Co-Fermentation by Lactobacillus brevis B7 Improves the Antioxidant and Immunomodulatory Activities of Hydroponic Ginseng-Fortified Yogurt
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials for Yogurt Preparation
2.2. HPLC Analysis of Hydroponic Ginseng Extract
2.3. Preparation of Yogurt and Its Water-Soluble Extract
2.4. Physicochemical and Microbial Properties of Yogurts
2.5. Antioxidant Activity of Yogurt
2.5.1. DPPH Radical-Scavenging Activity
2.5.2. ABTS Radical-Scavenging Activity
2.5.3. Reducing-Power Activity
2.5.4. FRAP Activity
2.6. Estimation of Cytotoxicity and Nitric Oxide Productivity
2.6.1. MTT Assay for Estimation of Cytotoxicity
2.6.2. NO Assay for Estimation of Immunomodulatory Activity
2.7. Immunomodulatory Activity of Yogurts
2.8. Sensory Evaluation of Yogurt
2.9. Statistical Analysis
3. Results and Discussion
3.1. Ginsenoside Composition of Hydroponic Ginseng Extract
3.2. Changes in pH, Titratable Acidity, and Bacterial Growth during Yogurt Fermentation
3.3. Physicochemical Properties of Hydroponic Ginseng-Supplemented Probiotic Yogurts
3.4. Antioxidant Activities of Ginseng-Supplemented Probiotic Yogurts
3.5. Cytotoxicity of Hydroponic Ginseng-Supplemented Probiotic Yogurts
3.6. Nitric Oxide Productivity of Hydroponic Ginseng-Supplemented Probiotic Yogurts
3.7. Immunomodulatory Activities of Hydroponic-Ginseng-Supplemented Probiotic Yogurts
3.8. Sensory Evaluation of Hydroponic-Ginseng-Supplemented Probiotic Yogurts
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lai, P.K.; Roy, J. Antimicrobial and chemopreventive properties of herbs and spices. Curr. Med. Chem. 2004, 11, 1451–1460. [Google Scholar] [CrossRef] [PubMed]
- Bin, S.; Yi-Zhong, C.; John, D.B.; Harold, C. Potential application of spice and herb extracts as natural preservatives in cheese. J. Med. Food 2011, 14, 284–290. [Google Scholar]
- Hwang, J.E.; Kim, K.T.; Paik, H.D. Improved antioxidant, anti-inflammatory, and anti-adipogenic properties of hydroponic ginseng fermented by Leuconostoc mesenteroides KCCM 12010P. Molecules 2019, 24, 3359. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.Y.; Yang, H.; Lee, T.K.; Lee, C.H.; Seo, J.W.; Kim, J.E.; Kim, S.Y.; Park, J.H.Y.; Lee, K.W. A short-term, hydroponic-culture of ginseng results in a significant increase in the anti-oxidative activity and bioactive components. Food Sci. Biotechnol. 2020, 29, 1007–1012. [Google Scholar] [CrossRef] [Green Version]
- Lourens-Hattingh, A.; Viljoen, B.C. Yogurt as probiotic carrier food. Int. Dairy J. 2001, 11, 1–17. [Google Scholar] [CrossRef]
- Song, M.W.; Jang, H.J.; Kim, K.T.; Paik, H.D. Probiotic and antioxidant properties of novel Lactobacillus brevis KCCM 12203P isolated from kimchi and evaluation of immune-stimulating activities of its heat-killed cells in RAW 264.7 cells. J. Microbiol. Biotechnol. 2019, 29, 1894–1903. [Google Scholar] [CrossRef] [PubMed]
