Next Article in Journal
Research on the Jiamusi Area’s Shallow Groundwater Recharge Using Remote Sensing and the SWAT Model
Previous Article in Journal
Football Analytics: Assessing the Correlation between Workload, Injury and Performance of Football Players in the English Premier League
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Age-Associated Changes in Carotid Intima–Media Thickness in Relation to Redox Balance Indices in Metabolic Syndrome

by
Ganka Y. Bekyarova
1,
Nicolai A. Bekyarov
2,
Valentina H. Madjova
2,
Christiana R. Madjova
3,
Evgenia D. Kalevska
4,
Ayshe S. Salim
5,
Deyana G. Vankova
5,
Diana G. Ivanova
5 and
Yoana D. Kiselova-Kaneva
5,*
1
Department of Physiology and Pathophysiology, Medical University of Varna, 9002 Varna, Bulgaria
2
Department of General Medicine, Medical University of Varna, 9002 Varna, Bulgaria
3
Department of Conservative Dental Treatment and Oral Pathology, Medical University of Varna, 9002 Varna, Bulgaria
4
Department of Neurology and Neuroscience, Medical University of Varna, 9002 Varna, Bulgaria
5
Department of Biochemistry, Molecular Medicine and Nutrigenomics, Medical University of Varna, 9002 Varna, Bulgaria
*
Author to whom correspondence should be addressed.
Appl. Sci. 2024, 14(16), 7218; https://doi.org/10.3390/app14167218
Submission received: 20 May 2024 / Revised: 24 July 2024 / Accepted: 9 August 2024 / Published: 16 August 2024
(This article belongs to the Section Applied Biosciences and Bioengineering)

Featured Application

In this study, we evaluated the relationship among the carotid intima–media thickness (CIMT), the redox balance parameters of plasma asymmetric dimethylarginine (ADMA), malondialdehyde (MDA), and HO-1, and the expression of oxidative stress-related NF-kB, Nrf2, and HO-1 in peripheral blood mononuclear cells as biomarkers in metabolic syndrome (MetS).

Abstract

Metabolic syndrome (MetS) is defined by the World Health Organisation (WHO) as a pathologic condition characterized by abdominal obesity, insulin resistance, hypertension, and hyperlipidaemia. The components of MetS and the associated cardiovascular risks may disrupt the vascular endothelial function and the structure of the vascular wall, increasing the risk of atherosclerosis and vascular diseases. In this study we evaluated the relationship between the carotid intima–media thickness (CIMT), the redox balance parameters of plasma asymmetric dimethylarginine (ADMA), malondialdehyde (MDA), and heme oxygenase 1 (HO-1), and the expression of oxidative stress-related nuclear factor kappa B (NF-kB), nuclear factor erythroid 2-related factor 2 (Nrf2), and HO-1 in peripheral blood mononuclear cells (PBMCs) in MetS. Significantly higher CIMT was established in MetS patients aged ≥ 55 years as compared with the control group (0.96 ± 0.29 vs. 0.74 ± 0.21, p < 0.05). Expression was higher in MetS patients aged < 55 years (83% for NF-kB, p < 0.05; 251% for Nrf2, p < 0.05, and 337% for HO-1, p < 0.05) in comparison to the control group. Similarly, expression was higher in CIMT < 0.90 mm than the control group by 80% for NF-kB, p < 0.01; 260% for Nrf2, p < 0.05, and 303% for HO-1, p < 0.05. In contrast, gene expression was under-regulated in the subgroups of MetS patients aged ≥ 55 years and MetS patients with CIMT ≥ 0.90 mm. Significantly higher plasma levels for MDA, ADMA, and HO-1 were established in the age < 55 and age ≥ 55 MetS subgroups and the CIMT < 0.90 mm and CIMT ≥ 0.90 mm subgroups. In conclusion, MetS individuals aged ≥ 55 are at higher risk of increased CIMT and impaired redox balance.

