Activation of AMPK/miR-181b Axis Alleviates Endothelial Dysfunction and Vascular Inflammation in Diabetic Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Human Arteries
2.2. Animal Experimentation
2.3. Blood Glucose Measurement
2.4. Organ Culture of Arteries
2.5. Functional Assay by Wire Myography
2.6. Lucigenin-Enhanced Chemiluminescence Assay
2.7. ROS Determination by Dihydroethidium (DHE) Staining
2.8. Cell Culture
2.9. Exercise Protocol
2.10. Hemodynamic Study
2.11. Quantitative RT-PCR
2.12. Western Blotting
2.13. Experimental Blinding and Randomization
2.14. Statistical Analysis
3. Results
3.1. miR-181b Expression Reduced in Diabetic Condition
3.2. miR-181b Overexpression Improved Endothelial Function in Aortas of Diabetic Mice
3.3. miR-181b Overexpression Suppressed Vascular ROS in Aortas of Diabetic Mice
3.4. miR-181b Overexpression Inhibited Vascular and Endothelial Inflammation
3.5. AMPK Activation Increased miR-181b Expression in Human Arteries and Endothelial Cells
3.6. Chronic Exercise Activated AMPK/miR-181b Axis in Diabetic Mice
3.7. LSS Activated AMPK/miR-181b Axis in Endothelial Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ling, W.; Huang, Y.; Huang, Y.M.; Fan, R.R.; Sui, Y.; Zhao, H.L. Global Trend of Diabetes Mortality Attributed to Vascular Complications, 2000–2016. Cardiovasc. Diabetol. 2020, 19, 182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeFronzo, R.A.; Ferrannini, E.; Groop, L.; Henry, R.R.; Herman, W.H.; Holst, J.J.; Hu, F.B.; Kahn, C.R.; Raz, I.; Shulman, G.I.; et al. Type 2 Diabetes Mellitus. Nat. Rev. Dis. Prim. 2015, 1, 15019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meza, C.A.; LaFavor, J.D.; Kim, D.H.; Hickner, R.C. Endothelial Dysfunction: Is There a Hyperglycemia-Induced Imbalance of NOX and NOS? Int. J. Mol. Sci. 2019, 20, 3775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, H.; Harrison, D.G. Endothelial Dysfunction in Cardiovascular Diseases: The Role of Oxidant Stress. Circ. Res. 2000, 87, 840–844. [Google Scholar] [CrossRef] [Scilit]
- Odegaard, A.O.; Jacobs, D.R.; Sanchez, O.A.; Goff, D.C.; Reiner, A.P.; Gross, M.D. Oxidative Stress, Inflammation, Endothelial Dysfunction and Incidence of Type 2 Diabetes. Cardiovasc. Diabetol. 2016, 15, 51. [Google Scholar] [CrossRef] [Scilit]
- Steven, S.; Frenis, K.; Oelze, M.; Kalinovic, S.; Kuntic, M.; Jimenez, M.T.B.; Vujacic-Mirski, K.; Helmstädter, J.; Kröller-Schön, S.; Münzel, T.; et al. Vascular Inflammation and Oxidative Stress: Major Triggers for Cardiovascular Disease. Oxid. Med. Cell. Longev. 2019, 2019, 7092151. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Cheng, C.K.; Yi, M.; Lui, K.O.; Huang, Y. Targeting Endothelial Dysfunction and Inflammation. J. Mol. Cell. Cardiol. 2022, 168, 58–67. [Google Scholar] [CrossRef] [Scilit]
- Gebert, L.F.R.; MacRae, I.J. Regulation of MicroRNA Function in Animals. Nat. Rev. Mol. Cell Biol. 2018, 20, 21–37. [Google Scholar] [CrossRef] [Scilit]
