Quinolone and Tetracycline-Resistant Biofilm-Forming Escherichia coli Isolates from Slovak Broiler Chicken Farms and Chicken Meat
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples, Bacterial and DNA Isolation
2.2. MALDI-TOF and PCR Identification
2.3. Antimicrobial Susceptibility Detection
2.4. Detection of Biofilm Formation
2.5. Phylogenetic Typing of Strains
2.6. Detection of Genes Encoding Resistance to Antimicrobial Substances and Virulence Factors
3. Results
3.1. Antimicrobial Susceptibility Profile
3.2. Evaluation of Biofilm Formation
3.3. Phylogenetic Analysis
3.4. Genotype Resistance to Antimicrobial Agents
3.5. Presence of Mobile Genetic Elements and Virulence Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abdalla, S.E.; Abia, A.L.K.; Amoako, D.G.; Perrett, K.; Bester, L.A.; Essack, S.Y. From Farm-to-Fork: E. coli from an intensive pig production system in South Africa shows high resistance to critically important antibiotics for human and animal use. Antibiotics 2021, 10, 178. [Google Scholar] [CrossRef] [PubMed]
- Qiao, M.; Ying, G.G.; Singer, A.C.; Zhu, Y.G. Review of antibiotic resistance in China and its environment. Environ. Int. 2018, 110, 160–172. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Liu, N.; Gao, Y.; Liu, J.; Huang, X.; Zhang, Q.; Li, Y.; Zhao, J.; Wang, J.; Zhao, G. Surveillance and reduction control of Escherichia coli and diarrheagenic E. coli during the pig slaughtering process in China. Front. Vet. Sci. 2021, 8, 735076. [Google Scholar] [CrossRef] [PubMed]
- Silva, A.; Silva, V.; Pereira, J.E.; Maltez, L.; Igrejas, G.; Valentão, P.; Falco, V.; Poeta, P. Antimicrobial resistance and clonal lineages of Escherichia coli from food-producing animals. Antibiotics 2023, 12, 1061. [Google Scholar] [CrossRef] [PubMed]
- Basavaraju, M.; Gunashree, B. Escherichia coli: An overview of main characteristics. In Escherichia coli; Intech Open: London, UK, 2022. [Google Scholar]
- Puvača, N.; de Llanos Frutos, R. Antimicrobial resistance in Escherichia coli strains isolated from humans and pet animals. Antibiotics 2021, 10, 69. [Google Scholar] [CrossRef]
- Jang, J.; Hur, H.G.; Sadowsky, M.J.; Byappanahalli, M.N.; Yan, T.; Ishii, S. Environmental Escherichia coli: Ecology and public health implications—A review. J. Appl. Microbiol. 2017, 123, 570–581. [Google Scholar] [CrossRef]
- Halkman, H.B.D.; Halkman, A.K. Indicator Organisms. In Encyclopedia of Food Microbiology; Academic Press: London, UK, 2014. [Google Scholar]
- Rega, M.; Andriani, L.; Cavallo, S.; Bonilauri, P.; Bonardi, S.; Conter, M.; Carmosino, I.; Bacci, C. Antimicrobial resistant E. coli in pork and wild boar meat: A risk to consumers. Foods 2022, 11, 3662. [Google Scholar] [CrossRef]
- Rega, M.; Carmosino, I.; Bonilauri, P.; Frascolla, V.; Vismarra, A.; Bacci, C. Prevalence of ESβL, AmpC and colistin-resistant E. coli in meat: A comparison between pork and wild boar. Microorganisms 2021, 9, 214. [Google Scholar] [CrossRef]
