Reduced Levels of H2S in Diabetes-Associated Osteoarthritis Are Linked to Hyperglycaemia, Nrf-2/HO-1 Signalling Downregulation and Chondrocyte Dysfunction
Abstract
1. Introduction
2. Materials and Methods
2.1. Measurement of H2S Levels in Serum Samples
2.2. Isolation and Culture of Human Articular Chondrocytes
2.3. Reagents and Treatment Conditions
2.4. Protein Isolation, SDS-PAGE, and Western Blot
2.5. RNA Isolation, RT-PCR, and qPCR
2.6. Flow Cytometric Analysis of ROS Production
2.7. Immunoenzymatic Assay of IL-6 Production
2.8. Nrf-2 Silencing
2.9. Immunohistochemistry
2.10. Statistical Analysis
3. Results
3.1. Reduced Levels of Serum H2S in OA Patients with DB Are Associated with Hyperglycaemia
3.2. Expression of H2S Synthesizing Enzymes Is Decreased in the Cartilage from DB-OA Patients and Associated with Hyperglycaemia
3.3. Expression of HO-1 Is Decreased in Cartilage from DB-OA Patients and Associated with Hyperglycaemia and CBS Levels
3.4. HG Exposition Attenuates the Expression of H2S Synthesizing Enzymes in IL-1β-Activated Chondrocytes. H2S Donors Modulate IL-1β-Induced Pro-Catabolic Response in Chondrocytes under HG Environment
3.5. Nrf-2/HO-1 Pathway Is Involved in the Modulation of H2S Biosynthesis and in the Anti-Inflammatory Effects of Exogenous Administration of H2S under HG Environment
3.6. Reduced H2S Biosynthesis and Nrf-2 Expression in db/db Mice Is Associated with a Higher Predisposition to Cartilage Damage in a Surgically Induced OA Model
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blanco, F.J.; Valdes, A.M.; Rego-Pérez, I. Mitochondrial DNA variation and the pathogenesis of osteoarthritis phenotypes. Nat. Rev. Rheumatol. 2018, 14, 327–340. [Google Scholar] [CrossRef] [PubMed]
- Bortoluzzi, A.; Furini, F.; Scirè, C.A. Osteoarthritis and its management—Epidemiology, nutritional aspects and environmental factors. Autoimmun. Rev. 2018, 17, 1097–1104. [Google Scholar] [CrossRef] [PubMed]
- Kraus, V.B.; Blanco, F.J.; Englund, M.; Karsdal, M.A.; Lohmander, L.S. Call for standardized definitions of osteoarthritis and risk stratification for clinical trials and clinical use. Osteoarthr. Cartil. 2015, 23, 1233–1241. [Google Scholar]
- Bolduc, J.A.; Collins, J.A.; Loeser, R.F. Reactive oxygen species, aging and articular cartilage homeostasis. Free Radic. Biol. Med. 2018, 132, 73–82. [Google Scholar] [CrossRef] [PubMed]
- Vina, E.R.; Kwoh, C.K. Epidemiology of osteoarthritis: Literature update. Curr. Opin. Rheumatol. 2018, 30, 160–167. [Google Scholar] [CrossRef] [PubMed]
- Courties, A.; Sellam, J.; Berenbaum, F. Metabolic syndrome-associated osteoarthritis. Curr. Opin. Rheumatol. 2017, 29, 214–222. [Google Scholar]
- Alenazi, A.M.; Alothman, S.; Alshehri, M.M.; Rucker, J.; Waitman, L.R.; Wick, J.; Sharma, N.K.; Kluding, P.M. The prevalence of type 2 diabetes and associated risk factors with generalized osteoarthritis: A retrospective study using ICD codes for clinical data repository system. Clin. Rheumatol. 2019, 38, 3539–3547. [Google Scholar] [CrossRef]