- Fekete, A.; Givens, D.; Lovegrove, J. Casein-derived lactotripeptides reduce systolic and diastolic blood pressure in a meta-analysis of randomised clinical trials. Nutrients 2015, 7, 659–681. [Google Scholar] [CrossRef] [Green Version]
- Pessione, E.; Cirrincione, S. Bioactive molecules released in food by lactic acid bacteria: Encrypted peptides and biogenic amines. Front. Microbiol. 2016, 7, 876. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Filannino, P.; Bai, Y.; Di Cagno, R.; Gobbetti, M.; Ganzle, M.G. Metabolism of phenolic compounds by Lactobacillus spp. during fermentation of cherry juice and broccoli puree. Food Microbiol. 2015, 46, 272–279. [Google Scholar] [CrossRef]
- Laatikainen, R.; Koskenpato, J.; Hongisto, S.M.; Loponen, J.; Poussa, T.; Hillila, M.; Korpela, R. Randomised clinical trial: Low-FODMAP rye bread vs. regular rye bread to relieve the symptoms of irritable bowel syndrome. Aliment. Pharmacol. Ther. 2016, 44, 460–470. [Google Scholar] [CrossRef]
- El-Sayed, S.M.; Salama, H.; El-Sayed, M.M. Preparation and properties of functional milk beverage fortified with kiwi pulp and sesame oil. Res. J. Pharm. Biol. Chem. Sci. 2015, 6, 609–618. [Google Scholar]
- Cruz Rodrigues, V.C.; Silva, L.G.S.; Simabuco, F.M.; Venema, K.; Antunes, A.E.C. Survival, metabolic status and cellular morphology of probiotics in dairy products and dietary supplement after simulated digestion. J. Funct. Foods 2019, 55, 126–134. [Google Scholar] [CrossRef]
- Ranadheera, R.D.C.S.; Evans, C.A.; Adams, M.C.; Baines, S.K. In vitro analysis of gastrointestinal tolerance and intestinal cell adhesion of probiotics in goat’s milk ice cream and yogurt. Food Res. Int. 2012, 49, 619–625. [Google Scholar] [CrossRef]
- Jeong, C.H.; Ryu, H.; Zhang, T.; Lee, C.H.; Seo, H.G.; Han, S.G. Green tea powder supplementation enhances fermentation and antioxidant activity of set-type yogurt. Food Sci. Biotechnol. 2018, 27, 1419–1427. [Google Scholar] [CrossRef]
- Lee, H.S.; Song, M.W.; Kim, K.T.; Hong, W.S.; Paik, H.D. Antioxidant effect and sensory evaluation of yogurt supplemented with hydroponic ginseng root extract. Foods 2021, 10, 639. [Google Scholar] [CrossRef] [PubMed]
- Ratan, Z.A.; Haidere, M.F.; Hong, Y.H.; Park, S.H.; Lee, J.O.; Lee, J.; Cho, J.Y. Pharmacological potential of ginseng and its major component ginsenosides. J. Ginseng Res. 2021, 45, 199–210. [Google Scholar] [CrossRef]
- Chen, W.; Balan, P.; Popovich, D.G. Analysis of Ginsenoside content (Panax ginseng) from Different Regions. Molecules 2019, 24, 3491. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.M.; Bae, B.S.; Park, H.W.; Ahn, N.G.; Cho, B.G.; Cho, Y.L.; Kwak, Y.S. Characterization of Korean Red Ginseng (Panax ginseng Meyer): History, preparation method, and chemical composition. J. Ginseng Res. 2015, 39, 384–391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jang, H.J.; Jung, J.; Yu, H.S.; Lee, N.K.; Paik, H.D. Evaluation of the Quality of Yogurt Using Ginseng Extract Powder and Probiotic Lactobacillus plantarum NK181. Korean J. Food Sci. Anim. Resour. 2018, 38, 1160–1167. [Google Scholar] [CrossRef] [Green Version]
