Dietary Glutamine Inclusion Regulates Immune and Antioxidant System, as Well as Programmed Cell Death in Fish to Protect against Flavobacterium columnare Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fish Husbandry
2.2. Experimental Diet Preparation and Feeding
2.3. Bacterial Challenge Experiment
2.4. Histopathological Structure
2.5. Enzyme Activity Assay
2.6. RNA Extraction and cDNA Preparation
2.7. Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis
2.8. TdT-Mediated dUTP Nick-End Labeling (TUNEL) Assays
2.9. Western Blotting Analysis
2.10. Statistical Analysis
3. Results
3.1. Dietary Glutamine Significantly Increased Growth Performance, Feed Utilization and the Disease Resistance of Yellow Catfish
3.2. Glutamine Differentially Regulated Cytokines Expression in Multiple Fish Tissues after Bacterial Infection
3.3. Glutamine Enhanced Fish Antioxidant Capacity against F. columnare Infection
3.4. Glutamine Protected Fish Gill Structures against F. columnare Infection
3.5. Glutamine Inhibited the Apoptosis of Fish Gill during Bacterial Infection
3.6. Glutamine Inhibited the Autophagy of Yellow Catfish via the Activation of mTOR Signaling
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
DAMP | damage-associated molecular patterns |
FA | fatty acids |
FBW | final body weight |
FCR | feed conversion ratio |
FSGD | fish specific genome duplication |
Gln | glutamine |
MAPK | mitogen-activated protein kinase |
mTOR | mechanistic target of rapamycin |
ROS | reactive oxygen species |
SGR | specific growth rate |
TAOC | total antioxidant capacity |
TG | triglyceride |
WGR | weight gain ratio |
References
- Pkala-Safińska, A. Contemporary threats of bacteribal infectioins in freshwater fish. J. Vet. Res. 2018, 62, 261–267. [Google Scholar] [CrossRef] [Green Version]
- Yu, Y.; Wang, Q.; Huang, Z.; Ding, L.; Xu, Z. Immunoglobulins, mucosal immunity and vaccination in teleost fish. Front. Immunol. 2020, 11, 567941. [Google Scholar] [CrossRef] [PubMed]
- Gomez, D.; Sunyer, J.O.; Salinas, I. The mucosal immune system of fish: The evolution of tolerating commensals while fighting pathogens. Fish Shellfish Immunol. 2013, 35, 1729–1739. [Google Scholar] [CrossRef] [Green Version]
- Peatman, E.; Lange, M.; Zhao, H.; Beck, B.H. Physiology and immunology of mucosal barriers in catfish (Ictalurus spp.). Tissue Barriers 2015, 3, e1068907. [Google Scholar] [CrossRef] [Green Version]
- Dash, S.; Das, S.K.; Samal, J.; Thatoi, H.N. Epidermal mucus, a major determinant in fish health: A review. Iran. J. Vet. Res. 2018, 19, 72–81. [Google Scholar] [CrossRef] [PubMed]
- Swelum, A.A.; Elbestawy, A.R.; El-Saadony, M.T.; Hussein, E.O.S.; Alhotan, R.; Suliman, G.M.; Taha, A.E.; Ba-Awadh, H.; El-Tarabily, K.A.; Abd El-Hack, M.E. Ways to minimize bacterial infections, with special reference to Escherichia coli, to cope with the first-week mortality in chicks: An updated overview. Poult. Sci. 2021, 100, 101039. [Google Scholar] [CrossRef] [PubMed]
- Boehm, T.; Swann, J.B. Origin and evolution of adaptive immunity. Annu. Rev. Anim. Biosci. 2014, 2, 259–283. [Google Scholar] [CrossRef]
- Buchmann, K. Evolution of innate immunity: Clues from invertebrates via fish to mammals. Front. Immunol. 2014, 5, 459. [Google Scholar] [CrossRef] [Green Version]
- Kurien, B.T.; Scofield, R.H. Free radical mediated peroxidative damage in systemic lupus erythematosus. Life Sci. 2003, 73, 1655–1666. [Google Scholar] [CrossRef]
- Hermans, N.; Cos, P.; Maes, L.; De Bruyne, T.; Vanden Berghe, D.; Vlietinck, A.J.; Pieters, L. Challenges and pitfalls in antioxidant research. Curr. Med. Chem. 2007, 14, 417–430. [Google Scholar] [CrossRef]