- Williams, M.F.; London, D.A.; Husni, E.M.; Navaneethan, S.; Kashyap, S.R. Type 2 diabetes and osteoarthritis: A systematic review and meta-analysis. J. Diabetes Complicat. 2016, 30, 944–950. [Google Scholar] [CrossRef]
- Yan, L.J. Pathogenesis of chronic hyperglycemia: From reductive stress to oxidative stress. J. Diabetes Res. 2014, 2014, 137919. [Google Scholar] [CrossRef]
- Li, J.; Huang, M.; Shen, X. The association of oxidative stress and pro-inflammatory cytokines in diabetic patients with hyperglycemic crisis. J. Diabetes Complicat. 2014, 28, 662–666. [Google Scholar] [CrossRef]
- Wang, X.; Hunter, D.; Xu, J.; Ding, C. Metabolic triggered inflammation in osteoarthritis. Osteoarthr. Cartil. 2015, 23, 22–30. [Google Scholar] [CrossRef]
- Hui, W.; Young, D.A.; Rowan, A.D.; Xu, X.; Cawston, T.E.; Proctor, C.J. Oxidative changes and signalling pathways are pivotal in initiating age-related changes in articular cartilage. Ann. Rheum. Dis. 2016, 75, 449–458. [Google Scholar] [CrossRef] [PubMed]
- Liu-Bryan, R.; Terkeltaub, R. Emerging regulators of the inflammatory process in osteoarthritis. Nat. Rev. Rheumatol. 2015, 11, 35–44. [Google Scholar] [CrossRef]
- Veronese, N.; Cooper, C.; Reginster, J.Y.; Hochberg, M.; Branco, J.; Bruyère, O.; Chapurlat, R.; Al-Daghri, N.; Dennison, E.; Herrero-Beaumont, G.; et al. Type 2 diabetes mellitus and osteoarthritis. Semin. Arthritis Rheum. 2019, 49, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Fox, B.; Schantz, J.T.; Haigh, R.; Wood, M.E.; Moore, P.K.; Viner, N.; Spencer, J.P.; Winyard, P.G.; Whiteman, M. Inducible hydrogen sulfide synthesis in chondrocytes and mesenchymal progenitor cells: Is H2S a novel cytoprotective mediator in the inflamed joint? J. Cell Mol. Med. 2012, 16, 896–910. [Google Scholar] [CrossRef] [PubMed]
- Burguera, E.F.; Vela-Anero, A.; Magalhães, J.; Meijide-Faílde, R.; Blanco, F.J. Effect of hydrogen sulfide sources on inflammation and catabolic markers on interleukin 1β-stimulated human articular chondrocytes. Osteoarthr. Cartil. 2014, 22, 1026–1035. [Google Scholar] [CrossRef]
- Vela-Anero, Á.; Hermida-Gómez, T.; Gato-Calvo, L.; Vaamonde-García, C.; Díaz-Prado, S.; Meijide-Faílde, R.; Blanco, F.J.; Burguera, E.F. Long-term effects of hydrogen sulfide on the anabolic-catabolic balance of articular cartilage in vitro. Nitric Oxide 2017, 70, 42–50. [Google Scholar] [CrossRef]
- Vaamonde-García, C.; Vela-Anero, Á.; Hermida-Gómez, T.; Fernández-Burguera, E.; Filgueira-Fernández, P.; Goyanes, N.; Blanco, F.J.; Meijide-Faílde, R. Effect of balneotherapy in sulfurous water on an in vivo murine model of osteoarthritis. Int. J. Biometeorol. 2020, 64, 307–318. [Google Scholar] [CrossRef] [PubMed]
- Peake, B.F.; Nicholson, C.K.; Lambert, J.P.; Hood, R.L.; Amin, H.; Amin, S.; Calvert, J.W. Hydrogen sulfide preconditions the db/db diabetic mouse heart against ischemia-reperfusion injury by activating Nrf2 signaling in an Erk-dependent manner. Am. J. Physiol. Heart Circ. Physiol. 2013, 304, H1215–H1224. [Google Scholar] [CrossRef]