- González-Gutiérrez, M.; García-Fernández, C.; Alonso-Calleja, C.; Capita, R. Microbial load and antibiotic resistance in raw beef preparations from northwest Spain. Food Sci. Nutr. 2020, 8, 777–785. [Google Scholar] [CrossRef]
- Millanao, A.R.; Mora, A.Y.; Villagra, N.A.; Bucarey, S.A.; Hidalgo, A.A. Biological effects of quinolones: A family of broad-spectrum antimicrobial agents. Molecules 2021, 26, 7153. [Google Scholar] [CrossRef]
- Naeem, A.; Badshah, S.L.; Muska, M.; Ahmad, N. The current case of quinolones: Synthetic approaches and antibacterial activity. Molecules 2016, 21, 268. [Google Scholar] [CrossRef] [PubMed]
- Sheykhsaran, E.; Baghi, H.B.; Soroush, M.H.; Ghotaslou, R. An overview of tetracyclines and related resistance mechanisms. Rev. Med. Microbiol. 2019, 30, 69. [Google Scholar] [CrossRef]
- Ramírez-Bayard, I.E.; Mejía, F.; Medina-Sánchez, J.R.; Cornejo-Reyes, H.; Castillo, M.; Querol-Audi, J.; Martínez-Torres, A.O. Prevalence of plasmid-associated tetracycline resistance genes in multidrug-resistant Escherichia coli strains isolated from environmental, animal and human samples in Panama. Antibiotics 2023, 12, 280. [Google Scholar] [CrossRef] [PubMed]
- LaPlante, K.L.; Dhand, A.; Wright, K.; Lauterio, M. Re-establishing the utility of tetracycline-class antibiotics for current challenges with antibiotic resistance. Ann. Med. 2022, 54, 1686–1700. [Google Scholar] [CrossRef] [PubMed]
- Brás, A.; Braz, M.; Martinho, I.; Duarte, J.; Pereira, C.; Almeida, A. Effect of bacteriophages against biofilms of Escherichia coli on food processing surfaces. Microorganisms 2024, 12, 366. [Google Scholar] [CrossRef]
- ISO Standard 6887-1; Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 1: General Rules for the Preparation of the Initial Suspension and Decimal Dilutions. Slovak Standards Institute: Bratislava, Slovakia, 2017.
- ISO Standard 6887-2; Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 2: Specific Rules for the Preparation of Meat and Meat Products. Slovak Standards Institute: Bratislava, Slovakia, 2017.
- ISO Standard 16649-2; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Beta-Glucuronidase-Positive Escherichia coli—Part 2: Colony-Count Technique at 44 °C C Using 5-Bromo-4-Chloro-3-Indolyl Beta-D-glucuronide. Slovak Standards Institute: Bratislava, Slovakia, 2007.
- Burker Daltonics. MALDI Biotyper 2.0. Software for Microorganism Identification and Classification User Manual; Bruker Scientific LLC: Billerica, MA, USA, 2008. [Google Scholar]
- Amit-Romach, E.; Sklan, D.; Uni, Z. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci. 2004, 83, 1093–1098. [Google Scholar] [CrossRef]
- Gattringer, R.; Niks, M.; Ostertag, R.; Schwarz, K.; Medvedovic, H.; Graninger, W.; Georgopoulos, A. Evaluation of MIDITECH automated colorimetric MIC reading for antimicrobial susceptibility testing. J. Antimicrob. Chemother. 2002, 49, 651–659. [Google Scholar] [CrossRef]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 14.0. 2024. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_14.0_Breakpoint_Tables.pdf (accessed on 1 January 2024).
