Region-Specific Long-Term Transcriptional Changes in the Plasminogen Activation System and Neuroinflammation in the Rat Brain After Status Epilepticus: Association with Depressive-like Behavior
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Lithium–Pilocarpine Model of SE
2.3. Video Monitoring
2.4. Sucrose Preference Test
2.5. qPCR
2.6. Statistical Analysis
3. Results
3.1. Lithium–Pilocarpine Seizures
3.2. Expression of Serpine1, Plat, and Plaur in the Hippocampus, Entorhinal Cortex, and Neocortex
3.3. Expression of Il1b, Tnf, and Tgfb1 in the Hippocampus, Entorhinal Cortex, and Neocortex
3.4. Sucrose Preference Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| DNase | Deoxyribonuclease |
| IL-1β | Interleukin-1 beta (gene: Il1b) |
| PA | Plasminogen Activation |
| PAI-1 | Plasminogen Activator Inhibitor-1 (gene: Serpine1) |
| qPCR | Quantitative Polymerase Chain Reaction |
| SE | Status Epilepticus |
| SEM | Standard Error of the Mean |
| TGF-β1 | Transforming Growth Factor beta 1 (gene: Tgfb1) |
| TLE | Temporal Lobe Epilepsy |
| TNF-α | Tumor Necrosis Factor alpha (gene: Tnf) |
| tPA | Tissue Plasminogen Activator (gene: Plat) |
| uPAR | Urokinase-type Plasminogen Activator Receptor (gene: Plaur) |
References
- Iyer, A.M.; Zurolo, E.; Boer, K.; Baayen, J.C.; Giangaspero, F.; Arcella, A.; Di Gennaro, G.C.; Esposito, V.; Spliet, W.G.M.; van Rijen, P.C.; et al. Tissue Plasminogen Activator and Urokinase Plasminogen Activator in Human Epileptogenic Pathologies. Neuroscience 2010, 167, 929–945. [Google Scholar] [CrossRef]
- Fay, W.P.; Garg, N.; Sunkar, M. Vascular Functions of the Plasminogen Activation System. Arter. Thromb. Vasc. Biol. 2007, 27, 1231–1237. [Google Scholar] [CrossRef]
- Benarroch, E.E. Tissue Plasminogen Activator: Beyond Thrombolysis. Neurology 2007, 69, 799–802. [Google Scholar] [CrossRef] [PubMed]
- Samson, A.L.; Medcalf, R.L. Tissue-Type Plasminogen Activator: A Multifaceted Modulator of Neurotransmission and Synaptic Plasticity. Neuron 2006, 50, 673–678. [Google Scholar] [CrossRef] [PubMed]
- Sashindranath, M.; Sales, E.; Daglas, M.; Freeman, R.; Samson, A.L.; Cops, E.J.; Beckham, S.; Galle, A.; McLean, C.; Morganti-Kossmann, C.; et al. The Tissue-Type Plasminogen Activator–Plasminogen Activator Inhibitor 1 Complex Promotes Neurovascular Injury in Brain Trauma: Evidence from Mice and Humans. Brain 2012, 135, 3251. [Google Scholar] [CrossRef]
- Wang, Y.F.; Tsirka, S.E.; Strickland, S.; Stieg, P.E.; Soriano, S.G.; Lipton, S.A. Tissue Plasminogen Activator (TPA) Increases Neuronal Damage after Focal Cerebral Ischemia in Wild-Type and TPA-Deficient Mice. Nat. Med. 1998, 4, 228–231. [Google Scholar] [CrossRef]
- Tsirka, S.E.; Gualandris, A.; Amaral, D.G.; Strickland, S. Excitotoxin-Induced Neuronal Degeneration and Seizure Are Mediated by Tissue Plasminogen Activator. Nature 1995, 377, 340–344. [Google Scholar] [CrossRef]
- Qian, Z.; Gilbert, M.E.; Colicos, M.A.; Kandel, E.R.; Kuhl, D. Tissue-Plasminogen Activator Is Induced as an Immediate-Early Gene during Seizure, Kindling and Long-Term Potentiation. Nature 1993, 361, 453–457. [Google Scholar] [CrossRef]