- Suzuki, K.; Sagara, M.; Aoki, C.; Tanaka, S.; Aso, Y. Clinical Implication of Plasma Hydrogen Sulfide Levels in Japanese Patients with Type 2 Diabetes. Intern. Med. 2017, 56, 17–21. [Google Scholar] [CrossRef]
- Burguera, E.F.; Vela-Anero, Á.; Gato-Calvo, L.; Vaamonde-García, C.; Meijide-Faílde, R.; Blanco, F.J. Hydrogen sulfide biosynthesis is impaired in the osteoarthritic joint. Int. J. Biometeorol. 2019, 64, 997–1010. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Tang, G.; Zhang, L.; Wu, L.; Wang, R. The pathogenic role of cystathionine γ-lyase/hydrogen sulfide in streptozotocin-induced diabetes in mice. Am. J. Pathol. 2011, 179, 869–879. [Google Scholar] [CrossRef]
- Wallace, J.L.; Wang, R. Hydrogen sulfide-based therapeutics: Exploiting a unique but ubiquitous gasotransmitter. Nat. Rev. Drug Discov. 2015, 14, 329–345. [Google Scholar] [CrossRef] [PubMed]
- Gheibi, S.; Samsonov, A.P.; Vazquez, A.B.; Kashfi, K. Regulation of carbohydrate metabolism by nitric oxide and hydrogen sulfide: Implications in diabetes. Biochem. Pharmacol. 2020, 176, 113819. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhao, L.; Jiang, S.; Hu, Z.; Hu, B.; Tong, F.; Shen, R. Cystathionine γ-Lyase Is Involved in the Renoprotective Effect of Brief and Repeated Ischemic Postconditioning After Renal Ischemia/Reperfusion Injury in Diabetes Mellitus. Transplant. Proc. 2018, 50, 1549–1557. [Google Scholar] [CrossRef]
- Sen, N. Functional and Molecular Insights of Hydrogen Sulfide Signaling and Protein Sulfhydration. J. Mol. Biol. 2017, 429, 543–561. [Google Scholar] [CrossRef]
- Uruno, A.; Furusawa, Y.; Yagishita, Y.; Fukutomi, T.; Muramatsu, H.; Negishi, T.; Sugawara, A.; Kensler, T.W.; Yamamoto, M. The Keap1-Nrf2 system prevents onset of diabetes mellitus. Mol. Cell Biol. 2013, 33, 2996–3010. [Google Scholar] [CrossRef]
- Cai, D.; Huff, T.W.; Liu, J.; Yuan, T.; Wei, Z.; Qin, J. Alleviation of Cartilage Destruction by Sinapic Acid in Experimental Osteoarthritis. Biomed. Res. Int. 2019, 2019, 5689613. [Google Scholar] [CrossRef] [PubMed]
- Pan, X.; Chen, T.; Zhang, Z.; Chen, X.; Chen, C.; Chen, L.; Wang, X.; Ying, X. Activation of Nrf2/HO-1 signal with Myricetin for attenuating ECM degradation in human chondrocytes and ameliorating the murine osteoarthritis. Int. Immunopharmacol. 2019, 75, 105742. [Google Scholar] [CrossRef]
- Xie, L.; Gu, Y.; Wen, M.; Zhao, S.; Wang, W.; Ma, Y.; Meng, G.; Han, Y.; Wang, Y.; Liu, G.; et al. Hydrogen Sulfide Induces Keap1 S-sulfhydration and Suppresses Diabetes-Accelerated Atherosclerosis via Nrf2 Activation. Diabetes 2016, 65, 3171–3184. [Google Scholar] [CrossRef]
- Niture, S.K.; Khatri, R.; Jaiswal, A.K. Regulation of Nrf2-an update. Free Radic. Biol. Med. 2014, 66, 36–44. [Google Scholar] [CrossRef]
- Guillén, M.; Megías, J.; Gomar, F.; Alcaraz, M. Haem oxygenase-1 regulates catabolic and anabolic processes in osteoarthritic chondrocytes. J. Pathol. 2008, 214, 515–522. [Google Scholar] [CrossRef] [PubMed]