- Gregová, G.; Kmeť, V.; Szabóová, T. New insight on antibiotic resistance and virulence of Escherichia coli from municipal and animal wastewater. Antibiotics 2021, 10, 1111. [Google Scholar] [CrossRef]
- O’Toole, G.A.; Pratt, L.A.; Watnick, P.I.; Newman, D.K.; Weaver, V.B.; Kolter, R. Genetic approaches to study of biofilms. Methods Enzym. 1999, 310, 91–109. [Google Scholar] [CrossRef]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef]
- Ballén, V.; Gabasa, Y.; Ratia, C.; Sánchez, M.; Soto, S. Correlation between antimicrobial resistance, virulence determinants and biofilm formation ability among extraintestinal pathogenic Escherichia coli strains isolated in Catalonia, Spain. Front. Microbiol. 2022, 12, 803862. [Google Scholar] [CrossRef] [PubMed]
- Doumith, M.; Day, M.J.; Hope, R.; Wain, J.; Woodford, N. Improved multiplex PCR strategy for rapid assignment of the four major Escherichia coli phylogenetic groups. J. Clin. Microbiol. 2012, 50, 3108–3110. [Google Scholar] [CrossRef] [PubMed]
- Escobar-Páramo, P.; Le Menac’h, A.; Le Gall, T.; Amorin, C.; Gouriou, S.; Picard, B.; Skurnik, D.; Denamur, E. Identification of forces shaping the commensal Escherichia coli genetic structure by comparing animal and human isolates. Environ. Microbiol. 2006, 8, 1975–1984. [Google Scholar] [CrossRef] [PubMed]
- Clermont, O.; Bonacorsi, S.; Bingen, E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000, 66, 4555–4558. [Google Scholar] [CrossRef]
- Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A.; Hooper, D.C. Qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef]
- Guillaume, G.; Verbrugge, D.; Chasseur-Libotte, M.L.; Moens, W.; Collard, J. PCR typing of tetracycline resistance determinants (tetA-E) in Salmonella enterica serotype hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol. Ecol. 2000, 32, 77–85. [Google Scholar] [CrossRef][Green Version]
- Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic resistance in the ECOR collection: Integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [Google Scholar] [CrossRef]
- Weill, F.X.; Demartin, M.; Fabre, L.; Grimont, P.A. Extended-spectrum-beta-lactamase (TEM-52)-producing strains of Salmonella enterica of various serotypes isolated in France. J. Clin. Microbiol. 2004, 42, 3359–3362. [Google Scholar] [CrossRef]
- Johnson, J.R.; Stell, A.L. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis. 2000, 181, 261–272. [Google Scholar] [CrossRef]
- Kuhnert, P.; Hacker, J.; Mühldorfer, I.; Burnens, A.P.; Nicolet, J.; Frey, J. Detection system for Escherichia coli-specific virulence genes: Absence of virulence determinants in B and C strains. Appl. Environ. Microbiol. 1997, 63, 703–709. [Google Scholar] [CrossRef]
- Bírošová, E.; Siegfried, L.; Kmet’ová, M.; Makara, A.; Ostró, A.; Gresová, A.; Urdzík, P.; Liptáková, A.; Molokácová, M.; Bártl, R.; et al. Detection of virulence factors in alpha-haemolytic Escherichia coli strains isolated from various clinical materials. Clin Microbiol. Infect. 2004, 10, 569–573. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.R.; Stapleton, A.E.; Russo, T.A.; Scheutz, F.; Brown, J.J.; Maslow, J.N. Characteristics and prevalence within serogroup O4 of a J96-like clonal group of uropathogenic Escherichia coli O4:H5 containing the class I and class III alleles of papG. Infect. Immun. 1997, 65, 2153–2159. [Google Scholar] [CrossRef] [PubMed]