- Gur-Wahnon, D.; Mizrachi, T.; Maaravi-Pinto, F.Y.; Lourbopoulos, A.; Grigoriadis, N.; Higazi, A.A.R.; Brenner, T. The Plasminogen Activator System: Involvement in Central Nervous System Inflammation and a Potential Site for Therapeutic Intervention. J. Neuroinflamm. 2013, 10, 124. [Google Scholar] [CrossRef]
- Lahtinen, L.; Huusko, N.; Myöhänen, H.; Lehtivarjo, A.K.; Pellinen, R.; Turunen, M.P.; Ylä-Herttuala, S.; Pirinen, E.; Pitkänen, A. Expression of Urokinase-Type Plasminogen Activator Receptor Is Increased during Epileptogenesis in the Rat Hippocampus. Neuroscience 2009, 163, 316–328. [Google Scholar] [CrossRef]
- Gorter, J.A.; Van Vliet, E.A.; Aronica, E.; Breit, T.; Rauwerda, H.; Lopes Da Silva, F.H.; Wadman, W.J. Potential New Antiepileptogenic Targets Indicated by Microarray Analysis in a Rat Model for Temporal Lobe Epilepsy. J. Neurosci. 2006, 26, 11083–11110. [Google Scholar] [CrossRef]
- Gorter, J.A.; Van Vliet, E.A.; Rauwerda, H.; Breit, T.; Stad, R.; Van Schaik, L.; Vreugdenhil, E.; Redeker, S.; Hendriksen, E.; Aronica, E.; et al. Dynamic Changes of Proteases and Protease Inhibitors Revealed by Microarray Analysis in CA3 and Entorhinal Cortex during Epileptogenesis in the Rat. Epilepsia 2007, 48 (Suppl. S5), 53–64. [Google Scholar] [CrossRef] [PubMed]
- Lukasiuk, K.; Kontula, L.; Pitkänen, A. CDNA Profiling of Epileptogenesis in the Rat Brain. Eur. J. Neurosci. 2003, 17, 271–279. [Google Scholar] [CrossRef] [PubMed]
- van Vliet, E.A.; Aronica, E.; Vezzani, A.; Ravizza, T. Review: Neuroinflammatory Pathways as Treatment Targets and Biomarker Candidates in Epilepsy: Emerging Evidence from Preclinical and Clinical Studies. Neuropathol. Appl. Neurobiol. 2018, 44, 91–111. [Google Scholar] [CrossRef]
- Soltani Khaboushan, A.; Yazdanpanah, N.; Rezaei, N. Neuroinflammation and Proinflammatory Cytokines in Epileptogenesis. Mol. Neurobiol. 2022, 59, 1724–1743. [Google Scholar] [CrossRef] [PubMed]
- Kuteykin-Teplyakov, K.; Brandt, C.; Hoffmann, K.; Löscher, W. Complex Time-Dependent Alterations in the Brain Expression of Different Drug Efflux Transporter Genes after Status Epilepticus. Epilepsia 2009, 50, 887–897. [Google Scholar] [CrossRef]
- De Simoni, M.G.; Perego, C.; Ravizza, T.; Moneta, D.; Conti, M.; Marchesi, F.; De Luigi, A.; Garattini, S.; Vezzani, A. Inflammatory Cytokines and Related Genes Are Induced in the Rat Hippocampus by Limbic Status Epilepticus. Eur. J. Neurosci. 2000, 12, 2623–2633. [Google Scholar] [CrossRef]
- Kamaşak, T.; Dilber, B.; Yaman, S.Ö.; Durgut, B.D.; Kurt, T.; Çoban, E.; Arslan, E.A.; Şahin, S.; Karahan, S.C.; Cansu, A. HMGB-1, TLR4, IL-1R1, TNF-α, and IL-1β: Novel Epilepsy Markers? Epileptic Disord. 2020, 22, 183–193. [Google Scholar] [CrossRef]
- Derynck, R.; Budi, E.H. Specificity, Versatility and Control of TGF-β Family Signaling. Sci. Signal. 2019, 12, eaav5183. [Google Scholar] [CrossRef]
- Yang, L.T.; Anthony, G.; Kaufer, D. Inflammatory Astrocytic TGFβ Signaling Induced by Blood–Brain Barrier Dysfunction Drives Epileptogenesis. In Jasper’s Basic Mechanisms of the Epilepsies; Oxford Academic: Oxford, UK, 2024; pp. 569–588. [Google Scholar] [CrossRef]