- Clérigues, V.; Murphy, C.L.; Guillén, M.I.; Alcaraz, M.J. Haem oxygenase-1 induction reverses the actions of interleukin-1β on hypoxia-inducible transcription factors and human chondrocyte metabolism in hypoxia. Clin. Sci. 2013, 125, 99–108. [Google Scholar] [CrossRef]
- Vaamonde-Garcia, C.; Courties, A.; Pigenet, A.; Laiguillon, M.C.; Sautet, A.; Houard, X.; Kerdine-Römer, S.; Meijide, R.; Berenbaum, F.; Sellam, J. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis. J. Biol. Chem. 2017, 292, 14505–14515. [Google Scholar] [CrossRef]
- Toegel, S.; Harrer, N.; Plattner, V.E.; Unger, F.M.; Viernstein, H.; Goldring, M.B.; Gabor, F.; Wirth, M. Lectin binding studies on C-28/I2 and T/C-28a2 chondrocytes provide a basis for new tissue engineering and drug delivery perspectives in cartilage research. J. Control Release 2007, 117, 121–129. [Google Scholar] [CrossRef]
- Ribeiro, M.; López de Figueroa, P.; Nogueira-Recalde, U.; Centeno, A.; Mendes, A.F.; Blanco, F.J.; Caramés, B. Diabetes-accelerated experimental osteoarthritis is prevented by autophagy activation. Osteoarthr. Cartil. 2016, 24, 2116–2125. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Li, X.; Wei, X.; Wang, H. Hydrogen Sulfide Plays an Important Role in Diabetic Cardiomyopathy. Front. Cell Dev. Biol. 2021, 9, 627336. [Google Scholar] [CrossRef]
- Whiteman, M.; Gooding, K.M.; Whatmore, J.L.; Ball, C.I.; Mawson, D.; Skinner, K.; Tooke, J.E.; Shore, A.C. Adiposity is a major determinant of plasma levels of the novel vasodilator hydrogen sulphide. Diabetologia 2010, 53, 1722–1726. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Jin, H.; Yang, L. Role of Hydrogen Sulfide in Retinal Diseases. Front. Pharmacol. 2017, 8, 588. [Google Scholar] [CrossRef]
- Nandi, S.S.; Mishra, P.K. H2S and homocysteine control a novel feedback regulation of cystathionine beta synthase and cystathionine gamma lyase in cardiomyocytes. Sci. Rep. 2017, 7, 3639. [Google Scholar] [CrossRef]
- Sun, H.J.; Wu, Z.Y.; Nie, X.W.; Bian, J.S. Role of Endothelial Dysfunction in Cardiovascular Diseases: The Link Between Inflammation and Hydrogen Sulfide. Front. Pharmacol. 2019, 10, 1568. [Google Scholar] [CrossRef] [PubMed]
- Comas, F.; Moreno-Navarrete, J.M. The Impact of H2S on Obesity-Associated Metabolic Disturbances. Antioxidants 2021, 10, 633. [Google Scholar] [CrossRef]
- Yamamoto, J.; Sato, W.; Kosugi, T.; Yamamoto, T.; Kimura, T.; Taniguchi, S.; Kojima, H.; Maruyama, S.; Imai, E.; Matsuo, S.; et al. Distribution of hydrogen sulfide (H₂S)-producing enzymes and the roles of the H₂S donor sodium hydrosulfide in diabetic nephropathy. Clin. Exp. Nephrol. 2013, 17, 32–40. [Google Scholar] [CrossRef]
- Yu, Y.; Xiao, L.; Ren, Z.; Zhu, G.; Wang, W.; Jia, Y.; Peng, A.; Wang, X. Glucose-induced decrease of cystathionine β-synthase mediates renal injuries. FASEB J. 2021, 35, e21576. [Google Scholar] [CrossRef]