- Pescador, N.; Pérez-Barba, M.; Ibarra, J.M.; Corbatón, A.; Martínez-Larrad, M.T.; Serrano-Ríos, M. Serum Circulating MicroRNA Profiling for Identification of Potential Type 2 Diabetes and Obesity Biomarkers. PLoS ONE 2013, 8, e77251. [Google Scholar] [CrossRef] [Scilit]
- Witkowski, M.; Witkowski, M.; Saffarzadeh, M.; Friebel, J.; Tabaraie, T.; Ta Bao, L.; Chakraborty, A.; Dörner, A.; Stratmann, B.; Tschoepe, D.; et al. Vascular MiR-181b Controls Tissue Factor-Dependent Thrombogenicity and Inflammation in Type 2 Diabetes. Cardiovasc. Diabetol. 2020, 19, 20. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Icli, B.; Wara, A.K.; Belkin, N.; He, S.; Kobzik, L.; Hunninghake, G.M.; Vera, M.P.; Blackwell, T.S.; Baron, R.M.; et al. MicroRNA-181b Regulates NF-ΚB–Mediated Vascular Inflammation. J. Clin. Investig. 2012, 122, 1973. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; He, S.; Wara, A.K.M.; Icli, B.; Shvartz, E.; Tesmenitsky, Y.; Belkin, N.; Li, D.; Blackwell, T.S.; Sukhova, G.K.; et al. Systemic Delivery of MicroRNA-181b Inhibits Nuclear Factor-ΚB Activation, Vascular Inflammation, and Atherosclerosis in Apolipoprotein E-Deficient Mice. Circ. Res. 2014, 114, 32–40. [Google Scholar] [CrossRef] [Scilit]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of Metabolism and Mitochondrial Homeostasis. Nat. Rev. Mol. Cell Biol. 2017, 19, 121–135. [Google Scholar] [CrossRef] [Scilit]
- Cheang, W.S.; Tian, X.Y.; Wong, W.T.; Lau, C.W.; Lee, S.S.T.; Chen, Z.Y.; Yao, X.; Wang, N.; Huang, Y. Metformin Protects Endothelial Function in Diet-Induced Obese Mice by Inhibition of Endoplasmic Reticulum Stress through 5’ Adenosine Monophosphate-Activated Protein Kinase-Peroxisome Proliferator-Activated Receptor δ Pathway. Arterioscler. Thromb. Vasc. Biol. 2014, 34, 830–836. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Song, A.; Hu, W.; Dai, M. The Anti-Atherosclerotic Effect of Paeonol against Vascular Smooth Muscle Cell Proliferation by Up-Regulation of Autophagy via the AMPK/MTOR Signaling Pathway. Front. Pharmacol. 2018, 8, 948. [Google Scholar] [CrossRef] [Scilit]
- Gélinas, R.; Mailleux, F.; Dontaine, J.; Bultot, L.; Demeulder, B.; Ginion, A.; Daskalopoulos, E.P.; Esfahani, H.; Dubois-Deruy, E.; Lauzier, B.; et al. AMPK Activation Counteracts Cardiac Hypertrophy by Reducing O-GlcNAcylation. Nat. Commun. 2018, 9, 374. [Google Scholar] [CrossRef] [Scilit]
- Ait-Aissa, K.; Nguyen, Q.M.; Gabani, M.; Kassan, A.; Kumar, S.; Choi, S.K.; Gonzalez, A.A.; Khataei, T.; Sahyoun, A.M.; Chen, C.; et al. MicroRNAs and Obesity-Induced Endothelial Dysfunction: Key Paradigms in Molecular Therapy. Cardiovasc. Diabetol. 2020, 19, 136. [Google Scholar] [CrossRef] [Scilit]
- Gongol, B.; Marin, T.; Zhang, J.; Wang, S.C.; Sun, W.; He, M.; Chen, S.; Chen, L.; Li, J.; Liu, J.H.; et al. Shear Stress Regulation of MiR-93 and MiR-484 Maturation through Nucleolin. Proc. Natl. Acad. Sci. USA 2019, 116, 12974–12979. [Google Scholar] [CrossRef] [Scilit]
