epicatechin and procyanidin B2 on the respiration of rat heart mitochondria. Biomed Res. Int. 2015, 2015, 232836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreno-Ulloa, A.; Miranda-Cervantes, A.; Licea-Navarro, A.; Mansour, C.; Beltrán-Partida, E.; Donis-Maturano, L.; Delgado De la Herrán, H.C.; Villarreal, F.; Álvarez-Delgado, C. (-)-Epicatechin stimulates mitochondrial biogenesis and cell growth in C2C12 myotubes via the G-protein coupled estrogen receptor. Eur. J. Pharmacol. 2018, 822, 95–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, L.; Cai, X.; Zhang, Z.; Li, Y. Grape seed procyanidin B2 ameliorates mitochondrial dysfunction and inhibits apoptosis via the AMP-activated protein kinase-silent mating type information regulation 2 homologue 1-PPARgamma co-activator-1alpha axis in rat mesangial cells under high-dose g. Br. J. Nutr. 2015, 113, 35–44. [Google Scholar] [CrossRef] [Scilit]
- Nogueira, L.; Ramirez-Sanchez, I.; Perkins, G.A.; Murphy, A.; Taub, P.R.; Ceballos, G.; Villarreal, F.J.; Hogan, M.C.; Malek, M.H. (-)-Epicatechin enhances fatigue resistance and oxidative capacity in mouse muscle. J. Physiol. 2011, 589, 4615–4631. [Google Scholar] [CrossRef] [Scilit]
- Patel, R.K.; Brouner, J.; Spendiff, O. Dark chocolate supplementation reduces the oxygen cost of moderate intensity cycling. J. Int. Soc. Sports Nutr. 2015, 12, 47. [Google Scholar] [CrossRef] [Scilit]
- Taub, P.R.; Ramirez-Sanchez, I.; Patel, M.; Higginbotham, E.; Moreno-Ulloa, A.; Román-Pintos, L.M.; Phillips, P.; Perkins, G.; Ceballos, G.; Villarreal, F. Beneficial effects of dark chocolate on exercise capacity in sedentary subjects: Underlying mechanisms. A double blind, randomized, placebo controlled trial. Food Funct. 2016, 7, 3686–3693. [Google Scholar] [CrossRef] [Scilit]
- Allgrove, J.; Farrell, E.; Gleeson, M.; Williamson, G.; Cooper, K. Regular dark chocolate consumption’s reduction of oxidative stress and increase of free-fatty-acid mobilization in response to prolonged cycling. Int. J. Sport Nutr. Exerc. Metab. 2011, 21, 113–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fraga, C.G.; Actis-Goretta, L.; Ottaviani, J.I.; Carrasquedo, F.; Lotito, S.B.; Lazarus, S.; Schmitz, H.H.; Keen, C.L. Regular consumption of a flavanol-rich chocolate can improve oxidant stress in young soccer players. Clin. Dev. Immunol. 2005, 12, 11–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schwarz, N.A.; Blahnik, Z.J.; Prahadeeswaran, S.; McKinley-Barnard, S.K.; Holden, S.L.; Waldhelm, A. (-)-Epicatechin Supplementation Inhibits Aerobic Adaptations to Cycling Exercise in Humans. Front. Nutr. 2018, 5, 132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Merino, J.Á.; Moreno-Perez, D.; de Lucas, B.; Montalvo-Lominchar, M.G.; Muñoz, E.; Sánchez, L.; Naclerio, F.; Herrera-Rocha, K.M.; Moreno-Jiménez, M.R.; Rocha-Guzmán, N.E.; et al. Chronic flavanol-rich cocoa powder supplementation reduces body fat mass in endurance athletes by modifying the follistatin/myostatin ratio and leptin levels. Food Funct. 2020, 11, 3441–3450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egan, B.; Zierath, J.R. Exercise metabolism and the molecular regulation of skeletal muscle adaptation. Cell Metab. 2013, 17, 162–184. [Google Scholar] [CrossRef] [Scilit]