- Shibuya, N.; Tanaka, M.; Yoshida, M.; Ogasawara, Y.; Togawa, T.; Ishii, K.; Kimura, H. 3-Mercaptopyruvate sulfurtransferase produces hydrogen sulfide and bound sulfane sulfur in the brain. Antioxid. Redox Signal. 2009, 11, 703–714. [Google Scholar] [CrossRef]
- Nasi, S.; Ehirchiou, D.; Chatzianastasiou, A.; Nagahara, N.; Papapetropoulos, A.; Bertrand, J.; Cirino, G.; So, A.; Busso, N. The protective role of the 3-mercaptopyruvate sulfurtransferase (3-MST)-hydrogen sulfide (H2S) pathway against experimental osteoarthritis. Arthritis Res. Ther. 2020, 22, 49. [Google Scholar] [CrossRef]
- Vaamonde-García, C.; López-Armada, M.J. Role of mitochondrial dysfunction on rheumatic diseases. Biochem. Pharmacol. 2019, 165, 181–195. [Google Scholar] [CrossRef]
- Zhang, F.; Chen, S.; Wen, J.Y.; Chen, Z.W. 3-Mercaptopyruvate sulfurtransferase/hydrogen sulfide protects cerebral endothelial cells against oxygen-glucose deprivation/reoxygenation-induced injury via mitoprotection and inhibition of the RhoA/ROCK pathway. Am. J. Physiol. Cell Physiol. 2020, 319, C720–C733. [Google Scholar] [CrossRef] [PubMed]
- Módis, K.; Coletta, C.; Erdélyi, K.; Papapetropoulos, A.; Szabo, C. Intramitochondrial hydrogen sulfide production by 3-mercaptopyruvate sulfurtransferase maintains mitochondrial electron flow and supports cellular bioenergetics. FASEB J. 2013, 27, 601–611. [Google Scholar] [CrossRef] [PubMed]
- Petrie, J.R.; Guzik, T.J.; Touyz, R.M. Diabetes, Hypertension, and Cardiovascular Disease: Clinical Insights and Vascular Mechanisms. Can. J. Cardiol. 2018, 34, 575–584. [Google Scholar] [CrossRef]
- Lazarte, J.; Hegele, R.A. Dyslipidemia Management in Adults with Diabetes. Can. J. Diabetes 2020, 44, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.; Ren, J.; Huang, J.; Li, D. Association of homocysteine with type 2 diabetes: A meta-analysis implementing Mendelian randomization approach. BMC Genom. 2013, 14, 867. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.; Jiang, X.; Pansuria, M.; Fang, P.; Mai, J.; Mallilankaraman, K.; Gandhirajan, R.K.; Eguchi, S.; Scalia, R.; Madesh, M.; et al. Hyperhomocysteinemia and hyperglycemia induce and potentiate endothelial dysfunction via μ-calpain activation. Diabetes 2015, 64, 947–959. [Google Scholar] [CrossRef]
- Fang, P.; Zhang, D.; Cheng, Z.; Yan, C.; Jiang, X.; Kruger, W.D.; Meng, S.; Arning, E.; Bottiglieri, T.; Choi, E.T.; et al. Hyperhomocysteinemia potentiates hyperglycemia-induced inflammatory monocyte differentiation and atherosclerosis. Diabetes 2014, 63, 4275–4290. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Qiu, B.; Lu, H.; Lai, Y.; Liu, J.; Luo, J.; Zhu, F.; Hu, Z.; Zhou, M.; Tian, J.; et al. Hyperhomocysteinemia Accelerates Acute Kidney Injury to Chronic Kidney Disease Progression by Downregulating Heme Oxygenase-1 Expression. Antioxid. Redox Signal. 2019, 30, 1635–1650. [Google Scholar] [CrossRef] [PubMed]
- Cao, P.; Zhang, W.; Kong, X.; Gao, N.; Zhao, X.; Xu, R. Hyperhomocysteinemia-induced Nrf2/HO-1 pathway suppression aggravates cardiac remodeling of hypertensive rats. Biochem. Biophys. Res. Commun. 2021, 547, 125–130. [Google Scholar] [CrossRef]