- Chistiakov, D.A.; Orekhov, A.N.; Bobryshev, Y.V. Effects of Shear Stress on Endothelial Cells: Go with the Flow. Acta Physiol. 2017, 219, 382–408. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Pu, Y.; Zhang, H.; Xie, L.; He, L.; Zhang, C.L.; Cheng, C.K.; Huo, Y.; Wan, S.; Chen, S.; et al. KLF2 Mediates the Suppressive Effect of Laminar Flow on Vascular Calcification by Inhibiting Endothelial BMP/SMAD1/5 Signaling. Circ. Res. 2021, 129, E87–E100. [Google Scholar] [CrossRef] [Scilit]
- Chiu, J.J.; Chien, S. Effects of Disturbed Flow on Vascular Endothelium: Pathophysiological Basis and Clinical Perspectives. Physiol. Rev. 2011, 91, 327–387. [Google Scholar] [CrossRef] [Scilit]
- Marin, T.; Gongol, B.; Chen, Z.; Woo, B.; Subramaniam, S.; Chien, S.; Shyy, J.Y.J. Mechanosensitive MicroRNAs—Role in Endothelial Responses to Shear Stress and Redox State. Free Radic. Biol. Med. 2013, 64, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Dixit, M.; Bess, E.; Fisslthaler, B.; Härtel, F.V.; Noll, T.; Busse, R.; Fleming, I. Shear Stress-Induced Activation of the AMP-Activated Protein Kinase Regulates FoxO1a and Angiopoietin-2 in Endothelial Cells. Cardiovasc. Res. 2008, 77, 160–168. [Google Scholar] [CrossRef] [Scilit]
- Kilkenny, C.; Browne, W.; Cuthill, I.C.; Emerson, M.; Altman, D.G. Animal Research: Reporting in Vivo Experiments: The ARRIVE Guidelines. Br. J. Pharmacol. 2010, 160, 1577–1579. [Google Scholar] [CrossRef] [Scilit]
- Furman, B.L. Streptozotocin-Induced Diabetic Models in Mice and Rats. Curr. Protoc. Pharmacol. 2015, 70, 5–47. [Google Scholar] [CrossRef] [Scilit]
- Cheng, C.K.; Wang, C.; Shang, W.; Lau, C.W.; Luo, J.Y.; Wang, L.; Huang, Y. A High Methionine and Low Folate Diet Alters Glucose Homeostasis and Gut Microbiome. Biochem. Biophys. Rep. 2021, 25, 100921. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Kim, Y.R.; Vikram, A.; Kumar, S.; Kassan, M.; Gabani, M.; Lee, S.K.; Jacobs, J.S.; Irani, K. P66Shc-Induced MicroRNA-34a Causes Diabetic Endothelial Dysfunction by Downregulating Sirtuin1. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 2394–2403. [Google Scholar] [CrossRef] [Scilit]
- Cheng, C.K.; Luo, J.Y.; Lau, C.W.; Cho, W.C.S.; Ng, C.F.; Ma, R.C.W.; Tian, X.Y.; Huang, Y. A GLP-1 Analog Lowers ER Stress and Enhances Protein Folding to Ameliorate Homocysteine-Induced Endothelial Dysfunction. Acta Pharmacol. Sin. 2021, 42, 1598–1609. [Google Scholar] [CrossRef] [Scilit]
- Choy, K.W.; Mustafa, M.R.; Lau, Y.S.; Liu, J.; Murugan, D.; Lau, C.W.; Wang, L.; Zhao, L.; Huang, Y. Paeonol Protects against Endoplasmic Reticulum Stress-Induced Endothelial Dysfunction via AMPK/PPARδ Signaling Pathway. Biochem. Pharmacol. 2016, 116, 51–62. [Google Scholar] [CrossRef] [Scilit]