- Sadler, D.G.; Draijer, R.; Stewart, C.E.; Jones, H.; Marwood, S.; Thijssen, D.H.J. Cocoa-flavanols enhance moderate-intensity pulmonary kinetics but not exercise tolerance in sedentary middle-aged adults. Eur. J. Appl. Physiol. 2021, 121, 2285–2294. [Google Scholar] [CrossRef] [Scilit]
- Naderi, A.; de Oliveira, E.P.; Ziegenfuss, T.N.; Willems, M.E.T. Timing, optimal dose and intake duration of dietary supplements with evidence-based use in sports nutrition. J. Exerc. Nutr. Biochem. 2016, 20, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Tabone, M.; Bressa, C.; García-Merino, J.A.; Moreno-Pérez, D.; Van, E.C.; Castelli, F.A.; Fenaille, F.; Larrosa, M. The effect of acute moderate-intensity exercise on the serum and fecal metabolomes and the gut microbiota of cross-country endurance athletes. Sci. Rep. 2021, 11, 3558. [Google Scholar] [CrossRef] [Scilit]
- Esteve-Lanao, J.; Foster, C.; Seiler, S.; Lucia, A. Impact of training intensity distribution on performance in endurance athletes. J. Strength Cond. Res. 2007, 21, 943–949. [Google Scholar] [CrossRef] [Scilit]
- Skinner, J.S.; Mclellan, T.H. The transition from aerobic to anaerobic metabolism. Res. Q. Exerc. Sport 1980, 51, 234–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Esteve-Lanao, J.; Moreno-Pérez, D.; Cardona, C.A.; Larumbe-Zabala, E.; Muñoz, I.; Sellés, S.; Cejuela, R. Is marathon training harder than the Ironman training? An ECO-method comparison. Front. Physiol. 2017, 8, 298. [Google Scholar] [CrossRef] [Scilit]
- Vioque, J.; Quiles, J. Encuesta de Nutrición y Salud de la Comunidad Valenciana; The Miguel Hernández University: Alicante, Spain, 2003; ISBN 84-607-9740-6. [Google Scholar]
- Colombo, G.; Clerici, M.; Garavaglia, M.E.; Giustarini, D.; Rossi, R.; Milzani, A.; Dalle-Donne, I. A step-by-step protocol for assaying protein carbonylation in biological samples. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2016, 1019, 178–190. [Google Scholar] [CrossRef] [Scilit]
- Kocha, T.; Yamaguchi, M.; Ohtaki, H.; Fukuda, T.; Aoyagi, T. Hydrogen peroxide-mediated degradation of protein: Different oxidation modes of copper- and iron-dependent hydroxyl radicals on the degradation of albumin. Biochim. Biophys. Acta Protein Struct. Mol. Enzymol. 1997, 1337, 319–326. [Google Scholar] [CrossRef] [Scilit]
- Peskin, A.V.; Winterbourn, C.C. Assay of superoxide dismutase activity in a plate assay using WST-1. Free Radic. Biol. Med. 2017, 103, 188–191. [Google Scholar] [CrossRef] [Scilit]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosa, E.F.; Ribeiro, R.F.; Pereira, F.M.T.; Freymu, E.; Aboulafia, J. Vitamin C and E supplementation prevents mitochondrial damage of ileum myocytes caused by intense and exhaustive exercise training. J. Appl. Physiol. 2022, 107, 1532–1538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, Y.K.; Kim, D.E.; Cho, S.H.; Kim, J.-H. Association between Leukocyte Mitochondrial DNA Copy Number and Regular Exercise in Postmenopausal Women. Korean J. Fam. Med. 2016, 37, 334–339. [Google Scholar] [CrossRef] [Scilit]