- Jung, J.; Paik, H.D.; Yoon, H.J.; Jang, H.J.; Jeewanthi, R.K.C.; Jee, H.S.; Li, X.; Lee, N.K.; Lee, S.K. Physicochemical Characteristics and Antioxidant Capacity in Yogurt Fortified with Red Ginseng Extract. Korean J. Food Sci. Anim. Resour. 2016, 36, 412–420. [Google Scholar] [CrossRef] [Green Version]
- Eom, S.J.; Hwang, J.E.; Kim, K.T.; Pak, H.D. Antibacterial Effects against Various Foodborne Pathogens and Sensory Properties of Yogurt Supplemented with Panax ginseng Marc Extract. Korean J. Food Sci. Anim. Resour. 2017, 37, 787–791. [Google Scholar] [CrossRef] [Green Version]
- Zhu, L.; Luan, X.; Dou, D.; Huang, L. Comparative Analysis of Ginsenosides and Oligosaccharides in White Ginseng (WG), Red Ginseng (RG) and Black Ginseng (BG). J. Chromatogr. Sci. 2019, 57, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Yang, Z.; Gao, L.; Liu, W.; Liu, R.; Zhao, J.; You, J. Changes in element accumulation, phenolic metabolism, and antioxidative enzyme activities in the red-skin roots of Panax ginseng. J. Ginseng Res. 2017, 41, 307–315. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.K.; Park, K.K.; Chung, A.S.; Chung, W.Y. Ginsenoside Rg3 enhances the chemosensitivity of tumors to cisplatin by reducing the basal level of nuclear factor erythroid 2-related factor 2-mediated heme oxygenase-1/NAD(P)H quinone oxidoreductase-1 and prevents normal tissue damage by scavenging cisplatin-induced intracellular reactive oxygen species. Food Chem. Toxicol. 2012, 50, 2565–2574. [Google Scholar]
- Qi, Z.; Li, W.; Tan, J.; Wang, C.; Lin, H.; Zhou, B.; Liu, J.; Li, P. Effect of ginsenoside Rh2 on renal apoptosis in cisplatin-induced nephrotoxicity in vivo. Phytomedicine 2019, 61, 152862. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Ahluwalia, V.; Saran, S.; Kumar, J.; Patel, A.K.; Singhania, R.R. Recent developments on solid-state fermentation for production of microbial secondary metabolites: Challenges and solutions. Bioresour. Technol. 2021, 323, 124566. [Google Scholar] [CrossRef] [PubMed]
- Choung, M.G.; Baek, I.Y.; Kang, S.T.; Han, W.Y.; Shin, D.C.; Moon, H.P.; Kang, K.H. Isolation and determination of anthocyanins in seed coats of black soybean (Glycine max (L.) Merr.). J. Agri. Food Chem. 2001, 49, 5848–5851. [Google Scholar] [CrossRef] [PubMed]
- Feitosa, P.R.B.; Santos, T.R.J.; Gualberto, N.C.; Narain, N.; de Aquino Santana, L.C.L. Solid-state fermentation with Aspergillus niger for the bio-enrichment of bioactive compounds in Moringa oleifera (moringa) leaves. Biocat. Agri. Biotechnol. 2020, 27, 101709. [Google Scholar] [CrossRef]
- Asagbra, A.E.; Sani, A.I.; Oyewole, O.B. Solid state fermentation production of tetracycline by Streptomyces strains using some agricultural wastes as substrate. World J. Microbiol. Biotechn. 2005, 21, 107–114. [Google Scholar] [CrossRef]