- Ighodaro, O.M.; Akinloye, O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 2018, 54, 287–293. [Google Scholar] [CrossRef] [Green Version]
- Deretic, V. Autophagy in infection. Curr. Opin. Cell Biol. 2010, 22, 252–262. [Google Scholar] [CrossRef]
- Jorgensen, I.; Rayamajhi, M.; Miao, E.A. Programmed cell death as a defence against infection. Nat. Rev. Immunol. 2017, 17, 151–164. [Google Scholar] [CrossRef] [PubMed]
- Deretic, V. Autophagy: An emerging immunological paradigm. J. Immunol. 2012, 189, 15–20. [Google Scholar] [CrossRef] [PubMed]
- Schaefer, L. Complexity of danger: The diverse nature of damage-associated molecular patterns. J. Biol. Chem. 2014, 289, 35237–35245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mizushima, N.; Alerting, E.; Articles, C.D.; Mizushima, N. Review autophagy: Process and function. Genes Dev. 2007, 21, 2861–2873. [Google Scholar] [CrossRef] [Green Version]
- Naderer, T.; Fulcher, M.C. Targeting apoptosis pathways in infections. J. Leukoc. Biol. 2018, 103, 275–285. [Google Scholar] [CrossRef]
- Tribble, G.D.; Lamont, R.J. Bacterial invasion of epithelial cells and spreading in periodontal tissue. Periodontology 2010, 52, 68–83. [Google Scholar] [CrossRef]
- Peter, K.; Judit, K.A. The interaction between nutrition and infection. Clin. Infect. Dis. 2008, 1582–1588. [Google Scholar] [CrossRef]
- Kedia-Mehta, N.; Finlay, D.K. Competition for nutrients and its role in controlling immune responses. Nat. Commun. 2019, 10, 2123. [Google Scholar] [CrossRef]
- Calder, P.C.; Samantha, K. The immune system: A target for functional foods? Br. J. Nutr. 2002, 88, 165–177. [Google Scholar] [CrossRef]
- Wu, D.; Lewis, E.D.; Pae, M.; Meydani, S.N. Nutritional modulation of immune function: Analysis of evidence, mechanisms and clinical relevance. Front. Immunol. 2019, 9, 3160. [Google Scholar] [CrossRef]
- Delesderrier, E.; Curioni, C.; Omena, J.; Macedo, C.R.; Cople-Rodrigues, C.; Citelli, M. Antioxidant nutrients and hemolysis in sickle cell disease. Clin. Chim. Acta 2020, 510, 381–390. [Google Scholar] [CrossRef] [PubMed]
- Rajendran, P.; Nandakumar, N.; Rengarajan, T.; Palaniswami, R.; Gnanadhas, E.N.; Lakshminarasaiah, U.; Gopas, J.; Nishigaki, I. Antioxidants and human diseases. Clin. Chim. Acta 2014, 436, 332–347. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Hyde, A.S.; Simpson, M.A.; Barycki, J.J. Emerging regulatory paradigms in glutathione metabolism. Adv. Cancer Res. 2014, 122, 69–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, S.; Tian, H.; Lin, J.; Xu, C.; Yuan, Y.; Gao, S.; Song, C.; Lv, P.; Mei, X. Zinc promotes autophagy and inhibits apoptosis through AMPK/mTOR signaling pathway after spinal cord injury. Neurosci. Lett. 2020, 736, 135263. [Google Scholar] [CrossRef]
- Sa-Nongdej, W.; Chongthammakun, S.; Songthaveesin, C. Nutrient starvation induces apoptosis and autophagy in C6 glioma stem-like cells. Heliyon 2021, 26, e06352. [Google Scholar] [CrossRef]
- Li, P.; Yin, Y.L.; Li, D.; Kim, S.W.; Wu, G. Amino acids and immune function. Br. J. Nutr. 2007, 98, 237–252. [Google Scholar] [CrossRef] [Green Version]
- Xi, P.; Jiang, Z.; Dai, Z.; Li, X.; Yao, K.; Zheng, C.; Lin, Y.; Wang, J.; Wu, G. Regulation of protein turnover by l-glutamine in porcine intestinal epithelial cells. J. Nutr. Biochem. 2012, 23, 1012–1017. [Google Scholar] [CrossRef]
- Tomé, D. The roles of dietary glutamate in the intestine. Ann. Nutr. Metab. 2018, 73, 15–20. [Google Scholar] [CrossRef]