- Engelstädter, J.; Harms, K.; Johnsen, P. The evolutionary dynamics of integrons in changing environments. ISME J. 2016, 10, 1296–1307. [Google Scholar] [CrossRef] [PubMed]
- Alkofide, H.; Alhammad, A.M.; Alruwaili, A.; Aldemerdash, A.; Almangour, T.A.; Alsuwayegh, A.; Almoqbel, D.; Albati, A.; Alsaud, A.; Enani, M. Multidrug-resistant and extensively drug-resistant Enterobacteriaceae: Prevalence, treatments, and outcomes—A retrospective cohort study. Infect. Drug Resist. 2020, 13, 4653–4662. [Google Scholar] [CrossRef] [PubMed]
- Caneschi, A.; Bardhi, A.; Barbarossa, A.; Zaghini, A. The use of antibiotics and antimicrobial resistance in veterinary medicine, a complex phenomenon: A narrative review. Antibiotics 2023, 12, 487. [Google Scholar] [CrossRef]
- Simjee, S.; Ippolito, G. European regulations on prevention use of antimicrobials from January 2022. Braz. J. Vet. Med. 2022, 44, e000822. [Google Scholar] [CrossRef]
- Awad, A.; Arafat, N.; Elhadidy, M. Genetic elements associated with antimicrobial resistance among avian pathogenic Escherichia coli. Ann. Clin. Microbiol. Antimicrob. 2016, 15, 59. [Google Scholar] [CrossRef]
- Ibrahim, D.; Awad, A.; Younis, G. Prevalence and characterization of quinolone-resistant Escherichia coli isolated from retail raw beef and poultry meat in Egypt. J. Adv. Vet. Anim. Res. 2023, 10, 490–499. [Google Scholar] [CrossRef]
- Türkyılmaz, O.; Darcan, C. Resistance mechanism of Escherichia coli strains with different ampicillin resistance levels. Appl. Microbiol. Biotechnol. 2024, 108, 5. [Google Scholar] [CrossRef]
- Parvin, M.S.; Talukder, S.; Ali, M.Y.; Chowdhury, E.H.; Rahman, M.T.; Islam, M.T. Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens 2020, 9, 420. [Google Scholar] [CrossRef]
- Alam, G.S.; Hassan, M.M.; Ahaduzzaman, M.; Nath, C.; Dutta, P.; Khanom, H.; Khan, S.A.; Pasha, M.R.; Islam, A.; Magalhaes, R.S.; et al. molecular detection of tetracycline-resistant genes in multi-drug-resistant Escherichia coli isolated from broiler meat in Bangladesh. Antibiotics 2023, 12, 418. [Google Scholar] [CrossRef] [PubMed]
- Caruso, G.; Giammanco, A.; Cardamone, C.; Oliveri, G.; Mascarella, C.; Capra, G.; Fasciana, T. Extra-intestinal fluoroquinolone-resistant Escherichia coli strains isolated from meat. Biomed. Res. Int. 2018, 2018, 8714975. [Google Scholar] [CrossRef] [PubMed]
- Pormohammad, A.; Nasiri, M.J.; Azimi, T. Prevalence of antibiotic resistance in Escherichia coli strains simultaneously isolated from humans, animals, food, and the environment: A systematic review and meta-analysis. Infect. Drug Resist. 2019, 12, 1181–1197. [Google Scholar] [CrossRef] [PubMed]
- Ranasinghe, R.A.S.S.; Satharasinghe, D.A.; Anwarama, P.S.; Parakatawella, P.M.S.D.K.; Jayasooriya, L.J.P.A.P.; Ranasinghe, R.M.S.B.K.; Rajapakse, R.P.V.J.; Huat, J.T.Y.; Rukayadi, Y.; Nakaguchi, Y.; et al. Prevalence and antimicrobial resistance of Escherichia coli in chicken meat and edible poultry organs collected from retail shops and supermarkets of North Western Province in Sri Lanka. J. Food Qual. 2022, 1, 8962698. [Google Scholar] [CrossRef]