- Quiros, P.M.; Goyal, A.; Jha, P.; Auwerx, J. Analysis of mtDNA/nDNA Ratio in Mice. Curr. Protoc. Mouse Biol. 2017, 7, 47–54. [Google Scholar] [CrossRef] [Scilit]
- Wen, J.-J.; Wan, X.; Thacker, J.; Garg, N.J. Chemotherapeutic efficacy of phosphodiesterase inhibitors in chagasic cardiomyopathy. JACC Basic Transl. Sci. 2016, 1, 235–250. [Google Scholar] [CrossRef] [Scilit]
- Yu, Y.; Wu, G.; Jiang, Y.; Li, B.; Feng, C.; Ge, Y.; Le, H.; Jiang, L.; Liu, H.; Shi, Y.; et al. Sea Cucumber Peptides Improved the Mitochondrial Capacity of Mice: A Potential Mechanism to Enhance Gluconeogenesis and Fat Catabolism during Exercise for Improved Antifatigue Property. Oxid. Med. Cell. Longev. 2020, 2020, 4604387. [Google Scholar] [CrossRef] [Scilit]
- Jiang, C.; Diao, F.; Sang, Y.-J.; Xu, N.; Zhu, R.-L.; Wang, X.-X.; Chen, Z.; Tao, W.-W.; Yao, B.; Sun, H.-X.; et al. GGPP-Mediated Protein Geranylgeranylation in Oocyte Is Essential for the Establishment of Oocyte-Granulosa Cell Communication and Primary-Secondary Follicle Transition in Mouse Ovary. PLoS Genet. 2017, 13, e1006535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Renga, B.; Mencarelli, A.; Migliorati, M.; Distrutti, E.; Fiorucci, S. Bile-acid-activated farnesoid X receptor regulates hydrogen sulfide production and hepatic microcirculation. World J. Gastroenterol. 2009, 15, 2097–2108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faul, F.; Erdfelder, E.; Lang, A.-G.; Buchner, A. G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav. Res. Methods 2007, 39, 175–191. [Google Scholar] [CrossRef] [Scilit]
- Jonvik, K.L.; Paulussen, K.J.M.; Danen, S.L.; Ceelen, I.J.M.; Horstman, A.M.; Wardenaar, F.C.; Van Loon, L.U.C.J.C.; Van Dijk, J.W. Protein Supplementation Does Not Augment Adaptations to Endurance Exercise Training. Med. Sci. Sports Exerc. 2019, 51, 2041–2049. [Google Scholar] [CrossRef] [Scilit]
- Handschin, C.; Spiegelman, B.M. The role of exercise and PGC1alpha in inflammation and chronic disease. Nature 2008, 454, 463–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lucia, A.; Gómez-Gallego, F.; Barroso, I.; Rabadán, M.; Bandrés, F.; San Juan, A.F.; Chicharro, J.L.; Ekelund, U.; Brage, S.; Earnest, C.P.; et al. PPARGC1A genotype (Gly482Ser) predicts exceptional endurance capacity in European men. J. Appl. Physiol. 2005, 99, 344–348. [Google Scholar] [CrossRef] [Scilit]
- European Food Safety Agency. Dietary Reference Values for Nutrients Summary Report; Technical Report; European Food Safety Authority (EFSA): Parma, Italy, 2017. [Google Scholar] [CrossRef] [Scilit]
- Jäger, R.; Kerksick, C.M.; Campbell, B.I.; Cribb, P.J.; Wells, S.D.; Skwiat, T.M.; Purpura, M.; Ziegenfuss, T.N.; Ferrando, A.A.; Arent, S.M.; et al. International Society of Sports Nutrition Position Stand: Protein and exercise. J. Int. Soc. Sports Nutr. 2017, 14, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Radak, Z.; Zhao, Z.; Koltai, E.; Ohno, H.; Atalay, M. Oxygen consumption and usage during physical exercise: The balance between oxidative stress and ROS-dependent adaptive signaling. Antioxid. Redox Signal. 2013, 18, 1208–1246. [Google Scholar] [CrossRef] [Scilit]