- Pires, R.S.; Braga, P.G.S.; Santos, J.M.B.; Amaral, J.B.; Amirato, G.R.; Trettel, C.S.; Dos Santos, C.A.F.; Vaisberg, M.; Nali, L.H.S.; Vieira, R.P.; et al. l-Glutamine supplementation enhances glutathione peroxidase and paraoxonase-1 activities in HDL of exercising older individuals. Exp. Gerontol. 2021, 156, 111584. [Google Scholar] [CrossRef] [PubMed]
- Cruzat, V.; Macedo Rogero, M.; Noel Keane, K.; Curi, R.; Newsholme, P. Glutamine: Metabolism and immune function, supplementation and clinical translation. Nutrients 2018, 10, 1564. [Google Scholar] [CrossRef] [Green Version]
- Koufaris, C.; Nicolaidou, V.; Ma, J. Glutamine addiction in virus-infected mammalian cells: A target of the innate immune system? Med. Hypotheses 2021, 153, 110620. [Google Scholar] [CrossRef]
- Kim, J.; Song, G.; Wu, G.; Gao, H.; Johnson, G.A.; Bazer, F.W. Arginine, leucine and glutamine stimulate proliferation of porcine trophectoderm cells through the mTOR-RPS6K-RPS6-EIF4EBP1 signal transduction pathway. Biol. Reprod. 2013, 88, 113. [Google Scholar] [CrossRef] [Green Version]
- Evans, M.E.; Jones, D.P.; Ziegler, T.R. Glutamine prevents cytokine-induced apoptosis in human colonic epithelial cells. J. Nutr. 2003, 133, 3065–3071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ban, K.; Kozar, R.A. Glutamine protects against apoptosis via downregulation of Sp3 in intestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 299, 1344–1353. [Google Scholar] [CrossRef] [Green Version]
- Marc Rhoads, J.; Wu, G. Glutamine, arginine and leucine signaling in the intestine. Amino Acids 2009, 37, 111–122. [Google Scholar] [CrossRef]
- Rhoads, J.M.; Argenzio, R.A.; Chen, W.; Graves, L.M.; Licato, L.L.; Blikslager, A.T.; Smith, J.; Gatzy, J.; Brenner, D.A. Glutamine metabolism stimulates intestinal cell MAPKs by a cAMP-inhibitable, RAF-independent mechanism. Gastroenterology 2000, 118, 90–100. [Google Scholar] [CrossRef]
- Yi, D.; Hou, Y.; Wang, L.; Ouyang, W.; Long, M.; Zhao, D.; Ding, B.; Liu, Y.; Wu, G. L-Glutamine enhances enterocyte growth via activation of the mTOR signaling pathway independently of AMPK. Amino Acids 2015, 47, 65–78. [Google Scholar] [CrossRef] [PubMed]
- Meng, D.; Yang, Q.; Wang, H.; Melick, C.H.; Jewell, J.L. Glutamine and asparagine activate mTORC1 independently of Rag GTPases. J. Biol. Chem. 2020, 295, 2890–2899. [Google Scholar] [CrossRef] [Green Version]
- Ogunlesi, F.; Cho, C.; Mcgrath-Morrow, S.A. The effect of glutamine on A549 cells exposed to moderate hyperoxia. Biochim. Biophys. Acta 2004, 1688, 112–120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larson, S.D.; Jing, L.; Dai, H.C.; Evers, B.M. Molecular mechanisms contributing to glutamine-mediated intestinal cell survival. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 293, G1262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, M.H.; Kim, H. The roles of glutamine in the intestine and its implication in intestinal diseases. Int. J. Mol. Sci. 2017, 18, 1051. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, B.; Wu, G.; Zhou, Z.; Dai, Z.; Sun, Y.; Ji, Y.; Li, W.; Wang, W.; Liu, C.; Han, F.; et al. Glutamine and intestinal barrier function. Amino Acids 2015, 47, 2143–2154. [Google Scholar] [CrossRef]
- Reeds, P.J.; Burrin, D.G. Glutamine and the bowel. J. Nutr. 2001, 131, 2505S–2508S. [Google Scholar] [CrossRef] [Green Version]
- Ji, F.J.; Wang, L.X.; Yang, H.S.; Hu, A.; Yin, Y.L. Review: The roles and functions of glutamine on intestinal health and performance of weaning pigs. Animal 2019, 13, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Lin, G.; Dai, Z.; Zhou, T.; Li, T.; Yuan, T.; Wu, Z.; Wu, G.; Wang, J. L-Glutamine deprivation induces autophagy and alters the mTOR and MAPK signaling pathways in porcine intestinal epithelial cells. Amino Acids 2015, 47, 2185–2197. [Google Scholar] [CrossRef]