- Aydin, A.; Suleymanoglu, A.A.; Abdramanov, A.; Paulsen, P.; Dumen, E. Detection of extended spectrum ß-lactamase-producing Escherichia coli with biofilm formation from chicken meat in Istanbul. Foods 2024, 13, 1122. [Google Scholar] [CrossRef]
- Sivaranjani, M.; McCarthy, M.C.; Sniatynski, M.K.; Wu, L.; Dillon, J.R.; Rubin, J.E.; White, A.P. Biofilm formation and antimicrobial susceptibility of E. coli associated with colibacillosis outbreaks in broiler chickens from Saskatchewan. Front. Microbiol. 2022, 13, 841516. [Google Scholar] [CrossRef]
- Rodrigues, S.V.; Laviniki, V.; Borges, K.A.; Furian, T.Q.; Moraes, H.L.S.; Nascimento, V.P.; Salle, C.T.P. Biofilm formation by avian pathogenic Escherichia coli is not related to in vivo pathogenicity. Curr. Microbiol. 2019, 76, 194–199. [Google Scholar] [CrossRef]
- Barilli, E.; Vismarra, A.; Frascolla, V.; Rega, M.; Bacci, C. Escherichia coli strains isolated from retail meat products: Evaluation of biofilm formation ability, antibiotic resistance, and phylogenetic group analysis. JFP 2020, 83, 233–240. [Google Scholar] [CrossRef]
- Wang, Y.; Yi, L.; Wang, Y.; Wang, Y.; Cai, Y.; Zhao, W.; Ding, C. Isolation, phylogenetic group, drug resistance, biofilm formation, and adherence genes of Escherichia coli from poultry in central China. Poult. Sci. 2016, 95, 2895–2901. [Google Scholar] [CrossRef]
- Menck-Costa, M.F.; Baptista, A.A.S.; Sanches, M.S.; Santos, B.Q.d.; Cicero, C.E.; Kitagawa, H.Y.; Justino, L.; Medeiros, L.P.; Souza, M.d.; Rocha, S.P.D.; et al. Resistance and virulence surveillance in Escherichia coli isolated from commercial meat samples: A One Health Approach. Microorganisms 2023, 11, 2712. [Google Scholar] [CrossRef]
- Shrestha, A.; Shrestha, R.; Koju, P.; Tamrakar, S.; Rai, A.; Shrestha, P.; Madhup, S.K.; Katuwal, N.; Shrestha, A.; Shrestha, A.; et al. The resistance patterns in E. coli isolates among apparently healthy adults and local drivers of antimicrobial resistance: A mixed-methods study in a suburban area of Nepal. Trop. Med. Infect. Dis. 2022, 7, 133. [Google Scholar] [CrossRef] [PubMed]
- Murase, T.; Phuektes, P.; Ozaki, H.; Angkititrakul, S. Prevalence of qnrS-positive Escherichia coli from chicken in Thailand and possible co-selection of isolates with plasmids carrying qnrS and trimethoprim-resistance genes under farm use of trimethoprim. Poult. Sci. 2022, 101, 101538. [Google Scholar] [CrossRef] [PubMed]
- Kurnia, R.S.; Indrawati, A.; Mayasari, N.L.P.I.; Priadi, A. Molecular detection of genes encoding resistance to tetracycline and determination of plasmid-mediated resistance to quinolones in avian pathogenic Escherichia coli in Sukabumi, Indonesia. Vet. World 2018, 11, 1581–1586. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, A.M.; Shimamoto, T.; Shimamoto, T. Molecular characterization of multidrug-resistant avian pathogenic Escherichia coli isolated from septicemic broilers. Int. J. Med. Microbiol. 2013, 303, 475–483. [Google Scholar] [CrossRef]