- Paglinawan, R.; Malipiero, U.; Schlapbach, R.; Frei, K.; Reith, W.; Fontana, A. TGFβ Directs Gene Expression of Activated Microglia to an Anti-Inflammatory Phenotype Strongly Focusing on Chemokine Genes and Cell Migratory Genes. Glia 2003, 44, 219–231. [Google Scholar] [CrossRef]
- Hailer, N.P.; Wirjatijasa, F.; Roser, N.; Hischebeth, G.T.R.; Korf, H.W.; Dehghani, F. Astrocytic Factors Protect Neuronal Integrity and Reduce Microglial Activation in an in Vitro Model of N-Methyl-D-Aspartate-Induced Excitotoxic Injury in Organotypic Hippocampal Slice Cultures. Eur. J. Neurosci. 2001, 14, 315–326. [Google Scholar] [CrossRef] [PubMed]
- Levy, N.; Milikovsky, D.Z.; Baranauskas, G.; Vinogradov, E.; David, Y.; Ketzef, M.; Abutbul, S.; Weissberg, I.; Kamintsky, L.; Fleidervish, I.; et al. Differential TGF-β Signaling in Glial Subsets Underlies IL-6–Mediated Epileptogenesis in Mice. J. Immunol. 2015, 195, 1713–1722. [Google Scholar] [CrossRef] [PubMed]
- Finch, C.E.; Laping, N.J.; Morgan, T.E.; Nichols, N.R.; Pasinetti, G.M. TGF-Β1 Is an Organizer of Responses to Neurodegeneration. J. Cell Biochem. 1993, 53, 314–322. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.Y.; Ba, Y.C.; Xiong, L.L.; Li, X.L.; Zou, Y.; Zhu, Y.C.; Zhou, X.F.; Wang, T.H.; Wang, F.; Tian, H.L.; et al. Endogenous TGFβ1 Plays a Crucial Role in Functional Recovery After Traumatic Brain Injury Associated with Smad3 Signal in Rats. Neurochem. Res. 2015, 40, 1671–1680. [Google Scholar] [CrossRef]
- Xie, Y.; Wang, X.; Liu, S.; He, Z.; Zhang, H.; Yu, Z.; Xie, M.; Wang, W. Transforming Growth Factor Β1 Protects Against Ischemic Demyelination via Regulating Microglial Lipid Metabolism Pathway. Stroke 2025, 56, 1554–1568. [Google Scholar] [CrossRef]
- Buisson, A.; Nicole, O.; Docagne, F.; Sartelet, H.; Mackenzie, E.T.; Vivien, D. Up-regulation of a Serine Protease Inhibitor in Astrocytes Mediates the Neuroprotective Activity of Transforming Growth Factor Β1. FASEB J. 1998, 12, 1683–1691. [Google Scholar] [CrossRef]
- Lehrmann, E.; Kiefer, R.; Christensen, T.; Toyka, K.V.; Zimmer, J.; Diemer, N.H.; Hartung, H.P.; Finsen, B. Microglia and Macrophages Are Major Sources of Locally Produced Transforming Growth Factor-Β1 after Transient Middle Cerebral Artery Occlusion in Rats. Glia 1998, 24, 437–448. [Google Scholar] [CrossRef]
- Hewitt, B.J.; Ali, M.; Hubbard, J.; Hill, L.J.; Botfield, H. Systematic Review of the Differential Effects of TGF-Β1 in Ischemic and Hemorrhagic Preclinical Stroke Models. J. Am. Heart Assoc. 2025, 14, e037890. [Google Scholar] [CrossRef]
- Gross, C.E.; Bednar, M.M.; Howard, D.B.; Sporn, M.B. Transforming Growth Factor-Β1 Reduces Infarct Size after Experimental Cerebral Ischemia in a Rabbit Model. Stroke 1993, 24, 558–562. [Google Scholar] [CrossRef]
- Li, L.Y.; Li, J.L.; Zhang, H.M.; Yang, W.M.; Wang, K.; Fang, Y.; Wang, Y. TGFβ1 Treatment Reduces Hippocampal Damage, Spontaneous Recurrent Seizures, and Learning Memory Deficits in Pilocarpine-Treated Rats. J. Mol. Neurosci. 2013, 50, 109–123. [Google Scholar] [CrossRef]