- Coutinho, F.; Castro, C.; Rufino-Palomares, E.; Ordóñez-Grande, B.; Gallardo, M.A.; Oliva-Teles, A.; Peres, H. Dietary glutamine supplementation effects on amino acid metabolism, intestinal nutrient absorption capacity and antioxidant response of gilthead sea bream (Sparus aurata) juveniles. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2016, 191, 9–17. [Google Scholar] [CrossRef]
- Ma, X.Z.; Feng, L.; Wu, P.; Liu, Y.; Kuang, S.Y.; Tang, L.; Zhou, X.Q.; Jiang, W.D. Enhancement of flavor and healthcare substances, mouthfeel parameters and collagen synthesis in the muscle of on-growing grass carp (Ctenopharyngodon idella) fed with graded levels of glutamine. Aquaculture 2020, 528, 735486. [Google Scholar] [CrossRef]
- Sato, Y.; Hashiguchi, Y.; Nishida, M. Temporal pattern of loss/persistence of duplicate genes involved in signal transduction and metabolic pathways after teleost-specific genome duplication. BMC. Evol. Biol. 2009, 9, 127. [Google Scholar] [CrossRef] [Green Version]
- Ravi, V.; Venkatesh, B. The divergent genomes of teleosts. Annu. Rev. Anim. Biosci. 2018, 6, 47–68. [Google Scholar] [CrossRef] [PubMed]
- Gong, G.; Dan, C.; Xiao, S.; Guo, W.; Huang, P.; Xiong, Y. Chromosomal-level assembly of yellow catfish genome using third-generation DNA sequencing and Hi-C analysis. Gigascience 2018, 7, giy120. [Google Scholar] [CrossRef]
- Song, Y.F.; Hogstrand, C.; Ling, S.C.; Chen, G.H.; Luo, Z. Creb-Pgc1α pathway modulates the interaction between lipid droplets and mitochondria and influences high fat diet-induced changes of lipid metabolism in the liver and isolated hepatocytes of yellow catfish. J. Nutrl. Biochem. 2020, 80, 108364. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.; Zhao, T.; Hogstrand, C.; Xu, Y.C.; Luo, Z. FXR-mediated inhibition of autophagy contributes to FA-induced TG accumulation and accordingly reduces FA-induced lipotoxicity. Cell Commun. Signal 2020, 18, 47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evenhuis, J.P.; Mohammed, H.; Lapatra, S.E.; Welch, T.J.; Arias, C.R. Virulence and molecular variation of Flavobacterium columnare affecting rainbow trout in Idaho, USA. Aquaculture 2016, 464, 106–110. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Shen, J.; Yan, Z.; Xiang, X.; Mu, R.; Zhu, P.; Yao, Y.; Zhu, F.; Chen, K.; Chi, S.; et al. Dietary glycyrrhiza uralensis extracts supplementation elevated growth performance, immune responses and disease resistance against Flavobacterium columnare in yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 2020, 97, 153–164. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, X.; Luo, Y.; Wan, X.; Yao, Y.; Zhang, L.; Yu, Y.; Ai, T.; Wang, Q.; Xu, Z. IgM and IgD heavy chains of yellow catfish (Pelteobagrus fulvidraco): Molecular cloning, characterization and expression analysis in response to bacterial infection. Fish Shellfish Immunol. 2019, 84, 233–243. [Google Scholar] [CrossRef]
- Xu, Z.; Takizawa, F.; Casadei, E.; Shibasaki, Y.; Sunyer, J.O. Specialization of mucosal immunoglobulins in pathogen control and microbiota homeostasis occurred early in vertebrate evolution. Sci. Immunol. 2020, 5, eaay3254. [Google Scholar] [CrossRef]
- Wang, Q.; He, G.; Mai, K.; Xu, W.; Zhou, H.; Wang, X.; Mei, L. Chronic rapamycin treatment on the nutrient utilization and metabolism of juvenile turbot (Psetta maxima). Sci. Rep. 2016, 6, 28068. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Zheng, S.; Jia, S.; Song, F.; Wu, G. Oxidation of energy substrates in tissues of largemouth bass (Micropterus salmoides). Amino Acids 2020, 52, 1017–1032. [Google Scholar] [CrossRef]