- Hood, D.A.; Uguccioni, G.; Vainshtein, A.; D’souza, D. Mechanisms of exercise-induced mitochondrial biogenesis in skeletal muscle: Implications for health and disease. Compr. Physiol. 2011, 1, 1119–1134. [Google Scholar] [CrossRef] [Scilit]
- Merry, T.L.; Ristow, M. Nuclear factor erythroid-derived 2-like 2 (NFE2L2, Nrf2) mediates exercise-induced mitochondrial biogenesis and the anti-oxidant response in mice. J. Physiol. 2016, 594, 5195–5207. [Google Scholar] [CrossRef] [Scilit]
- Dent, J.R.; Stocks, B.; Campelj, D.G.; Philp, A. Transient changes to metabolic homeostasis initiate mitochondrial adaptation to endurance exercise. Semin. Cell Dev. Biol. 2022. [Google Scholar] [CrossRef] [Scilit]
- Bouchez, C.; Devin, A. Mitochondrial Biogenesis and Mitochondrial Reactive Oxygen Species (ROS): A Complex Relationship Regulated by the cAMP/PKA Signaling Pathway. Cells 2019, 8, 287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allen, J.; Sun, Y.; Woods, J.A. Exercise and the Regulation of Inflammatory Responses, 1st ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2015; Volume 135, ISBN 9780128039915. [Google Scholar]
- Powers, S.K.; Deminice, R.; Ozdemir, M.; Yoshihara, T.; Bomkamp, M.P.; Hyatt, H. Exercise-induced oxidative stress: Friend or foe? J. Sport Health Sci. 2020, 9, 415–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pingitore, A.; Lima, G.P.P.; Mastorci, F.; Quinones, A.; Iervasi, G.; Vassalle, C. Exercise and oxidative stress: Potential effects of antioxidant dietary strategies in sports. Nutrition 2015, 31, 916–922. [Google Scholar] [CrossRef] [Scilit]
- Bouviere, J.; Fortunato, R.S.; Dupuy, C.; Werneck-de-Castro, J.P.; Carvalho, D.P.; Louzada, R.A. Exercise-Stimulated ROS Sensitive Signaling Pathways in Skeletal Muscle. Antioxidants 2021, 10, 537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaćimović, S.; Popović-Djordjević, J.; Sarić, B.; Krstić, A.; Mickovski-Stefanović, V.; Pantelić, N.Đ. Antioxidant Activity and Multi-Elemental Analysis of Dark Chocolate. Foods 2022, 11, 1445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loffredo, L.; Baratta, F.; Ludovica, P.; Battaglia, S.; Carnevale, R.; Nocella, C.; Novo, M.; Pannitteri, G.; Ceci, F.; Angelico, F.; et al. Effects of dark chocolate on endothelial function in patients with non-alcoholic steatohepatitis. Nutr. Metab. Cardiovasc. Dis. 2018, 28, 143–149. [Google Scholar] [CrossRef] [Scilit]
- Sarriá, B.; Mateos, R.; Sierra-Cinos, J.L.; Goya, L.; García-Diz, L.; Bravo, L. Hypotensive, hypoglycaemic and antioxidant effects of consuming a cocoa product in moderately hypercholesterolemic humans. Food Funct. 2012, 3, 867–874. [Google Scholar] [CrossRef] [Scilit]
- Bernatoniene, J.; Kopustinskiene, D.M. The Role of Catechins in Cellular Responses to Oxidative Stress. Molecules 2018, 23, 965. [Google Scholar] [CrossRef] [Scilit]