- Aguilar-Castillo, M.J.; Cabezudo-García, P.; García-Martín, G.; Lopez-Moreno, Y.; Estivill-Torrús, G.; Ciano-Petersen, N.L.; Oliver-Martos, B.; Narváez-Pelaez, M.; Serrano-Castro, P.J. A Systematic Review of the Predictive and Diagnostic Uses of Neuroinflammation Biomarkers for Epileptogenesis. Int. J. Mol. Sci. 2024, 25, 6488. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Zou, Y.; Du, Y.; Luo, J.; Zhang, M.; Yang, W.; Wang, X.; Lü, Y. Altered Cerebrospinal Fluid Concentrations of TGFβ1 in Patients with Drug-Resistant Epilepsy. Neurochem. Res. 2014, 39, 2211–2217. [Google Scholar] [CrossRef] [PubMed]
- Ivens, S.; Kaufer, D.; Flores, L.P.; Bechmann, I.; Zumsteg, D.; Tomkins, O.; Seiffert, E.; Heinemann, U.; Friedman, A. TGF-β Receptor-Mediated Albumin Uptake into Astrocytes Is Involved in Neocortical Epileptogenesis. Brain 2007, 130, 535–547. [Google Scholar] [CrossRef] [PubMed]
- Cacheaux, L.P.; Ivens, S.; David, Y.; Lakhter, A.J.; Bar-Klein, G.; Shapira, M.; Heinemann, U.; Friedman, A.; Kaufer, D. Transcriptome Profiling Reveals TGF-β Signaling Involvement in Epileptogenesis. J. Neurosci. 2009, 29, 8927–8935. [Google Scholar] [CrossRef]
- Raison, C.L.; Capuron, L.; Miller, A.H. Cytokines Sing the Blues: Inflammation and the Pathogenesis of Depression. Trends Immunol. 2006, 27, 24–31. [Google Scholar] [CrossRef]
- Jiang, H.; Chen, S.; Li, C.; Lu, N.; Yue, Y.; Yin, Y.; Zhang, Y.; Zhi, X.; Zhang, D.; Yuan, Y. The Serum Protein Levels of the TPA–BDNF Pathway Are Implicated in Depression and Antidepressant Treatment. Transl. Psychiatry 2017, 7, e1079. [Google Scholar] [CrossRef]
- Lee, K.M.; Kim, Y.K. The Role of IL-12 and TGF-Β1 in the Pathophysiology of Major Depressive Disorder. Int. Immunopharmacol. 2006, 6, 1298–1304. [Google Scholar] [CrossRef]
- Davami, M.H.; Baharlou, R.; Vasmehjani, A.A.; Ghanizadeh, A.; Keshtkar, M.; Dezhkam, I.; Atashzar, M.R. Elevated IL-17 and TGF-β Serum Levels: A Positive Correlation between T-Helper 17 Cell-Related Pro-Inflammatory Responses with Major Depressive Disorder. Basic Clin. Neurosci. 2016, 7, 137–142. [Google Scholar] [CrossRef]
- Jovanovic, A.M.; Mitkovic Voncina, M.; Kostic, M.; Jeremic, M.; Todorovic, J.; Popadic, D.; Tosevski, D.L.; Markovic, I. Childhood Maltreatment Correlates with Higher Concentration of Transforming Growth Factor Beta (TGF-β) in Adult Patients with Major Depressive Disorder. Psychiatry Res. 2021, 301, 113987. [Google Scholar] [CrossRef]
- Depino, A.M.; Lucchina, L.; Pitossi, F. Early and Adult Hippocampal TGF-Β1 Overexpression Have Opposite Effects on Behavior. Brain Behav. Immun. 2011, 25, 1582–1591. [Google Scholar] [CrossRef]
- Xu, D.; Liu, G.; Zhao, M.; Wan, X.; Qu, Y.; Murayama, R.; Hashimoto, K. Effects of Arketamine on Depression-like Behaviors and Demyelination in Mice Exposed to Chronic Restrain Stress: A Role of Transforming Growth Factor-Β1. J. Affect. Disord. 2024, 367, 745–755. [Google Scholar] [CrossRef]
- Kanner, A.M.; Palac, S. Depression in Epilepsy: A Common but Often Unrecognized Comorbid Malady. Epilepsy Behav. 2000, 1, 37–51. [Google Scholar] [CrossRef]