- Seo, K.W.; Lee, Y.J. Molecular characterization of fluoroquinolone-resistant Escherichia coli from broiler breeder farms. Poult. Sci. 2021, 100, 101250. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Martínez, J.M.; Cano, M.E.; Velasco, C.; Martínez-Martínez, L.; Pascual, A. Plasmid-mediated quinolone resistance: An update. J. Infect. Chemother. 2011, 17, 149–182. [Google Scholar] [CrossRef]
- Van, T.T.H.; Chin, J.; Chapman, T.; Tran, L.T.; Coloe, P.J. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Food Microbiol. 2008, 124, 217–223. [Google Scholar] [CrossRef]
- Bhattarai, R.K.; Basnet, H.B.; Dhakal, I.P.; Devkota, B. Antimicrobial resistance of avian pathogenic Escherichia coli isolated from broiler, layer, and breeder chickens. Vet. World 2024, 17, 480–499. [Google Scholar] [CrossRef]
- Al-Bahry, S.N.; Al-Mashani, B.M.; Al-Ansari, A.S.; Elshafie, A.E.; Mahmoud, I.Y. Escherichia coli tetracycline efflux determinants in relation to tetracycline residues in chicken. Asian Pac. J. Trop. Med. 2013, 6, 718–722. [Google Scholar] [CrossRef]
- Richter, S.N.; Frassona, I.; Bergob, C.; Manganellia, R.; Cavallarob, A.; Palù, G. Characterisation of qnr plasmid-mediated quinolone resistance in Enterobacteriaceae from Italy: Association of the qnrB19 allele with the integron element ISBR1 in Escherichia coli. Int. J. Antimicrob. Agents 2010, 35, 578–583. [Google Scholar] [CrossRef]
- Kocúreková, T.; Karahutová, L.; Bujňáková, D. Antimicrobial susceptibility and detection of virulence-associated genes in Escherichia coli strains isolated from commercial broilers. Antibiotics 2021, 10, 1303. [Google Scholar] [CrossRef] [PubMed]
- Savin, M.; Bierbaum, G.; Kreyenschmidt, J.; Schmithausen, R.M.; Sib, E.; Schmoger, S.; Käsbohrer, A.; Hammerl, J.A. Clinically relevant Escherichia coli isolates from process waters and wastewater of poultry and pig slaughterhouses in Germany. Microorganisms 2021, 9, 698. [Google Scholar] [CrossRef] [PubMed]
- Sarowska, J.; Futoma-Koloch, B.; Jama-Kmiecik, A.; Frej-Madrzak, M.; Ksiazczyk, M.; Bugla-Ploskonska, G.; Choroszy-Krol, I. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources: Recent reports. Gut Pathog. 2019, 11, 10. [Google Scholar] [CrossRef] [PubMed]
- Mellata, M.; Johnson, J.R.; Curtiss, R., 3rd. Escherichia coli isolates from commercial chicken meat and eggs cause sepsis, meningitis and urinary tract infection in rodent models of human infections. Zoonoses Public Health 2018, 65, 103–113. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequences (5′–3′) | Annealing Temperature | Product Size | References |
---|---|---|---|---|
16S rRNA | GACCTCGGTTTAGTTCACAGA CACACGCTGACGCTGACCA | 55 °C | 585 bp | [22] |
chuA | ATGATCATCGCGGCGTGCTG AAACGCGCTCGCGCCTAAT | 65 °C | 281 bp | [29] |
yjaA | TGTTCGCGATCTTGAAAGCAAACGT ACCTGTGACAAACCGCCCTCA | 65 °C | 216 bp | [29] |
TspE4.C2 | GCGGGTGAGACAGAAACGCG TTGTCGTGAGTTGCGAACCCG | 65 °C | 152 bp | [29] |
qnrA | ATTTCTCACGCCAGGATTTG GATCGGCAAAGGTTAGGTCA | 57 °C | 516 bp | [32] |
qnrB | GATCGTGAAAGCCAGAAAGG ACGATGCCTGGTAGTTGTCC | 57 °C | 469 bp | [32] |
qnrS | ACGACATTCGTCAACTGCAA TAAATTGGCACCCTGTAGGC | 57 °C | 417 bp | [32] |