- Drobnic, F.; Storsve, A.B.; Burri, L.; Ding, Y.; Banquells, M.; Riera, J.; Björk, P.; Ferrer-Roca, V.; Domingo, J.C. Krill-Oil-Dependent Increases in HS-Omega-3 Index, Plasma Choline and Antioxidant Capacity in Well-Conditioned Power Training Athletes. Nutrients 2021, 13, 4237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, C.-H.; Lin, Y.-A.; Chen, S.-L.; Hsu, M.-C.; Hsu, C.-C. American Ginseng Attenuates Eccentric Exercise-Induced Muscle Damage via the Modulation of Lipid Peroxidation and Inflammatory Adaptation in Males. Nutrients 2021, 14, 78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wangdi, J.T.; O’Leary, M.F.; Kelly, V.G.; Jackman, S.R.; Tang, J.C.Y.; Dutton, J.; Bowtell, J.L. Tart Cherry Supplement Enhances Skeletal Muscle Glutathione Peroxidase Expression and Functional Recovery after Muscle Damage. Med. Sci. Sports Exerc. 2022, 54, 609–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomez-Cabrera, M.C.; Domenech, E.; Viña, J. Moderate exercise is an antioxidant: Upregulation of antioxidant genes by training. Free Radic. Biol. Med. 2008, 44, 126–131. [Google Scholar] [CrossRef] [Scilit]
- Ristow, M.; Zarse, K.; Oberbach, A.; Klöting, N.; Birringer, M.; Kiehntopf, M.; Stumvoll, M.; Kahn, C.R.; Blüher, M. Antioxidants prevent health-promoting effects of physical exercise in humans. Proc. Natl. Acad. Sci. USA 2009, 106, 8665–8670. [Google Scholar] [CrossRef] [Scilit]
- Clifford, T.; Jeffries, O.; Stevenson, E.J.; Davies, K.A.B. The effects of vitamin C and E on exercise-induced physiological adaptations: A systematic review and Meta-analysis of randomized controlled trials. Crit. Rev. Food Sci. Nutr. 2020, 60, 3669–3679. [Google Scholar] [CrossRef] [Scilit]
- Vollaard, N.B.J.; Constantin-Teodosiu, D.; Fredriksson, K.; Rooyackers, O.; Jansson, E.; Greenhaff, P.L.; Timmons, J.A.; Sundberg, C.J. Systematic analysis of adaptations in aerobic capacity and submaximal energy metabolism provides a unique insight into determinants of human aerobic performance. J. Appl. Physiol. 2009, 106, 1479–1486. [Google Scholar] [CrossRef] [Scilit]
- Slavin, M.B.; Memme, J.M.; Oliveira, A.N.; Moradi, N.; Hood, D.A. Regulatory networks coordinating mitochondrial quality control in skeletal muscle. Am. J. Physiol. Cell Physiol. 2022, 322, C913–C926. [Google Scholar] [CrossRef] [Scilit]
- Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef] [Scilit]
- Rowley, T.J., 4th; Bitner, B.F.; Ray, J.D.; Lathen, D.R.; Smithson, A.T.; Dallon, B.W.; Plowman, C.J.; Bikman, B.T.; Hansen, J.M.; Dorenkott, M.R.; et al. Monomeric cocoa catechins enhance β-cell function by increasing mitochondrial respiration. J. Nutr. Biochem. 2017, 49, 30–41. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Ramiro, I.; Ramos, S.; Bravo, L.; Goya, L.; Martín, M.Á. Procyanidin B2 induces Nrf2 translocation and glutathione S-transferase P1 expression via ERKs and p38-MAPK pathways and protect human colonic cells against oxidative stress. Eur. J. Nutr. 2012, 51, 881–892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jîtcă, G.; Ősz, B.E.; Tero-Vescan, A.; Miklos, A.P.; Rusz, C.-M.; Bătrînu, M.