- Kandratavicius, L.; Peixoto-Santos, J.E.; Monteiro, M.R.; Scandiuzzi, R.C.; Carlotti, C.G.; Assirati, J.A.; Hallak, J.E.; Leite, J.P. Mesial Temporal Lobe Epilepsy with Psychiatric Comorbidities: A Place for Differential Neuroinflammatory Interplay. J. Neuroinflamm. 2015, 12, 38. [Google Scholar] [CrossRef] [PubMed]
- Leite, J.P.; Garcia-Cairasco, N.; Cavalheiro, E.A. New Insights from the Use of Pilocarpine and Kainate Models. Epilepsy Res. 2002, 50, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Honchar, M.P.; Olney, J.W.; Sherman, W.R. Systemic Cholinergic Agents Induce Seizures and Brain Damage in Lithium-Treated Rats. Science 1983, 220, 323–325. [Google Scholar] [CrossRef] [PubMed]
- Pitkanen, A.; Lukasiuk, K. Molecular and Cellular Basis of Epileptogenesis in Symptomatic Epilepsy. Epilepsy Behav. 2009, 14 (Suppl. S1), 16–25. [Google Scholar] [CrossRef]
- Pitkänen, A.; Kharatishvili, I.; Karhunen, H.; Lukasiuk, K.; Immonen, R.; Nairismägi, J.; Gröhn, O.; Nissinen, J. Epileptogenesis in Experimental Models. Epilepsia 2007, 48, 13–20. [Google Scholar] [CrossRef]
- Pineda, E.; Shin, D.; Sankar, R.; Mazarati, A.M. Comorbidity between Epilepsy and Depression: Experimental Evidence for the Involvement of Serotonergic, Glucocorticoid, and Neuroinflammatory Mechanisms. Epilepsia 2010, 51 (Suppl. S3), 110–114. [Google Scholar] [CrossRef]
- Mazarati, A.; Siddarth, P.; Baldwin, R.A.; Shin, D.; Caplan, R.; Sankar, R. Depression after Status Epilepticus: Behavioural and Biochemical Deficits and Effects of Fluoxetine. Brain 2008, 131, 2071–2083. [Google Scholar] [CrossRef]
- Andre, V.; Dube, C.; Francois, J.; Leroy, C.; Rigoulot, M.-A.A.; Roch, C.; Namer, I.J.; Nehlig, A.; André, V.; Dubé, C.; et al. Pathogenesis and Pharmacology of Epilepsy in the Lithium-Pilocarpine Model. Epilepsia 2007, 48 (Suppl. S5), 41–47. [Google Scholar] [CrossRef]
- Covolan, L.; Mello, L.E.A.M. Temporal Profile of Neuronal Injury Following Pilocarpine or Kainic Acid-Induced Status Epilepticus. Epilepsy Res. 2000, 39, 133–152. [Google Scholar] [CrossRef] [PubMed]
- Karan, A.A.; Spivak, Y.S.; Suleymanova, E.M.; Gerasimov, K.A.; Bolshakov, A.P.; Vinogradova, L.V. Distant Neuroinflammation Acutely Induced by Focal Brain Injury and Its Control by Endocannabinoid System. Exp. Neurol. 2024, 373, 114679. [Google Scholar] [CrossRef] [PubMed]
- Racine, R.J. Modification of Seizure Activity by Electrical Stimulation: II. Motor Seizure. Electroencephalogr. Clin. Neurophysiol. 1972, 32, 281–294. [Google Scholar] [CrossRef] [PubMed]
- Kubová, H.; Rejchrtová, J.; Redkozubova, O.; Mares, P.; Kubova, H.; Rejchrtova, J. Outcome of Status Epilepticus in Immature Rats Varies According to the Paraldehyde Treatment. Epilepsia 2005, 46 (Suppl. S5), 38–42. [Google Scholar] [CrossRef]
- Shaydurov, V.A.; Kasianov, A.; Bolshakov, A.P. Analysis of Housekeeping Genes for Accurate Normalization of QPCR Data During Early Postnatal Brain Development. J. Mol. Neurosci. 2018, 64, 431–439. [Google Scholar] [CrossRef]
- Suleymanova, E.M.; Shangaraeva, V.A.; van Rijn, C.M.; Vinogradova, L.V. The Cannabinoid Receptor Agonist WIN55.212 Reduces Consequences of Status Epilepticus in Rats. Neuroscience 2016, 334, 191–200. [Google Scholar] [CrossRef]