tetA | GGCCTCAATTTCCTGACG AAGCAGGATGTAGCCTGTGC | 54 °C | 372 bp | [33] |
tetB | GAGACGCAATCGAATTCGG TTTAGTGGCTATTCTTCCTGCC | 54 °C | 228 bp | [33] |
Int1 | GGGTCAAGGATCTGGATTTCG ACATGCGTGTAAATCATCGTCG | 62 °C | 483 bp | [34] |
Int2 | CACGGATATGCGACAAAAAGGT GTAGCAAACGAGTGACGAAATG | 62 °C | 788 bp | [34] |
Tn3 | CACGAATGAGGGCCGACAGGA ACCCACTCGTGCACCCAACTG | 62 °C | 500 bp | [35] |
kpsMT II | GCGCATTTGCTGATACTGTTG CATCCAGACGATAAGCATGAGCA | 63 °C | 272 bp | [36] |
fimA | GGCGAATTCTGTTCTGTCGGCTCTGTC TTGGAATTCAACCTTGAAGGTCGCATC | 52 °C | 510 bp | [37] |
papC | GACGGCTGTACTGCAGGGTGTGGCG ATATCCTTTCTGCAGGGATGCAATA | 65 °C | 328 bp | [38] |
iutA | GGCTGGACATCATGGGAACTGG CGTCGGGAACGGGTAGAATCG | 63 °C | 300 bp | [39] |
cvaC | CACACACAAACGGGAGCTGTT CTTCCCGCAGCATAGTTCCAT | 63 °C | 680 bp | [36] |
Phylogenetic Groups and Subgroups | |||||||
---|---|---|---|---|---|---|---|
Number (%) of Samples | A0 | A1 | B1 | B22 | B23 | D1 | D2 |
Chicken cloacal swabs (n = 23) | 0 (0) | 6 (26.1%) | 6 (26.1%) | 2 (8.7%) | 1 (4.3%) | 1 (4.3%) | 7 (30.5%) |
Chicken thigh muscle meat (n = 11) | 1 (9.1%) | 3 (27.3%) | 4 (36.4%) | 0 (0) | 0 (0) | 1 (9.1%) | 2 (18.2%) |
Genetic Determinant | Cloacal Swabs (n = 23) | Chicken Meat (n = 11) | ||
---|---|---|---|---|
Commensals | Pathogens | Commensals | Pathogens | |
Isolates with Virulence Genes | 11 (n = 12) | 11 (n = 11) | 8 (n = 8) | 3 (n = 3) |
qnrA | 4 | 1 | 4 | – |
qnrB | 1 | – | – | – |
qnrS | 2 | 3 | – | – |
qnrAB | – | – | – | 1 |
tetA | 9 | 8 | 6 | 2 |
tetB | 1 | 2 | – | 1 |
tetAB | – | 2 | – | 1 |
Int1 | 5 | 9 | 3 | 1 |
Int2 | – | – | – | – |
Tn3 | 10 | 11 | 4 | 1 |
kpsMT II | 1 | 1 | – | 1 |
fimA | 11 | 11 | 8 | 3 |
papC | – | – | – | – |
iutA | 7 | 11 | 6 | 2 |
cvaC | 3 | 4 | 4 | 2 |
biofilm formation | 2 | 1 | – | 1 |
No. of Strain | Phenotypic Resistance | Resistance Mechanism | Biofilm Formation | Phylogenetic Typing | Genotypic Resistance | Mobile Genetic Elements | Virulence Factors |
---|---|---|---|---|---|---|---|
E. coli from chicken cloacal swabs | |||||||
1C | AMP | – | Non-biofilm | A1 | tetA | Tn3 | fimA, iutA |
2C | – | Quinolone Incompl. Resistance | Weak | B1 | qnrA | – | fimA, cvaC, iutA |
3C | AMP | Quinolone Incompl. Resistance | Non-biofilm | A1 | tetA | Tn3 | fimA, iutA |
4C | AMP | – | Non-biofilm | B23 | tetA, tetB | Int1, Tn3 | fimA, iutA |
5C | AMP | – | Non-biofilm | A1 | tetA | Tn3 | fimA, iutA |
6C | AMP, TET, COT | Penicillinase:low | Non-biofilm | D2 | tetA | Int1, Tn3 | fimA, cvaC, iutA |
7C | AMP | – | Non-biofilm | D2 | qnrA | Tn3 | fimA, cvaC, iutA |
8C | AMP | – | Non-biofilm | A1 | tetA | Tn3 | fimA, iutA |
9C | AMP, TET | Penicillinase:low | Non-biofilm | D2 | tetA | Int1, Tn3 | fimA, iutA |
10C | AMP, COT | Penicillinase:low | Non-biofilm | B1 | tetB, qnrA | Int1, Tn3 | fimA, cvaC, iutA |
11C | AMP | Penicillinase:low | Non-biofilm | B1 | tetA, qnrA | – | fimA |
12C | AMP, TET, COT | – | Weak | D2 | tetA, qnrS | Int1, Tn3 | fimA, cvaC, iutA |
13C | AMP, TET, COT | Penicillinase:low | Non-biofilm | D2 | tetA | Int1, Tn3 | fimA, iutA |
14C | AMP, TET, COT | – | Non-biofilm | B1 | tetA, qnrS | Int1, Tn3 | fimA |
15C | AMP, TET | Penicillinase:low | Non-biofilm | D2 | tetA, qnrS | Int1, Tn3 | fimA, cvaC, iutA |