-G.; Vari, C.E. Positive Aspects of Oxidative Stress at Different Levels of the Human Body: A Review. Antioxidants 2022, 11, 572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manach, C.; Williamson, G.; Morand, C.; Scalbert, A.; Rémésy, C. Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am. J. Clin. Nutr. 2005, 81, 230S–242S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kistner, T.M.; Pedersen, B.K.; Lieberman, D.E. Interleukin 6 as an energy allocator in muscle tissue. Nat. Metab. 2022, 4, 170–179. [Google Scholar] [CrossRef] [Scilit]
- Muñoz-Cánoves, P.; Scheele, C.; Pedersen, B.K.; Serrano, A.L. Interleukin-6 myokine signaling in skeletal muscle: A double-edged sword? FEBS J. 2013, 280, 4131–4148. [Google Scholar] [CrossRef] [Scilit]
- Hennigar, S.R.; McClung, J.P.; Pasiakos, S.M. Nutritional interventions and the IL-6 response to exercise. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2017, 31, 3719–3728. [Google Scholar] [CrossRef] [Scilit]
- González-Garrido, J.A.; García-Sánchez, J.R.; Garrido-Llanos, S.; Olivares-Corichi, I.M. An association of cocoa consumption with improved physical fitness and decreased muscle damage and oxidative stress in athletes. J. Sports Med. Phys. Fit. 2017, 57, 441–447. [Google Scholar] [CrossRef] [Scilit]
- Cavarretta, E.; Peruzzi, M.; Vescovo, R.D.; Pilla, F.D.; Gobbi, G.; Serdoz, A.; Ferrara, R.; Schirone, L.; Sciarretta, S.; Nocella, C.; et al. Dark chocolate intake positively modulates redox status and markers of muscular damage in elite football athletes: A randomized controlled study. Oxid. Med. Cell. Longev. 2018, 2018, 4061901. [Google Scholar] [CrossRef] [Scilit]









| Gene Name | Gene Accession Number | Forward | Reverse | Annealing Temperature | Primer Concentration | Reference |
|---|---|---|---|---|---|---|
| MT-CO1 | 4512 (NC_012920.1) | CGCCGACCGTTGACTATTCT | CACTATAGCAGATGCGAGCAGG | 58 °C | 625 nM | This study |
| HBB | 3043 (NC_000011.10) | GAAGAGCCAAGGACAGGTAC | CAACTTCATCCACGTTCACC | 60 °C | 500 nM | [29] |
| MT-ND1 | 4535 (NC_012920.1) | CTAGCAGAAACAAACCGGGC | CCGGCTGCGTATTCTACGTT | 60 °C | 200 nM | [30] |
| MT-CYT | 19893556 (NC_012920.1) | ATTCCTTCATGTCGGACGAG | ACTGAGAAGCCCCCTCAAAT | 60 °C | 200 nM | [31] |
| NFE2L2 | 4780 (NC_000002.12) | AGCACATCCAGACAGACACCAGT | TTCAGCGTGGCTGGGGATAT | 60 °C | 400 nM | [32] |
| ACTB | 60 (NC_000007.14) | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | 60 °C | 200 nM | [33] |
| Rn18S | 19791 (NC_000083.5) | GCAATTATTCCCCATGAAC | GGCCTCACTAAACCATCCAA | 55 °C | 200 nM | [34] |
| Parameters | CT (n = 20) | CO (n = 22) | p |
|---|---|---|---|
| Age (years) | 36.45 ± 9.03 | 35.18 ± 7.13 | 0.615 |
| Body weight (kg) | 70.16 ± 8.70 | 71.98 ± 7.90 | 0.481 |
| Height (cm) | 176.20 ± 6.30 | 177.13 ± 5.84 | 0.620 |
| BMI | 22.56 ± 2.18 | 22.92 ± 2.09 | 0.582 |
| PPARD1A rs8192678 Allele | CT (n = 20) | CO (n = 22) | Total | |
|---|---|---|---|---|
| CC | Observed cases | 11 | 11 | 22 |
| % of total | 26.8 | 26.8 | 53.7 | |
| CT | Observed cases | 7 | 6 | 13 |
| % of total | 17.1 | 14.6 | 31.7 | |
| TT | Observed cases | 2 | 5 | 7 |
| % of total | 2.4 | 12.2 | 14.6 | |