- Suleymanova, E.M.; Gulyaev, M.V.; Abbasova, K.R. Structural Alterations in the Rat Brain and Behavioral Impairment after Status Epilepticus: An MRI Study. Neuroscience 2016, 315, 79–90. [Google Scholar] [CrossRef]
- Roch, C.; Leroy, C.; Nehlig, A.; Namer, I.J. Magnetic Resonance Imaging in the Study of the Lithium-Pilocarpine Model of Temporal Lobe Epilepsy in Adult Rats. Epilepsia 2002, 43, 325–335. [Google Scholar] [CrossRef]
- Su, E.J.; Fredriksson, L.; Geyer, M.; Folestad, E.; Cale, J.; Andrae, J.; Gao, Y.; Pietras, K.; Mann, K.; Yepes, M.; et al. Activation of PDGF-CC by Tissue Plasminogen Activator Impairs Blood Brain Barrier Integrity During Ischemic Stroke. Nat. Med. 2008, 14, 731. [Google Scholar] [CrossRef]
- Shmakova, A.A.; Rubina, K.A.; Rysenkova, K.D.; Gruzdeva, A.M.; Ivashkina, O.I.; Anokhin, K.V.; Tkachuk, V.A.; Semina, E.V. Urokinase Receptor and Tissue Plasminogen Activator as Immediate-Early Genes in Pentylenetetrazole-Induced Seizures in the Mouse Brain. Eur. J. Neurosci. 2020, 51, 1559–1572. [Google Scholar] [CrossRef]
- Smith, H.W.; Marshall, C.J. Regulation of Cell Signalling by UPAR. Nat. Rev. Mol. Cell Biol. 2010, 11, 23–36. [Google Scholar] [CrossRef]
- Merino, P.; Diaz, A.; Jeanneret, V.; Wu, F.; Torre, E.; Cheng, L.; Yepes, M. Urokinase-Type Plasminogen Activator (UPA) Binding to the UPA Receptor (UPAR) Promotes Axonal Regeneration in the Central Nervous System. J. Biol. Chem. 2016, 292, 2741. [Google Scholar] [CrossRef]
- Yepes, M. Urokinase-Type Plasminogen Activator Is a Modulator of Synaptic Plasticity in the Central Nervous System: Implications for Neurorepair in the Ischemic Brain. Neural. Regen. Res. 2020, 15, 620–624. [Google Scholar] [CrossRef]
- Ndode-Ekane, X.E.; Pitkänen, A. Urokinase-Type Plasminogen Activator Receptor Modulates Epileptogenesis in Mouse Model of Temporal Lobe Epilepsy. Mol. Neurobiol. 2013, 47, 914–937. [Google Scholar] [CrossRef] [PubMed]
- Cunningham, O.; Campion, S.; Hugh Perry, V.; Murray, C.; Sidenius, N.; Docagne, F.; Cunningham, C. Microglia and the Urokinase Plasminogen Activator Receptor/UPA System in Innate Brain Inflammation. Glia 2009, 57, 1802–1814. [Google Scholar] [CrossRef] [PubMed]
- Mehra, A.; Ali, C.; Parcq, J.; Vivien, D.; Docagne, F. The Plasminogen Activation System in Neuroinflammation. Biochim. Biophys. Acta BBA—Mol. Basis Dis. 2016, 1862, 395–402. [Google Scholar] [CrossRef] [PubMed]
- Siao, C.J.; Tsirka, S.E. Tissue Plasminogen Activator Mediates Microglial Activation via Its Finger Domain through Annexin II. J. Neurosci. 2002, 22, 3352–3358. [Google Scholar] [CrossRef]
- Turrin, N.P.; Rivest, S. Innate Immune Reaction in Response to Seizures: Implications for the Neuropathology Associated with Epilepsy. Neurobiol. Dis. 2004, 16, 321–334. [Google Scholar] [CrossRef]
- Liu, T.; Clark, R.K.; McDonnell, P.C.; Young, P.R.; White, R.F.; Barone, F.C.; Feuerstein, G.Z. Tumor Necrosis Factor-α Expression in Ischemic Neurons. Stroke 1994, 25, 1481–1488. [Google Scholar] [CrossRef]