- Ling, W.C.; Liu, J.; Lau, C.W.; Murugan, D.D.; Mustafa, M.R.; Huang, Y. Treatment with Salvianolic Acid B Restores Endothelial Function in Angiotensin II-Induced Hypertensive Mice. Biochem. Pharmacol. 2017, 136, 76–85. [Google Scholar] [CrossRef] [Scilit]
- Gou, L.; Zhao, L.; Song, W.; Wang, L.; Liu, J.; Zhang, H.; Lau, C.W.; Yao, X.; Tian, X.Y.; Wong, W.T.; et al. Inhibition of MiR-92a Suppresses Oxidative Stress and Improves Endothelial Function by Upregulating Heme Oxygenase-1 in Db/Db Mice. Antioxid. Redox Signal. 2018, 28, 358–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheang, W.S.; Wong, W.T.; Zhao, L.; Xu, J.; Wang, L.; Lau, C.W.; Chen, Z.Y.; Ma, R.C.W.; Xu, A.; Wang, N.; et al. PPARδ Is Required for Exercise to Attenuate Endoplasmic Reticulum Stress and Endothelial Dysfunction in Diabetic Mice. Diabetes 2017, 66, 519–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, E.K.; Miller, I.; Aja, S.; Landree, L.E.; Pinn, M.; McFadden, J.; Kuhajda, F.P.; Moran, T.H.; Ronnett, G.V. C75, a Fatty Acid Synthase Inhibitor, Reduces Food Intake via Hypothalamic AMP-Activated Protein Kinase. J. Biol. Chem. 2004, 279, 19970–19976. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, C.K.; Lin, X.; Pu, Y.; Tse, J.K.Y.; Wang, Y.; Zhang, C.L.; Cao, X.; Lau, C.W.; Huang, J.; He, L.; et al. SOX4 Is a Novel Phenotypic Regulator of Endothelial Cells in Atherosclerosis Revealed by Single-Cell Analysis. J. Adv. Res. 2022, in press. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Liu, J.; Qu, D.; Wang, L.; Luo, J.Y.; Lau, C.W.; Liu, P.; Gao, Z.; Tipoe, G.L.; Lee, H.K.; et al. Inhibition of MiR-200c Restores Endothelial Function in Diabetic Mice Through Suppression of COX-2. Diabetes 2016, 65, 1196–1207. [Google Scholar] [CrossRef] [Scilit]
- Goh, S.Y.; Cooper, M.E. The Role of Advanced Glycation End Products in Progression and Complications of Diabetes. J. Clin. Endocrinol. Metab. 2008, 93, 1143–1152. [Google Scholar] [CrossRef] [Scilit]
- Goldin, A.; Beckman, J.A.; Schmidt, A.M.; Creager, M.A. Advanced Glycation End Products: Sparking the Development of Diabetic Vascular Injury. Circulation 2006, 114, 597–605. [Google Scholar] [CrossRef] [Scilit]
- Lu, X.; Kassab, G.S. Assessment of Endothelial Function of Large, Medium, and Small Vessels: A Unified Myograph. Am. J. Physiol.-Heart Circ. Physiol. 2011, 300, H94–H100. [Google Scholar] [CrossRef] [Scilit]
- Gagov, H.; Gribkova, I.V.; Serebryakov, V.N.; Schubert, R. Sodium Nitroprusside-Induced Activation of Vascular Smooth Muscle BK Channels Is Mediated by PKG Rather Than by a Direct Interaction with NO. Int. J. Mol. Sci. 2022, 23, 2798. [Google Scholar] [CrossRef] [Scilit]
- Higashi, Y.; Maruhashi, T.; Noma, K.; Kihara, Y. Oxidative Stress and Endothelial Dysfunction: Clinical Evidence and Therapeutic Implications. Trends Cardiovasc. Med. 2014, 24, 165–169. [Google Scholar] [CrossRef] [Scilit]