| Total | Observed cases | 20 | 22 | 42 |
| % of total | 46.3 | 53.7 | 100.0 |
| CT (n = 20) | CO (n = 22) | |||||||
|---|---|---|---|---|---|---|---|---|
| T1 | T3 | p | T1 | T3 | p | p * | p ** | |
| Energy (kcal) | 2402 ± 499 | 2051 ± 623 | 0.200 | 2093 ± 609 | 2162 ± 590 | 0.669 | 0.353 | 0.600 |
| Carbohydrates (%E) | 46.8 ± 7.3 | 45.6 ± 9.1 | 0.546 | 43.9 ± 6.9 | 43.1± 10.18 | 0.699 | 0.226 | 0.428 |
| Protein (%E) | 18.7 ± 2.7 | 19.9 ± 3.8 | 0.112 | 20.3 ± 3.9 | 20.58 ± 4.0 | 0.667 | 0.163 | 0.419 |
| Fat (%E) | 35.0 ± 7.7 | 34.5 ± 8.8 | 0.802 | 35.8 ± 6.2 | 34.7 ± 7.5 | 0.346 | 0.878 | 0.929 |
| Carbohydrates (g/kg b.m) | 3.7 ± 1.6 | 3.15 ± 1.0 | 0.075 | 3.0 ± 1.0 | 2.9 ± 1.1 | 0.581 | 0.187 | 0.326 |
| Protein (g/kg b.m) | 1.5 ± 0.9 | 1.4 ± 0.5 | 0.425 | 1.5 ± 0.4 | 1.5 ± 0.4 | 0.881 | 0.528 | 0.788 |
| Fat (g/kg b.m) | 1.2 ± 0.5 | 1.0 ± 0.41 | 0.248 | 1.2 ± 0.5 | 1.08 ± 0.4 | 0.245 | 0.624 | 0.967 |
| Fiber (g) | 33.3 ± 18.2 | 29.1 ± 12.2 | 0.146 | 26.4 ± 13.5 | 29.3 ± 16.0 | 0.236 | 0.150 | 0.977 |
| CT (n = 20) | CO (n = 22) | |||||||
|---|---|---|---|---|---|---|---|---|
| T1 | T3 | p | T1 | T3 | p | p * | p ** | |
| VO2max (mL/kg/min) | 57.72 ± 5.10 | 59.89 ± 3.59 | 0.032 * | 59.70 ± 5.13 | 61.30 ± 4.79 | 0.038 * | 0.217 | 0.302 |
| VT1 (km/h) | 13.18 ± 0.96 | 13.72 ± 1.00 | 0.001 * | 13.6 ± 0.87 | 13.86 ± 0.91 | 0.010 * | 0.138 | 0.640 |
| VT2 (km/h) | 15.51 ± 1.13 | 16.01 ± 1.29 | 0.001 * | 16.04 ± 0.79 | 16.42 ± 0.98 | 0.010 * | 0.084 | 0.253 |
| MAS (km/h) | 17.59 ± 1.37 | 18.06 ± 1.43 | 0.001 * | 18.10 ± 1.08 | 17.85 ± 2.08 | 0.572 | 0.185 | 0.681 |
| T1km (min) | 3.24 ± 0.29 | 3.18 ± 0.26 | 0.207 | 3.21 ± 0.24 | 3.17 ± 0.24 | 0.207 | 0.692 | 0.915 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
García-Merino, J.A.; de Lucas, B.; Herrera-Rocha, K.; Moreno-Pérez, D.; Montalvo-Lominchar, M.G.; Fernández-Romero, A.; Santiago, C.; Pérez-Ruiz, M.; Larrosa, M. Flavanol-Rich Cocoa Supplementation Inhibits Mitochondrial Biogenesis Triggered by Exercise. Antioxidants 2022, 11, 1522. https://doi.org/10.3390/antiox11081522
García-Merino JA, de Lucas B, Herrera-Rocha K, Moreno-Pérez D, Montalvo-Lominchar MG, Fernández-Romero A, Santiago C, Pérez-Ruiz M, Larrosa M. Flavanol-Rich Cocoa Supplementation Inhibits Mitochondrial Biogenesis Triggered by Exercise. Antioxidants. 2022; 11(8):1522. https://doi.org/10.3390/antiox11081522
Chicago/Turabian StyleGarcía-Merino, Jose Angel, Beatriz de Lucas, Karen Herrera-Rocha, Diego Moreno-Pérez, Maria Gregoria Montalvo-Lominchar, Arantxa Fernández-Romero, Catalina Santiago, Margarita Pérez-Ruiz, and Mar Larrosa. 2022. "Flavanol-Rich Cocoa Supplementation Inhibits Mitochondrial Biogenesis Triggered by Exercise" Antioxidants 11, no. 8: 1522. https://doi.org/10.3390/antiox11081522
APA StyleGarcía-Merino, J. A., de Lucas, B., Herrera-Rocha, K., Moreno-Pérez, D., Montalvo-Lominchar, M. G., Fernández-Romero, A., Santiago, C., Pérez-Ruiz, M., & Larrosa, M. (2022). Flavanol-Rich Cocoa Supplementation Inhibits Mitochondrial Biogenesis Triggered by Exercise. Antioxidants, 11(8), 1522. https://doi.org/10.3390/antiox11081522