- Yamashita, K.; Gerken, U.; Vogel, P.; Hossmann, K.A.; Wiessner, C. Biphasic Expression of TGF-Β1 MRNA in the Rat Brain Following Permanent Occlusion of the Middle Cerebral Artery. Brain Res. 1999, 836, 139–145. [Google Scholar] [CrossRef]
- Grammas, P.; Ovase, R. Cerebrovascular Transforming Growth Factor-β Contributes to Inflammation in the Alzheimer’s Disease Brain. Am. J. Pathol. 2002, 160, 1583–1587. [Google Scholar] [CrossRef] [PubMed]
- Mercado-Gómez, O.; Landgrave-Gómez, J.; Arriaga-Avila, V.; Nebreda-Corona, A.; Guevara-Guzmán, R. Role of TGF-β Signaling Pathway on Tenascin C Protein Upregulation in a Pilocarpine Seizure Model. Epilepsy Res. 2014, 108, 1694–1704. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Canabal, A.; Wheeler, A.L.; Sarkis, D.; Lerch, J.P.; Lu, W.Y.; Buckwalter, M.S.; Wyss-Coray, T.; Josselyn, S.A.; Frankland, P.W. Chronic Over-Expression of TGFβ1 Alters Hippocampal Structure and Causes Learning Deficits. Hippocampus 2013, 23, 1198–1211. [Google Scholar] [CrossRef] [PubMed]
- Persinger, M.A.; Bureau, Y.R.J.; Kostakos, M.; Peredery, O.; Falter, H. Behaviors of Rats with Insidious, Multifocal Brain Damage Induced by Seizures Following Single Peripheral Injections of Lithium and Pilocarpine. Physiol. Behav. 1993, 53, 849–866. [Google Scholar] [CrossRef]
- Leite, J.P.; Nakamura, E.M.; Lemos, T.; Masur, J.; Cavalheiro, E.A. Learning Impairment in Chronic Epileptic Rats Following Pilocarpine-Induced Status Epilepticus. Braz. J. Med. Biol. Res. 1990, 23, 681–683. [Google Scholar]
- Sankar, R.; Shin, D.H.; Liu, H.; Mazarati, A.; De Vasconcelos, A.P.; Wasterlain, C.G.; Pereira de Vasconcelos, A.; Wasterlain, C.G. Patterns of Status Epilepticus-Induced Neuronal Injury during Development and Long-Term Consequences. J. Neurosci. 1998, 18, 8382–8393. [Google Scholar] [CrossRef]
- Hopkins, W.E.; Westerhausen, D.R.; Sobel, B.E.; Billadello, J.J. Transcriptional Regulation of Plasminogen Activator Inhibitor Type-1 MRNA in Hep G2 Cells by Epidermal Growth Factor. Nucleic Acids Res. 1991, 19, 163–168. [Google Scholar] [CrossRef][Green Version]
- Jiang, Z.; Seo, J.Y.; Ha, H.; Lee, E.A.; Kim, Y.S.; Han, D.C.; Uh, S.T.; Park, C.S.; Lee, H.B. Reactive Oxygen Species Mediate TGF-Β1-Induced Plasminogen Activator Inhibitor-1 Upregulation in Mesangial Cells. Biochem. Biophys. Res. Commun. 2003, 309, 961–966. [Google Scholar] [CrossRef]
- Serretti, A. Anhedonia and Depressive Disorders. Clin. Psychopharmacol. Neurosci. 2023, 21, 401–409. [Google Scholar] [CrossRef]
- Primo, M.J.; Fonseca-Rodrigues, D.; Almeida, A.; Teixeira, P.M.; Pinto-Ribeiro, F. Sucrose Preference Test: A Systematic Review of Protocols for the Assessment of Anhedonia in Rodents. Eur. Neuropsychopharmacol. 2023, 77, 80–92. [Google Scholar] [CrossRef]
- Katz, R.J. Animal Model of Depression: Pharmacological Sensitivity of a Hedonic Deficit. Pharmacol. Biochem. Behav. 1982, 16, 965–968. [Google Scholar] [CrossRef] [PubMed]
- Scheggi, S.; De Montis, M.G.; Gambarana, C. Making Sense of Rodent Models of Anhedonia. Int. J. Neuropsychopharmacol. 2018, 21, 1049–1065. [Google Scholar] [CrossRef]