- Declercq, A.M.; Haesebrouck, F.; Van den Broeck, W.; Bossier, P.; Decostere, A. Columnaris disease in fish: A review with emphasis on bacterium-host interactions. Vet. Res. 2013, 44, 27. [Google Scholar] [CrossRef] [Green Version]
- Deters, B.J.; Saleem, M. The role of glutamine in supporting gut health and neuropsychiatric factors-ScienceDirect. Food Sci. Human Wellness 2021, 10, 149–154. [Google Scholar] [CrossRef]
- Lai, Y.N.; Yeh, S.L.; Lin, M.T.; Shang, H.F.; Yeh, C.L.; Chen, W.J. Glutamine supplementation enhances mucosal immunity in rats with Gut-Derived sepsis. Nutrition 2004, 20, 286–291. [Google Scholar] [CrossRef]
- Zhang, F.; Wang, X.; Pan, L.; Wang, W.; Li, N.; Li, J. Glutamine attenuates lipopolysaccharide-induced acute lung injury. Nutrition 2009, 25, 692–698. [Google Scholar] [CrossRef] [PubMed]
- Vigeland, C.L.; Beggs, H.S.; Collins, S.L.; Chan-Li Yv Powell, J.D.; Doerschuk, C.M.; Horton, M.R. Inhibition of glutamine metabolism accelerates resolution of acute lung injury. Physiol. Rep. 2019, 7, e14019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pohlenz, C.; Buentello, A.; Bakke, A.M.; Gatlin, D.M. Free dietary glutamine improves intestinal morphology and increases enterocyte migration rates, but has limited effects on plasma amino acid profile and growth performance of channel catfish Ictalurus punctatus. Aquaculture 2012, 370, 32–39. [Google Scholar] [CrossRef]
- Cheng, Z.Y.; Gatlin, D.M.; Buentello, A. Dietary supplementation of arginine and/or glutamine influences growth performance, immune responses and intestinal morphology of hybrid striped bass (Morone chrysops × Morone saxatilis). Aquaculture 2012, s362, 39–43. [Google Scholar] [CrossRef]
- Feng, L.; Luo, J.B.; Jiang, W.D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.Y.; Tang, L.; Zhang, Y.A.; Zhou, X.Q. Changes in barrier health status of the gill for grass carp (Ctenopharyngodon idella) during valine deficiency: Regulation of tight junction protein transcript, antioxidant status and apoptosis-related gene expression. Fish Shellfish Immunol. 2015, 45, 239–249. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.D.; Wen, H.L.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Wu, P.; Zhao, J.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. The tight junction protein transcript abundance changes and oxidative damage by tryptophan deficiency or excess are related to the modulation of the signalling molecules, NF-κB p65,TOR,caspase-(3,8,9) and Nrf2 mRNA levels, in the gill of young grass carp (Ctenopharyngodon idellus). Fish Shellfish Immunol. 2015, 46, 168–180. [Google Scholar] [CrossRef]
- Feng, L.; Gan, L.; Jiang, W.D.; Wu, P.; Liu, Y.; Jiang, J.; Tang, L.; Kuang, S.Y.; Tang, W.N.; Zhang, Y.A.; et al. Gill structural integrity changes in fish deficient or excessive in dietary isoleucine: Towards the modulation of tight junction protein, inflammation, apoptosis and antioxidant defense via NF-κB, TOR and Nrf2 signaling pathways. Fish Shellfish Immunol. 2017, 63, 127–138. [Google Scholar] [CrossRef]
- Xu, H.J.; Jiang, W.D.; Feng, L.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. Vitamin E deficiency depressed gill immune response and physical barrier referring to NF-kB, TOR, Nrf2 and MLCK signalling in grass carp (Ctenopharyngodon idella) under infection of Flavobacterium columnare. Aquaculture 2018, 484, 13–27. [Google Scholar] [CrossRef]