- Li, X.; Yu, P.; Yu, Y.; Xu, T.; Liu, J.; Cheng, Y.; Yang, X.; Cui, X.; Yin, C.; Liu, Y. Hydrogen sulfide ameliorates high glucose-induced pro-inflammation factors in HT-22 cells: Involvement of SIRT1-mTOR/NF-κB signaling pathway. Int. Immunopharmacol. 2021, 95, 107545. [Google Scholar] [CrossRef]
- Zhang, H.; Zhuang, X.D.; Meng, F.H.; Chen, L.; Dong, X.B.; Liu, G.H.; Li, J.H.; Dong, Q.; Xu, J.D.; Yang, C.T. Calcitriol prevents peripheral RSC96 Schwann neural cells from high glucose & methylglyoxal-induced injury through restoration of CBS/H2S expression. Neurochem. Int. 2016, 92, 49–57. [Google Scholar]
- Hu, T.X.; Wang, G.; Wu, W.; Gao, L.; Tan, Q.Y.; Wang, J. Hydrogen Sulfide Inhibits High Glucose-Induced sFlt-1 Production via Decreasing ADAM17 Expression in 3T3-L1 Adipocytes. Int. J. Endocrinol. 2017, 2017, 9501792. [Google Scholar] [CrossRef]
- Guan, Q.; Liu, W.; Liu, Y.; Fan, Y.; Wang, X.; Yu, C.; Zhang, Y.; Wang, S.; Liu, J.; Zhao, J.; et al. High glucose induces the release of endothelin-1 through the inhibition of hydrogen sulfide production in HUVECs. Int. J. Mol. Med. 2015, 35, 810–814. [Google Scholar] [CrossRef][Green Version]
- Lin, F.; Yang, Y.; Wei, S.; Huang, X.; Peng, Z.; Ke, X.; Zeng, Z.; Song, Y. Hydrogen Sulfide Protects Against High Glucose-Induced Human Umbilical Vein Endothelial Cell Injury Through Activating PI3K/Akt/eNOS Pathway. Drug Des. Dev. Ther. 2020, 14, 621–633. [Google Scholar] [CrossRef] [PubMed]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Lin, X.; Huang, C. Activation of the reverse transsulfuration pathway through NRF2/CBS confers erastin-induced ferroptosis resistance. Br. J. Cancer 2020, 122, 279–292. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wu, J.; Sun, A.; Sun, Y.; Yu, X.; Liu, N.; Dong, S.; Yang, F.; Zhang, L.; Zhong, X.; et al. Hydrogen sulfide decreases high glucose/palmitate-induced autophagy in endothelial cells by the Nrf2-ROS-AMPK signaling pathway. Cell Biosci. 2016, 6, 33. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Song, T.; Gu, Y.; Zhang, Y.; Cao, S.; Miao, Q.; Zhang, X.; Chen, H.; Gao, Y.; Zhang, L.; et al. Hydrogen Sulfide Alleviates Liver Injury Through the S-Sulfhydrated-Kelch-Like ECH-Associated Protein 1/Nuclear Erythroid 2-Related Factor 2/Low-Density Lipoprotein Receptor-Related Protein 1 Pathway. Hepatology 2021, 73, 282–302. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, Y.; Nicholson, C.K.; Lambert, J.P.; Barr, L.A.; Kuek, N.; Herszenhaut, D.; Tan, L.; Murohara, T.; Hansen, J.M.; Husain, A.; et al. Sodium Sulfide Attenuates Ischemic-Induced Heart Failure by Enhancing Proteasomal Function in an Nrf2-Dependent Manner. Circ. Heart Fail. 2016, 9, e002368. [Google Scholar] [CrossRef]
- Ivanciuc, T.; Sbrana, E.; Casola, A.; Garofalo, R.P. Protective Role of Nuclear Factor Erythroid 2-Related Factor 2 Against Respiratory Syncytial Virus and Human Metapneumovirus Infections. Front. Immunol. 2018, 9, 854. [Google Scholar] [CrossRef]