- Asri, M.N.; Zarei, M.; Saari, N. Low molecular weight peptides generated from palm kernel cake via solid state lacto-fermentation extend the shelf life of bread. LWT-Food Sci. Technol. 2020, 134, 110206. [Google Scholar] [CrossRef]
- Ganjam, L.S.; Thornton, W.H.; Marshall, R.T.; Macdonald, R.C. Antiproliferative effects of yogurt fractions obtained by membrane dialysis on cultured mammalian intestinal cells. J. Dairy Sci. 1997, 80, 2325–2329. [Google Scholar] [CrossRef] [Green Version]
- Gill, H.S.; Rutherfurd, K.J.; Prasad, J.; Gopal, P.K. Enhancement of natural and acquired immunity by Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019). Brit. J. Nutr. 2000, 83, 167–176. [Google Scholar] [CrossRef] [Green Version]
- Isolauri, E.; Sutas, Y.; Kankaanpaa, P.; Arvillonin, H.; Salminen, S. Probiotics: Effect on immunity. Am. J. Clin. Nutr. 2001, 73, 444–450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perdigon, G.; Alvarez, S.; Rachid, M.; Aguero, G.; Gobbato, N. Immune system stimulation by probiotics. J. Dairy Sci. 1995, 78, 1597–1606. [Google Scholar] [CrossRef]
- Mahfudh, N.; Novitasari, R. Immunomodulatory activity of yogurt fortified with honey and Hibiscus sabdariffa L. on reactive oxygen intermediate and nitric oxide secretion. Indones. J. Pharm. 2019, 30, 141–146. [Google Scholar] [CrossRef]
- Makino, S.; Sato, A.; Goto, A.; Nakamura, M.; Ogawa, M.; Chiba, Y.; Hemmi, J.; Kano, H.; Takeda, K.; Okumura, K.; et al. Enhanced natural killer cell activation by exopolysaccharides derived from yogurt fermented with Lactobacillus delbrueckii ssp. bulgaricus OLL1073R-1. J. Dairy Sci. 2016, 99, 915–923. [Google Scholar] [CrossRef] [Green Version]
- Adolfsson, O.; Meydani, S.N.; Russell, R.M. Yogurt and gut function. Am. J. Clin. Nutr. 2004, 80, 245–256. [Google Scholar] [CrossRef] [PubMed]
- Meydani, S.N.; Ha, W.K. Immunologic effects of yogurt. Am. J. Clin. Nutr. 2000, 71, 861–872. [Google Scholar] [CrossRef] [Green Version]
- Ayebo, A.D.; Shahani, K.M.; Dam, R.; Friend, B.A. Ion exchange separation of the antitumor component(s) of yogurt dialysate. J. Dairy Sci. 1982, 65, 2388–2390. [Google Scholar] [CrossRef]
- Biffi, A.; Coradini, D.; Larsen, R.; Riva, L.; Fronzo, G.D. Antiproliferative effect of fermented milk on the growth of a human breast cancer cell line. Nutr. Cancer 1997, 28, 93–99. [Google Scholar] [CrossRef]
- Simone, C.; Bianchi Salvadori, B.; Negri, M.; Ferrazzi, M.; Baldinelli, L.; Vesely, R. The adjuvant effect of yogurt on production of gamma interferon by Con A stimulated human peripheral blood lymphocytes. Nutr. Rep. Int. 1986, 33, 419–433. [Google Scholar]
- Shah, N.P. Yogurt in Health and Disease Prevention, 1st ed.; Academic Press: London, UK, 2017; pp. 221–235. [Google Scholar]
- Chen, L.; Chen, N.; He, Q.; Sun, Q.; Zeng, W.C. Preparation of a functional yogurt with Ligustrum robustum (Rxob.) Blume and its action mechanism. J. Food Sci. 2021, 86, 1114–1123. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.X.; Yu, Z.L.; He, Q.; Tang, S.H.; Zeng, W.C. A potentially functional yogurt co-fermentation with Gnaphalium affine. LWT-Food Sci. Technol. 2018, 91, 423–430. [Google Scholar] [CrossRef]