- Theofilis, P.; Sagris, M.; Oikonomou, E.; Antonopoulos, A.S.; Siasos, G.; Tsioufis, C.; Tousoulis, D. Inflammatory Mechanisms Contributing to Endothelial Dysfunction. Biomedicines 2021, 9, 781. [Google Scholar] [CrossRef] [Scilit]
- Tanasescu, M.; Leitzmann, M.F.; Rimm, E.B.; Hu, F.B. Physical Activity in Relation to Cardiovascular Disease and Total Mortality among Men with Type 2 Diabetes. Circulation 2003, 107, 2435–2439. [Google Scholar] [CrossRef] [Scilit]
- Guest, P.C.; Rahmoune, H. Characterization of the Db/Db Mouse Model of Type 2 Diabetes. Methods Mol. Biol. 2019, 1916, 195–201. [Google Scholar] [CrossRef] [Scilit]
- Ferraro, E.; Giammarioli, A.M.; Chiandotto, S.; Spoletini, I.; Rosano, G. Exercise-Induced Skeletal Muscle Remodeling and Metabolic Adaptation: Redox Signaling and Role of Autophagy. Antioxid. Redox Signal. 2014, 21, 154–176. [Google Scholar] [CrossRef] [Scilit]
- Kim, B.; Lee, H.; Kawata, K.; Park, J.Y. Exercise-Mediated Wall Shear Stress Increases Mitochondrial Biogenesis in Vascular Endothelium. PLoS ONE 2014, 9, e111409. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Sit, A.; Feinberg, M.W. Role for MiR-181 Family in Regulating Vascular Inflammation and Immunity. Trends Cardiovasc. Med. 2014, 24, 105–112. [Google Scholar] [CrossRef] [Scilit]
- Cai, W.; Ramdas, M.; Zhu, L.; Chen, X.; Striker, G.E.; Vlassara, H. Oral Advanced Glycation Endproducts (AGEs) Promote Insulin Resistance and Diabetes by Depleting the Antioxidant Defenses AGE Receptor-1 and Sirtuin 1. Proc. Natl. Acad. Sci. USA 2012, 109, 15888–15893. [Google Scholar] [CrossRef] [Scilit]
- Mao, W.; Fan, Y.; Wang, X.; Feng, G.; You, Y.; Li, H.; Chen, Y.; Yang, J.; Weng, H.; Shen, X. Phloretin Ameliorates Diabetes-Induced Endothelial Injury through AMPK-Dependent Anti-EndMT Pathway. Pharmacol. Res. 2022, 179, 106205. [Google Scholar] [CrossRef] [Scilit]
- Wu, N.; Shen, H.; Liu, H.; Wang, Y.; Bai, Y.; Han, P. Acute Blood Glucose Fluctuation Enhances Rat Aorta Endothelial Cell Apoptosis, Oxidative Stress and pro-Inflammatory Cytokine Expression in Vivo. Cardiovasc. Diabetol. 2016, 15, 109. [Google Scholar] [CrossRef] [Scilit]
- Schiffrin, E.L. Oxidative Stress, Nitric Oxide Synthase, and Superoxide Dismutase: A Matter of Imbalance Underlies Endothelial Dysfunction in the Human Coronary Circulation. Hypertension 2008, 51, 31–32. [Google Scholar] [CrossRef] [Scilit]
- Jansen, T.; Kvandová, M.; Daiber, A.; Stamm, P.; Frenis, K.; Schulz, E.; Münzel, T.; Kröller-Schön, S. The AMP-Activated Protein Kinase Plays a Role in Antioxidant Defense and Regulation of Vascular Inflammation. Antioxidants 2020, 9, 525. [Google Scholar] [CrossRef] [Scilit]
- Warburton, D.E.R.; Bredin, S.S.D. Health Benefits of Physical Activity: A Systematic Review of Current Systematic Reviews. Curr. Opin. Cardiol. 2017, 32, 541–556. [Google Scholar] [CrossRef] [Scilit]