- McDonnell, C.; Leánez, S.; Pol, O. The induction of the transcription factor Nrf2 enhances the antinociceptive effects of delta-opioid receptors in diabetic mice. PLoS ONE 2017, 12, e0180998. [Google Scholar] [CrossRef]
- Zhang, B.; Zhang, C.Y.; Zhang, X.L.; Sun, G.B.; Sun, X.B. Guan Xin Dan Shen formulation protects db/db mice against diabetic cardiomyopathy via activation of Nrf2 signaling. Mol. Med. Rep. 2021, 24, 531. [Google Scholar] [CrossRef]
- Si, Y.F.; Wang, J.; Guan, J.; Zhou, L.; Sheng, Y.; Zhao, J. Treatment with hydrogen sulfide alleviates streptozotocin-induced diabetic retinopathy in rats. Br. J. Pharmacol. 2013, 169, 619–631. [Google Scholar] [CrossRef]
- Ma, S.; Zhong, D.; Ma, P.; Li, G.; Hua, W.; Sun, Y.; Liu, N.; Zhang, L.; Zhang, W. Exogenous Hydrogen Sulfide Ameliorates Diabetes-Associated Cognitive Decline by Regulating the Mitochondria-Mediated Apoptotic Pathway and IL-23/IL-17 Expression in db/db Mice. Cell Physiol. Biochem. 2017, 41, 1838–1850. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Deng, M.; Su, J.; Lin, Y.; Jia, Z.; Peng, K.; Wang, F.; Yang, T. Specific downregulation of cystathionine β-synthase expression in the kidney during obesity. Physiol. Rep. 2018, 6, e13630. [Google Scholar] [CrossRef] [PubMed]
Reference Sequence | Forward Sequence | Reverse Sequence | |
---|---|---|---|
CBS | NM_000071.3 | aggagaagtgtcctggatgc | taggttgtctgctccgtctg |
CSE | NM_001902.6 | gcatttcaaaaacggaatgg | ctcatgctgtggatgagagg |
HO-1 | NM_002133.3 | tccgatgggtccttacactc | taaggaagcagcaagaga |
MPST | NM_021126.8 | acatcaaggagaacctggaatc | gatgtggccaggttcaatg |
Nrf-2 | NM_006164.5 | gcaacaggacattgagcaag | tggacttggaaccatggtagt |
RPLP13 | NM_012423.4 | caagcggatgaacaccaac | tgtggggcagcatacctc |
YWHAZ | NM_003406.3 | gatccccaatgcttcacaag | tgcttgttgtgactgatcgac |
Non DB-OA Patients | DB-OA Patients | Statistical Differences | |
---|---|---|---|
Sex (% women) | 91.18 | 85.71 | 0.5422 |
Age (years) | 64.82 ± 6.97 | 65.95 ± 8.88 | 0.9525 |
BMI (kg/m2) | 28.21 ± 4.70 | 29.06 ± 4.03 | 0.4306 |
Obesity (%) | 29.41 | 33.33 | 0.7702 |
Glucose levels (mg/dL) | 85.96 ± 8.90 | 130.5 ± 32.80 | <0.0001 |
Hyperglycaemia (glucose ≥110 mg/dL) (%) | 0 | 82.35 | - |
Hypertension * (%) | 41.18 | 61.90 | 0.1415 |
Body fat (%) | 41.08 ± 9.05 | 42.66 ± 9.95 | 0.3451 |
Total cholesterol (mg/dL) | 200.40 ± 29.65 | 188.30 ± 41.30 | 0.3349 |
Hypercholesterolemia (cholesterol ≥220 mg/dL) (%) | 25.93 | 29.41 | 0.8148 |
Triglycerides (mg/dL) | 101.90 ± 33.41 | 132.90 ± 61.17 | 0.0764 |
Dyslipidaemia * (%) | 52.94 | 80.95 | 0.0386 |
non DB-OA Patients | DB-OA Patients | Statistical Differences | |
---|---|---|---|
Sex (% women) | 35.71 | 30.00 | 0.7815 |
Age (years) | 71.36 ± 12.00 | 79.6 ± 9.73 | 0.1274 |
BMI (kg/m2) | 30.17 ± 6.24 | 30.24 ± 5.99 | 0.9860 |
Obesity (%) | 44.44 | 60.00 | 0.6110 |
Glucose levels (mg/mL) | 98.79 ± 18.71 | 183.9 ± 80.88 | 0.0009 |
Hyperglycaemia (glucose ≥110 mg/dL) (%) | 21.43 | 80.00 | 0.003 |
Hypertension * (%) | 50.00 | 80.00 | 0.1466 |