- Mazarati, A.M.; Pineda, E.; Shin, D.; Tio, D.; Taylor, A.N.; Sankar, R. Comorbidity between Epilepsy and Depression: Role of Hippocampal Interleukin-1β. Neurobiol. Dis. 2010, 37, 461–467. [Google Scholar] [CrossRef]
- Kofod, J.; Elfving, B.; Nielsen, E.H.; Mors, O.; Köhler-Forsberg, O. Depression and Inflammation: Correlation between Changes in Inflammatory Markers with Antidepressant Response and Long-Term Prognosis. Eur. Neuropsychopharmacol. 2022, 54, 116–125. [Google Scholar] [CrossRef]
- Dantzer, R.; O’Connor, J.C.; Freund, G.G.; Johnson, R.W.; Kelley, K.W. From Inflammation to Sickness and Depression: When the Immune System Subjugates the Brain. Nat. Rev. Neurosci. 2008, 9, 46–56. [Google Scholar] [CrossRef]
- Stepanichev, M.; Dygalo, N.N.; Grigoryan, G.; Shishkina, G.T.; Gulyaeva, N. Rodent Models of Depression: Neurotrophic and Neuroinflammatory Biomarkers. Biomed. Res. Int. 2014, 2014, 932757. [Google Scholar] [CrossRef]
- Zhang, P.F.; You, W.Y.; Gao, Y.J.; Wu, X.B. Activation of Pyramidal Neurons in the Infralimbic Cortex Alleviates LPS-Induced Depressive-like Behavior in Mice. Brain Res. Bull. 2024, 214, 111008. [Google Scholar] [CrossRef]







| Gene | Forward Primer | Reverse Primer | Amplicon Size |
|---|---|---|---|
| Tgfb1 | GCGCCTGCAGAGATTCAAGTCAAC | TCAGGCGTATCAGTGGGGGTCA | 117 |
| Tnf | GTCCAACTCCGGGCTCAGAAT | ACTCCCCCGATCCACTCAG | 173 |
| Il1b | TCTGTGACTCGTGGGATGAT | CACTTGTTGGCTTATGTTCTGTC | 161 |
| Plat | CAGTGCCCTGACGGATTTGTTG | AGGGCTTCACGTCTCGGTCT | 241 |
| Plaur | CGGGCACAGCAGGTTTCCATAG | CTCCGGTTTCCCAGCACATCTAAG | 244 |
| Serpine1 | TCGGCACAATCCAACAGAGACA | CCAGTGCCGGGGTAAGAAAGA | 184 |
| Ywhaz | TTGAGCAGAAGACGGAAGGT | GAAGCATTGGGGATCAAGAA | 136 |
| Hprt | CGTCGTGATTAGTGATGATGAAC | CAAGTCTTTCAGTCCTGTCCATAA | 128 |
| Osbp | TCCGGGAGACTTTACCTTCACTT | GTGTCACCCTCTTATCAACCACC | 100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Karan, A.; Selivanova, E.; Spivak, Y.; Suleymanova, E. Region-Specific Long-Term Transcriptional Changes in the Plasminogen Activation System and Neuroinflammation in the Rat Brain After Status Epilepticus: Association with Depressive-like Behavior. Brain Sci. 2025, 15, 1083. https://doi.org/10.3390/brainsci15101083
Karan A, Selivanova E, Spivak Y, Suleymanova E. Region-Specific Long-Term Transcriptional Changes in the Plasminogen Activation System and Neuroinflammation in the Rat Brain After Status Epilepticus: Association with Depressive-like Behavior. Brain Sciences. 2025; 15(10):1083. https://doi.org/10.3390/brainsci15101083
Chicago/Turabian StyleKaran, Anna, Elizaveta Selivanova, Yulia Spivak, and Elena Suleymanova. 2025. "Region-Specific Long-Term Transcriptional Changes in the Plasminogen Activation System and Neuroinflammation in the Rat Brain After Status Epilepticus: Association with Depressive-like Behavior" Brain Sciences 15, no. 10: 1083. https://doi.org/10.3390/brainsci15101083
APA StyleKaran, A., Selivanova, E., Spivak, Y., & Suleymanova, E. (2025). Region-Specific Long-Term Transcriptional Changes in the Plasminogen Activation System and Neuroinflammation in the Rat Brain After Status Epilepticus: Association with Depressive-like Behavior. Brain Sciences, 15(10), 1083. https://doi.org/10.3390/brainsci15101083