- Joyner, M.J.; Casey, D.P. Regulation of Increased Blood Flow (Hyperemia) to Muscles During Exercise: A Hierarchy of Competing Physiological Needs. Physiol. Rev. 2015, 95, 549–601. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Lee, T.S.; Kolb, E.M.; Sun, K.; Lu, X.; Sladek, F.M.; Kassab, G.S.; Garland, T.; Shyy, J.Y.J. AMP-Activated Protein Kinase Is Involved in Endothelial NO Synthase Activation in Response to Shear Stress. Arterioscler. Thromb. Vasc. Biol. 2006, 26, 1281–1287. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Kim, C.W.; Simmons, R.D.; Jo, H. Role of Flow-Sensitive MicroRNAs in Endothelial Dysfunction and Atherosclerosis Mechanosensitive Athero-MiRs. Arterioscler. Thromb. Vasc. Biol. 2014, 34, 2206–2216. [Google Scholar] [CrossRef] [Scilit]







| Variable | Mean ± SD |
|---|---|
| No. of patients | 12 |
| No. of diabetic/non-diabetic patients | 4/8 |
| No. of males/females | 7/5 |
| Mean age | 63.75 ± 14.25 |
| mRNA/miRNA | Forward (5′-3′) | Reverse (5′-3′) | Accession Number |
|---|---|---|---|
| ICAM1 | TTGGGCATAGAGACCCCGTT | GCACATTGCTCAGTTCATACACC | NM_000201 |
| VCAM1 | CAGTAAGGCAGGCTGTAAAAGA | TGGAGCTGGTAGACCCTCG | NM_001078 |
| IL-6 | CCTGAACCTTCCAAAGATGGC | TTCACCAGGCAAGTCTCCTCA | NM_000600 |
| GAPDH | CCACTCCTCCACCTTTGAC | ACCCTGTTGCTGTAGCCA | NM_002046 |
| mRNA/miRNA | Forward (5′-3′) | Reverse (5′-3′) | Accession Number |
|---|---|---|---|
| Icam1 | GTGATGCTCAGGTATCCATCCA | CACAGTTCTCAAAGCACAGCG | NM_010493 |
| Vcam1 | GTTCCAGCGAGGGTCTACC | AACTCTTGGCAAACATTAGGTGT | NM_011693 |
| Il-6 | TTCAGCCCTTGCTTGCCTC | ACACTTTTACTCCGAAGTCGGT | NM_031168 |
| Cdh5 | ATTGGCCTGTGTTTTCGCAC | CACAGTGGGGTCATCTGCAT | NM_009868 |
| Gapdh | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA | NM_001289726 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, C.-K.; Shang, W.; Liu, J.; Cheang, W.-S.; Wang, Y.; Xiang, L.; Lau, C.-W.; Luo, J.-Y.; Ng, C.-F.; Huang, Y.; et al. Activation of AMPK/miR-181b Axis Alleviates Endothelial Dysfunction and Vascular Inflammation in Diabetic Mice. Antioxidants 2022, 11, 1137. https://doi.org/10.3390/antiox11061137
Cheng C-K, Shang W, Liu J, Cheang W-S, Wang Y, Xiang L, Lau C-W, Luo J-Y, Ng C-F, Huang Y, et al. Activation of AMPK/miR-181b Axis Alleviates Endothelial Dysfunction and Vascular Inflammation in Diabetic Mice. Antioxidants. 2022; 11(6):1137. https://doi.org/10.3390/antiox11061137
Chicago/Turabian StyleCheng, Chak-Kwong, Wenbin Shang, Jian Liu, Wai-San Cheang, Yu Wang, Li Xiang, Chi-Wai Lau, Jiang-Yun Luo, Chi-Fai Ng, Yu Huang, and et al. 2022. "Activation of AMPK/miR-181b Axis Alleviates Endothelial Dysfunction and Vascular Inflammation in Diabetic Mice" Antioxidants 11, no. 6: 1137. https://doi.org/10.3390/antiox11061137
APA StyleCheng, C.-K., Shang, W., Liu, J., Cheang, W.-S., Wang, Y., Xiang, L., Lau, C.-W., Luo, J.-Y., Ng, C.-F., Huang, Y., & Wang, L. (2022). Activation of AMPK/miR-181b Axis Alleviates Endothelial Dysfunction and Vascular Inflammation in Diabetic Mice. Antioxidants, 11(6), 1137. https://doi.org/10.3390/antiox11061137