- Chen, K.; Zhou, X.Q.; Jiang, W.D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. Dietary phosphorus deficiency caused alteration of gill immune and physical barrier function in the grass carp (Ctenopharyngodon idella) after infection with Flavobacterium columnare. Aquaculture 2019, 506, 1–13. [Google Scholar] [CrossRef]
- Zheng, X.; Feng, L.; Jiang, W.D.; Wu, P.; Liu, Y.; Kuang, S.Y.; Tang, L.; Zhou, X.Q. The regulatory effects of pyridoxine deficiency on the grass carp (Ctenopharyngodon idella) gill barriers immunity, apoptosis, antioxidant and tight junction challenged with Flavobacterium columnar. Fish Shellfish Immunol. 2020, 105, 209–223. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Z.H.; Jiang, W.D.; Feng, L.; Wu, P.; Liu, Y.; Kuang, S.Y.; Tang, L.; Zhou, X.Q. Dietary choline inhibited the gill apoptosis in association with the p38MAPK and JAK/STAT3 signalling pathways of juvenile grass carp (Ctenopharyngodon idella). Aquaculture 2020, 529, 735699. [Google Scholar] [CrossRef]
- Salinas, I.; Zhang, Y.A.; Sunyer, J.O. Mucosal immunoglobulins and B cells of teleost fish. Dev. Comp. Immunol. 2011, 35, 1346–1365. [Google Scholar] [CrossRef] [Green Version]
- Al-Banna, N.A.; Cyprian, F.; Albert, M.J. Cytokine responses in campylobacteriosis: Linking pathogenesis to immunity. Cytokine Growth Factor Rev. 2018, 41, 75–87. [Google Scholar] [CrossRef]
- Kogut, M.H.; Genovese, K.J.; Swaggerty, C.L.; He, H.; Broom, L. Inflammatory phenotypes in the intestine of poultry: Not all inflammation is created equal. Poultry Sci. 2018, 97, 2339–2346. [Google Scholar] [CrossRef] [PubMed]
- Peng, C.K.; Huang, K.L.; Wu, C.P.; Li, M.H.; Hu, Y.T.; Hsu, C.W.; Tsai, S.H.; Chu, S.J. Glutamine protects ischemia-reperfusion induced acute lung injury in isolated rat lungs. Pulm Pharmacol. Ther. 2011, 24, 153–161. [Google Scholar] [CrossRef]
- Yang, L.; Chen, Z.; Dai, J.; Pei, Y.; Hu, H.; Ai, Q. The protective role of glutamine on enteropathy induced by high dose of soybean meal in turbot, Scophthalmus maximus L. Aquaculture 2018, 497, 510–519. [Google Scholar] [CrossRef]
- Chen, J.; Zhou, X.Q.; Lin, F.; Liu, Y.; Jiang, J. Effects of glutamine on hydrogen peroxide-induced oxidative damage in intestinal epithelial cells of Jian carp (Cyprinus carpio var. Jian). Aquaculture 2009, 288, 285–289. [Google Scholar] [CrossRef]
- Liu, J.; Mai, K.; Xu, W.; Zhang, Y.; Zhou, H.; Ai, Q. Effects of dietary glutamine on survival, growth performance, activities of digestive enzyme, antioxidant status and hypoxia stress resistance of half-smooth tongue sole (Cynoglossus semilaevis Günther) post larvae. Aquaculture 2015, 446, 48–56. [Google Scholar] [CrossRef]
- Xu, H.; Zhu, Q.; Wang, C.; Zhao, Z.; Luo, L.; Wang, L.; Li, J.; Xu, Q. Effect of dietary Alanyl-glutamine supplementation on growth performance, development of intestinal tract, antioxidant status and plasma non-specific immunity of young mirror carp (Cyprinus carpio L.). J. Northeast. Agric. Univ. 2014, 21, 37–46. [Google Scholar] [CrossRef]
- Yu, H.; Gao, Q.; Dong, S.; Lan, Y.; Ye, Z.; Wen, B. Regulation of dietary glutamine on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka). Fish Shellfish Immunol. 2016, 50, 56–65. [Google Scholar] [CrossRef]
- Lamkanfi, M.; Dixit, V.M. Manipulation of host cell death pathways during microbial infections. Cell Host Microbe 2010, 8, 44–54. [Google Scholar] [CrossRef] [Green Version]
- Labbé, K.; Saleh, M. Cell death in the host response to infection. Cell Death Differ. 2008, 15, 1339–1349. [Google Scholar] [CrossRef] [Green Version]