Primer 1 | Acession Code | Direction | Primer Sequence (5′ to 3′) |
---|---|---|---|
β-Actin | NM_031144.3 | Forward | GTGGGCCGCCCTAGGCACCAG |
Reverse | GGAGGAAGAGGATGCGGCAGT | ||
TNF-α | XM_032888689.1 | Forward | TTGACCTCAGCGCTGAGTTG |
Reverse | CCTGTAGCCCACGTCGTAGC | ||
iNOS | AY211532.1 | Forward | CCCTTCCGAAGTTTCTGGCAGC |
Reverse | GGCTGTCAGAGCCTCGTGGCTTTGG | ||
IL-1β | NM_031512.2 | Forward | CAGGATGAGGACATGAGCACC |
Reverse | CTCTGCAGACTCAAACTCCAC | ||
IL-6 | NM_012589.2 | Forward | GTACTCCAGAAGACCAGAGG |
Reverse | TGCTGGTGACAACCACGGCC |
Sample Type 1 | Nutritional Composition (%) | Color Parameter 2 | ||||||
---|---|---|---|---|---|---|---|---|
Fat | Protein | Lactose | Total Solid | Ash | L * | a * | b * | |
C | 3.27 ± 0.25 | 4.23 ± 0.25 | 7.57 ± 0.06 | 14.93 ± 0.16 b | 0.81 ± 0.03 | 93.61 ± 0.48 a | −3.00 ± 0.11 b | 6.48 ± 0.20 b |
LB | 3.20 ± 0.26 | 4.17 ± 0.21 | 7.53 ± 0.21 | 14.90 ± 0.18 b | 0.79 ± 0.06 | 93.93 ± 0.13 a | −3.03 ± 0.04 b | 6.78 ± 0.10 b |
HG | 3.27 ± 0.21 | 4.53 ± 0.32 | 7.57 ± 0.21 | 15.52 ± 0.33 a | 0.81 ± 0.04 | 91.62 ± 0.02 b | −2.40 ± 0.09 a | 10.72 ± 0.04 a |
LHG | 3.24 ± 0.35 | 4.47 ± 0.25 | 7.43 ± 0.12 | 15.43 ± 0.25 a | 0.82 ± 0.05 | 91.74 ± 0.01 b | −2.33 ± 0.10 a | 10.55 ± 0.11 a |
Evaluation Criteria | Sensory Evaluation of Each Type of Ginseng Yogurt 1 | |||
---|---|---|---|---|
C | LB | HG | LHG | |
Color | 6.10 ± 0.70 a | 6.13 ± 0.85 a | 4.97 ± 1.22 b | 5.03 ± 1.30 b |
Texture | 5.97 ± 1.08 | 5.74 ± 1.03 | 5.61 ± 1.15 | 5.45 ± 1.09 |
Flavor | 5.52 ± 0.96 a | 5.45 ± 1.12 ab | 4.90 ± 1.27 bc | 4.81 ± 1.05 c |
Taste | 5.42 ± 1.03 a | 5.58 ± 1.12 a | 4.74 ± 1.26 b | 4.58 ± 1.48 b |
Overall acceptance | 5.32 ± 0.60 a | 5.26 ± 0.89 ab | 4.81 ± 0.98 bc | 4.58 ± 1.06 c |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, M.-W.; Park, J.-Y.; Lee, H.-S.; Kim, K.-T.; Paik, H.-D. Co-Fermentation by Lactobacillus brevis B7 Improves the Antioxidant and Immunomodulatory Activities of Hydroponic Ginseng-Fortified Yogurt. Antioxidants 2021, 10, 1447. https://doi.org/10.3390/antiox10091447
Song M-W, Park J-Y, Lee H-S, Kim K-T, Paik H-D. Co-Fermentation by Lactobacillus brevis B7 Improves the Antioxidant and Immunomodulatory Activities of Hydroponic Ginseng-Fortified Yogurt. Antioxidants. 2021; 10(9):1447. https://doi.org/10.3390/antiox10091447
Chicago/Turabian StyleSong, Myung-Wook, Ji-Young Park, Hyun-Sook Lee, Kee-Tae Kim, and Hyun-Dong Paik. 2021. "Co-Fermentation by Lactobacillus brevis B7 Improves the Antioxidant and Immunomodulatory Activities of Hydroponic Ginseng-Fortified Yogurt" Antioxidants 10, no. 9: 1447. https://doi.org/10.3390/antiox10091447
APA StyleSong, M.-W., Park, J.-Y., Lee, H.-S., Kim, K.-T., & Paik, H.-D. (2021). Co-Fermentation by Lactobacillus brevis B7 Improves the Antioxidant and Immunomodulatory Activities of Hydroponic Ginseng-Fortified Yogurt. Antioxidants, 10(9), 1447. https://doi.org/10.3390/antiox10091447