16C | AMP, TET, COT | Penicillinase:low; Quinolone Incompl. Resistance | Non-biofilm | A1 | tetA, qnrB | Int1, Tn3 | – |
17C | AMP, TET, COT | Penicillinase:low | Non-biofilm | D2 | tetA | Int1, Tn3 | fimA, iutA |
18C | COT | Quinolone Incompl. Resistance | Non-biofilm | B22 | tetA, tetB, qnrS | Int1, Tn3 | kpsMT II, fimA, iutA |
19C | AMP | Quinolone Incompl. Resistance | Non-biofilm | B22 | tetA | Tn3 | fimA, iutA |
20C | AMP, SAM, TET, COT | Quinolone Incompl. Resistance | Non-biofilm | B1 | tetA, qnrS | Int1, Tn3 | fimA |
21C | AMP, TET | Penicillinase:low | Strong | A1 | tetA | Tn3 | kpsMT II, fimA |
22C | AMP, CAZ, CIP, TET, COT | Multiresistance! | Non-biofilm | D1 | tetA | Int1, Tn3 | fimA, iutA |
23C | AMP, COT | Penicillinase:high! | Non-biofilm | B1 | qnrA | Int1, Tn3 | fimA, cvaC, iutA |
E. coli from chicken meat samples | |||||||
1M | AMP, SAM | Quinolone Incompl. Resistance | Non-biofilm | A1 | tetA | – | fimA, cvaC, iutA |
2M | – | Quinolone Incompl. Resistance | Non-biofilm | A1 | tetA | – | fimA, cvaC, iutA |
3M | – | Quinolone Incompl. Resistance | Non-biofilm | A1 | tetA | – | fimA, cvaC, iutA |
4M | AMP, SAM, CIP, TET, COT | – | Non-biofilm | B1 | tetA, qnrA | Int1, Tn3 | fimA, iutA |
5M | AMP, CIP, TET, COT | – | Non-biofilm | A0 | tetA | Int1, Tn3 | fimA |
6M | AMP, SAM, CIP | – | Non-biofilm | B1 | qnrA | Tn3 | fimA |
7M | AMP, CIP | Penicillinase:low | Weak | D2 | tetA, qnrA, qnrB | – | kpsMT II, fimA, cvaC, iutA |
8M | AMP, CIP, TET, COT | Penicillinase:high! | Non-biofilm | D2 | tetB | Int1, Tn3 | fimA, iutA |
9M | – | Quinolone Incompl. Resistance | Non-biofilm | D1 | tetA, tetB | – | fimA, cvaC |
10M | – | Quinolone Incompl. Resistance | Non-biofilm | B1 | qnrA | – | fimA, cvaC, iutA |
11M | AMP, SAM, CIP, TET, COT | – | Non-biofilm | B1 | tetA, qnrA | Int1, Tn3 | fimA, iutA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dančová, N.; Gregová, G.; Szabóová, T.; Regecová, I.; Király, J.; Hajdučková, V.; Hudecová, P. Quinolone and Tetracycline-Resistant Biofilm-Forming Escherichia coli Isolates from Slovak Broiler Chicken Farms and Chicken Meat. Appl. Sci. 2024, 14, 9514. https://doi.org/10.3390/app14209514
Dančová N, Gregová G, Szabóová T, Regecová I, Király J, Hajdučková V, Hudecová P. Quinolone and Tetracycline-Resistant Biofilm-Forming Escherichia coli Isolates from Slovak Broiler Chicken Farms and Chicken Meat. Applied Sciences. 2024; 14(20):9514. https://doi.org/10.3390/app14209514
Chicago/Turabian StyleDančová, Nikola, Gabriela Gregová, Tatiana Szabóová, Ivana Regecová, Ján Király, Vanda Hajdučková, and Patrícia Hudecová. 2024. "Quinolone and Tetracycline-Resistant Biofilm-Forming Escherichia coli Isolates from Slovak Broiler Chicken Farms and Chicken Meat" Applied Sciences 14, no. 20: 9514. https://doi.org/10.3390/app14209514
APA StyleDančová, N., Gregová, G., Szabóová, T., Regecová, I., Király, J., Hajdučková, V., & Hudecová, P. (2024). Quinolone and Tetracycline-Resistant Biofilm-Forming Escherichia coli Isolates from Slovak Broiler Chicken Farms and Chicken Meat. Applied Sciences, 14(20), 9514. https://doi.org/10.3390/app14209514