- Portt, L.; Norman, G.; Clapp, C.; Greenwood, M.; Greenwood, M.T. Anti-apoptosis and cell survival: A review. Biochimi. Biophys. Acta 2011, 1813, 238–259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kunttu, H.; Suomalainen, L.R.; Jokinen, E.I.; Valtonen, E.T. Flavobacterium columnare colony types: Connection to adhesion and virulence? Microb. Pathog. 2009, 46, 21–27. [Google Scholar] [CrossRef]
- Lu, Z.; Yang, M.; Zhang, K.; Zhan, F.; Qin, Z. Aeromonas hydrophila infection activates death receptor apoptosis pathway in the red blood cells of grass carp (Ctenopharyngodon idellus). Aquaculture 2021, 532, 735956. [Google Scholar] [CrossRef]
- Papaconstantinou, H.T.; Chung, D.H.; Zhang, W.; Ansari, N.H.; Hellmich, M.R.; Townsend, C.M., Jr.; Ko, T.C. Prevention of mucosal atrophy: Role of glutamine and caspases in apoptosis in intestinal epithelial cells. J. Gastrointest. Surg. 2000, 4, 416–423. [Google Scholar] [CrossRef]
- Kwon, W.Y.; Suh, G.J.; Kim, K.S.; Jo, Y.H.; Lee, J.H.; Kim, K.; Jung, S.K. Glutamine attenuates acute lung injury by inhibition of high mobility group box protein-1 expression during sepsis. Br. J. Nutr. 2010, 103, 890–898. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Jiang, W.; Liu, Y.; Jiang, J.; Zhang, Y.; Wu, P.; Zhao, J.; Duan, X.; Zhou, X.; Feng, L. The metabolites of glutamine prevent hydroxyl radical-induced apoptosis through inhibiting mitochondria and calcium ion involved pathways in fish erythrocytes. Free Radic. Biol. Med. 2016, 92, 126–140. [Google Scholar] [CrossRef] [Green Version]
- Brouwer, I.J.; Out-Luiting, J.; Vermeer, M.H.; Tensen, C.P. Cucurbitacin E and I target the JAK/STAT pathway and induce apoptosis in Sézary cells. Biochem. Biophys. Rep. 2020, 24, 100832. [Google Scholar] [CrossRef] [PubMed]
- Kiu, H.; Nicholson, S.E. Biology and significance of the JAK/STAT signalling pathways. Growth Factors 2012, 30, 88–106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, Z.; Jiao, C.; Chen, B. Dietary Acanthopanax senticosus extracts modulated the inflammatory and apoptotic responses of yellow catfish to protect against Edwardsiella ictaluri infection. Aquac. Res. 2021, 52, 5078–5092. [Google Scholar] [CrossRef]
- Deretic, V.; Levine, B. Autophagy, immunity and microbial adaptations. Cell Host Microbe 2009, 3, 527–549. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ling, S.C.; Wu, K.; Zhang, D.G.; Luo, Z. Endoplasmic reticulum stress–mediated autophagy and apoptosis alleviate dietary fat-induced triglyceride accumulation in the intestine and in isolated intestinal epithelial cells of yellow catfish. J. Nutr. 2019, 149, 1732–1741. [Google Scholar] [CrossRef]
- Fujita, N.; Hayashi-Nishino, M.; Fukumoto, H.; Omori, H.; Yamamoto, A.; Noda, T.; Yoshimori, T. An Atg4B mutant hampers the lipidation of LC3 paralogues and causes defects in autophagosome closure. Mol. Biol. Cell 2008, 19, 4651–4659. [Google Scholar] [CrossRef] [Green Version]
- Wei, C.C.; Zhi, L.; Hogstrand, C.; Xu, Y.H.; Song, Y.F. Zinc reduces hepatic lipid deposition and activates lipophagy via Zn2+ /MTF-1/PPARα and Ca2+ /CaMKKβ/AMPK pathways. FFASEB J. 2018, 32, 6666–6680. [Google Scholar] [CrossRef]
- Neufeld, T.P. TOR-dependent control of autophagy: Biting the hand that feeds. Curr. Opin. Cell Biol. 2010, 22, 157–168. [Google Scholar] [CrossRef] [Green Version]
- Wu, K.; Chen, G.H.; Hogstrand, C.; Ling, S.C.; Wu, L.X.; Luo, Z. Methionine-chelated Zn promotes anabolism by integrating mTOR signal and autophagy pathway in juvenile yellow catfish. J. Trace Elem. Med. Biol. 2021, 65, 126732. [Google Scholar] [CrossRef]
Ingredient | % | Ingredient | % |
---|---|---|---|
Fish meal | 5 | Vitamin premix a | 1 |
Wheat gluten meal | 8 | Mineral premix b | 1.5 |
Corn gluten meal | 14 | Monocalcium phosphate | 1.5 |