Total Cholesterol (mg/dL) | 150.20 ± 58.17 | 128.10 ± 31.67 | 0.2884 |
Hypercholesterolemia (cholesterol ≥220 mg/dL) (%) | 14.29 | 0.00 | - |
Triglycerides (mg/dL) | 155.70 ± 86.12 | 131.40 ± 37.67 | 0.4135 |
Hypertriglyceridemia (triglycerides ≥200 mg/dL) (%) | 28.57 | 0.00 | - |
Dyslipidaemia * (%) | 64.29 | 80.00 | 0.4259 |
Treatment for Serum Donors | Non DB-OA Patients n = 34 | DB-OA Patients n = 21 | Comparison OA-DB vs. OA-Non DB Patients | Comparison Treated vs. Non Treated (Serum H2S Levels) |
Hypertension | 36.84% | 65.22% | 0.0336 | 0.4614 |
Hypercholesterolemia | 44.74% | 73.91% | 0.0281 | 0.5516 |
Glucocorticoids | 7.89% | 4.35% | 0.6027 | - |
Hypothyroidism | 5.26% | 8.70% | 0.6148 | - |
Osteoporosis | 21.05% | 26.06% | 0.6605 | - |
Anti-aggregation/anti-coagulants | 7.89% | 17.39% | 0.2691 | - |
Methotrexate | 18.42% | 8.70% | 0.3090 | - |
Anti-inflammatory | 15.80% | 21.74% | 0.2844 | - |
Treatment for Cartilage Donors | Non DB-OA Patients n = 14 | DB-OA Patients n = 10 | Comparison OA-DB vs. OA-Non DB Patients | Comparison Treated vs. Non Treated (CBS/CSE) |
Hypertension | 43.75% | 54.55% | 0.6081 | - |
Hypercholesterolemia | 56.25% | 81.82% | 0.1840 | - |
Glucocorticoids | 6.25% | 0.00% | - | - |
Osteoporosis | 6.25% | 0.00% | - | - |
Anti-aggregation/anti-coagulants | 37.50% | 90.91% | 0.0071 | 0.3502/0.1195 |
Gout | 18.75% | 0.00% | - | - |
Methotrexate | 6.25% | 0.00% | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Piñeiro-Ramil, M.; Burguera, E.F.; Hermida-Gómez, T.; Caramés, B.; Oreiro-Villar, N.; Meijide-Faílde, R.; Blanco, F.J.; Vaamonde-García, C. Reduced Levels of H2S in Diabetes-Associated Osteoarthritis Are Linked to Hyperglycaemia, Nrf-2/HO-1 Signalling Downregulation and Chondrocyte Dysfunction. Antioxidants 2022, 11, 628. https://doi.org/10.3390/antiox11040628
Piñeiro-Ramil M, Burguera EF, Hermida-Gómez T, Caramés B, Oreiro-Villar N, Meijide-Faílde R, Blanco FJ, Vaamonde-García C. Reduced Levels of H2S in Diabetes-Associated Osteoarthritis Are Linked to Hyperglycaemia, Nrf-2/HO-1 Signalling Downregulation and Chondrocyte Dysfunction. Antioxidants. 2022; 11(4):628. https://doi.org/10.3390/antiox11040628
Chicago/Turabian StylePiñeiro-Ramil, María, Elena F. Burguera, Tamara Hermida-Gómez, Beatriz Caramés, Natividad Oreiro-Villar, Rosa Meijide-Faílde, Francisco J. Blanco, and Carlos Vaamonde-García. 2022. "Reduced Levels of H2S in Diabetes-Associated Osteoarthritis Are Linked to Hyperglycaemia, Nrf-2/HO-1 Signalling Downregulation and Chondrocyte Dysfunction" Antioxidants 11, no. 4: 628. https://doi.org/10.3390/antiox11040628
APA StylePiñeiro-Ramil, M., Burguera, E. F., Hermida-Gómez, T., Caramés, B., Oreiro-Villar, N., Meijide-Faílde, R., Blanco, F. J., & Vaamonde-García, C. (2022). Reduced Levels of H2S in Diabetes-Associated Osteoarthritis Are Linked to Hyperglycaemia, Nrf-2/HO-1 Signalling Downregulation and Chondrocyte Dysfunction. Antioxidants, 11(4), 628. https://doi.org/10.3390/antiox11040628