Soybean meal | 29 | Choline chloride | 0.5 |
Fish oil | 2.5 | Ethoxy quinoline | 0.05 |
Soybean oil | 2.5 | Sodium alginate | 2 |
Soy lecithin | 1 | ||
Wheat meal | 31.45 | ||
Proximate composition (%) | |||
Crude protein | 39.62 | ||
Crude lipid | 7.49 |
Gene Name AN | Accession No. | Forward Sequence | Reverse Sequence |
---|---|---|---|
Inflammatory cytokines | |||
il-8 | KY218792.1 | CACCACGATGAAGGCTGCAACTC | TGTCCTTGGTTTCCTTCTGG |
il-1β | MF770571.1 | CGGCAGATGTGACCTGCACA | CAGAGTAAAAGCCAGCAGAAG |
p65nfκb | KY751029.1 | ACTACGTGGGTCATGCTCGG | TGCTGCAGGTTCCGTTCTCA |
myd88 | MH778540.1 | GAGGTGTAAGAGGATGGTGGTT | TGTGGAGGGTCTGGTGTAGTCA |
Apoptosis-related genes | |||
caspase3 | KY072821 | TCTACGGCACAGATGGATCC | TGTGTGCCTTCTGACTCACT |
caspase9 | KY053837 | TTCTGTCGAGGGGCATCTTT | AGGAACGGGTACAGGAACAG |
apaf1 | KY053839 | ACCGCCAAATAGCAACCTG | CTGCTCCTCGTGCTCAACAT |
p53 | HQ419002.1 | TGGGAAAACGAAGAGCAAAT | ATCGGAGGTGACAGGGACA |
baxa | KY072819 | TCGGAGACGAACTGGACAAC | TCGACAAGCAAAGTAGAAAAGC |
bcl2 | KY053838.1 | TTTCACCGCCGTGATCG | CCAACTTGCTATGTTGTCCACC |
JAK-STAT signaling | |||
jak1 | XM_027146298.1 | CGGAACCTCTGAAAACAAGTC | TGTCCCCGAGAAAAGAGATAG |
stat3 | KP342389.1 | ACTCCGGTTGCCAAATCACT | CCTCATTCCACAGAGCCAGTAT |
stat5 | KP342392.1 | ATCACCAGACCACAGGCACC | CACCACGACAGGCAAAGACAG |
Autophagy | |||
becn1 | KY062770 | CTCAACTGGACCGCCTGAAGAAA | CACTCCACAGGAACGCTGGGTAAT |
ulk1a | KY404999 | GCGATTAAACAGGGCAAACTCTATCC | GCTGTGATGTTGTTCATTCGGTCC |
atg5 | KY062771 | CAGAACCGTTTTATCTTCTCCTACCG | CGTCTACATCTTCAGCTTTCACGACTT |
lc3β | KY062774 | CCTGACCACGTCAACATGAGCGAACT | GGAAATGGCGGCAGACACGGAGA |
Antioxidant enzymes | |||
cat | NW0208479561 1 | TCTGTTCCCGTCCTTCATCC | ATATCCGTCAGGCAATCCAC |
gpx | XR_003438442.1 | ATCTACATTGGCTTGGAAAC | GAAAGTAGGGACTGAGGTGA |
Cu/Zn-sododDsod | KT751173.1 | GGCGGAGATGATGAAAGT | GAAAGGAAGCGGTGAAAC |
Mn-sod | KT751172.1 | TGGTGCTTGCTATGGTGA | GGCTTGAATCCCTTGCTG |
ef1α | KR061492.1 | GTCTGGAGATGCTGCCATTG | AGCCTTCTTCTCAACGCTCT |
IBW (g) | FBW (g) | WGR (%) | SGR (%/day) | FCR | SR (%) | |
---|---|---|---|---|---|---|
Con | 4.61 ± 0.02 | 28.04 ± 0.30 | 507.74 ± 6.84 | 1.40 ± 0.01 | 1.07 ± 0.01 | 73 ± 4 |
Gln | 4.66 ± 0.02 | 29.38 ± 0.09 | 530.44 ± 2.29 | 1.43 ± 0.00 | 0.94 ± 0.04 | 92 ± 4 |
p | 0.159 | 0.012 | 0.035 | 0.036 | 0.042 | 0.033 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiao, C.; Zou, J.; Chen, Z.; Zheng, F.; Xu, Z.; Lin, Y.-H.; Wang, Q. Dietary Glutamine Inclusion Regulates Immune and Antioxidant System, as Well as Programmed Cell Death in Fish to Protect against Flavobacterium columnare Infection. Antioxidants 2022, 11, 44. https://doi.org/10.3390/antiox11010044
Jiao C, Zou J, Chen Z, Zheng F, Xu Z, Lin Y-H, Wang Q. Dietary Glutamine Inclusion Regulates Immune and Antioxidant System, as Well as Programmed Cell Death in Fish to Protect against Flavobacterium columnare Infection. Antioxidants. 2022; 11(1):44. https://doi.org/10.3390/antiox11010044
Chicago/Turabian StyleJiao, Congrui, Jiahong Zou, Zhenwei Chen, Feifei Zheng, Zhen Xu, Yu-Hung Lin, and Qingchao Wang. 2022. "Dietary Glutamine Inclusion Regulates Immune and Antioxidant System, as Well as Programmed Cell Death in Fish to Protect against Flavobacterium columnare Infection" Antioxidants 11, no. 1: 44. https://doi.org/10.3390/antiox11010044
APA StyleJiao, C., Zou, J., Chen, Z., Zheng, F., Xu, Z., Lin, Y.-H., & Wang, Q. (2022). Dietary Glutamine Inclusion Regulates Immune and Antioxidant System, as Well as Programmed Cell Death in Fish to Protect against Flavobacterium columnare Infection. Antioxidants, 11(1), 44. https://doi.org/10.3390/antiox11010044