1. Introduction

Metabolic syndrome (MetS) is defined by the World Health Organisation (WHO) as a pathologic condition characterized by abdominal obesity, insulin resistance, hypertension, and hyperlipidaemia [1]. The components of MetS and the associated cardiovascular risks may disrupt the vascular endothelial function and the structure of the vascular wall, increasing the risk of atherosclerosis and vascular diseases [2]. Endothelial dysfunction (ED) is one of the major factors in the pathogenesis of MetS and atherosclerosis [3,4]. Recently, asymmetric dimethylarginine (ADMA), which is an endogenous inhibitor of nitric oxide synthetase and NO, was described as an emerging cardiovascular risk factor [5,6]. Carotid intima–media thickness (CIMT) and ADMA are currently widely used markers for ED and increased risk of cardiovascular diseases (CVDs) and atherosclerosis [7,8,9]. The ED molecular mechanisms in MetS are not completely understood, but free radicals and inflammatory mediators are thought to be involved. Oxidative stress and inflammation induced by high low-density lipoproteins (LDL) or by tumour necrosis factor alpha (TNF-alpha) increase plasma ADMA [3]. Previous studies have demonstrated that ADMA could lead to a concentration-dependent increase in the production of reactive oxygen species (ROS), which act as second messengers and activate nuclear factor kappa B (NF-kB) in endothelial cells [10].
Oxidative stress is a predominant factor for endothelial cell activation and dysfunction and oxidative stress-induced endothelial cell injury. The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is well recognized as a critical regulator of redox and metabolic homeostasis and an inflammation regulator as well [11,12].
Nrf2, a redox-sensitive transcription factor, increases the expression of heme oxygenase 1 (HO-1) and other genes [11], playing an important role in endothelial protection against oxidative stress [12]. HO-1 is expressed at low levels in endothelial cells and white blood cells under physiological conditions. It is highly inducible in response to stress [13]. HO-1 catalyses the degradation of heme to carbon monoxide and bilirubin, which also have cytoprotective effects for ED against various stresses [14,15]. It suppresses NF-kB expression and the production of proinflammatory mediators and reverses impaired eNOS expression in response to oxidized LDL and TNF-alpha [16]. There are very few studies examining plasma HO-1 in patients with MetS and atherosclerosis [17,18].
Activation of Nrf2/HO-1 signalling is beneficial for protecting endothelial cells from oxidative stress-induced injury and controlling atherosclerosis [19]. Reduced Nrf2 expression damages the function of endothelial progenitor cells, induces aging, and increases the risk of CVDs.
The Nrf2/HO-1 signalling pathway, being an indispensable one in the oxidative stress response, is involved in anti-inflammatory, antioxidant, apoptosis, and other processes and is among the important targets for atherosclerosis treatment. Activation of the Nrf2/HO-1 signalling pathway is an important molecular mechanism of herbal medicine in the protection of endothelial cells against oxidative stress injury in cardiometabolic diseases [19].
Carotid intima–media thickness can be used as a structural marker of subclinical atherosclerosis and is correlated with ED [20,21]. The relationship between CIMT and various endothelial function biomarkers in individuals with MetS has not been sufficiently clarified [22]. Carotid intima–media thickness is a marker to assess subclinical manifestations of cardiovascular and metabolic diseases and is a strong predictor of future cerebral and cardiovascular events [23].
This study evaluated the relationship between age and CIMT, expression levels of Nrf2, HO-1, NF-kB in Peripheral Blood Mononuclear Cells (PBMC) and plasmaADMA, and malondialdehyde (MDA) as biomarkers of ED and oxidative stress in MetS.

2. Materials and Methods

2.1. Participants

The investigation study was approved by the local Ethics Committee at the Medical University of Varna (Protocol. 86/26 September 2019, Varna, Bulgaria). Written informed consent was obtained from all participants. A total of 44 people (39 females, 5 males) were included in this case-control study. They were divided into two groups: those newly diagnosed with MetS (n = 30) and nonmetabolic, clinically healthy individuals (a control group) (n = 14). According to CEP-ATP III criteria [24] (the presence of three or more of the following: waist circumference ≥ 102 cm (men) or ≥88 cm (women); blood pressure ≥ 130/85 mmHg or treatment for hypertension; triglycerides ≥ 1.7 mmol/L (≥150 mg/dL); high-density lipoprotein (HDL) cholesterol < 1.03 mmol/L (<40 mg/dL) for men or <1.29 mmol/L (<50 mg/dL) for women), 30 individuals were selected for the MetS group. The participants were newly diagnosed and indicated as having MetS based on the abovementioned criteria and were not under treatment for the condition. Inclusion and exclusion criteria of the study were as follows: inclusion criteria—individuals with elevated blood pressure, blood sugar, obesity, dyslipidaemias, and high levels of triglycerides, cholesterol, and uric acid in the blood, as well as those who have relatives (mother, father) with diabetes mellitus, arterial hypertension, and obesity; exclusion criteria—vascular accident, autoimmune, psychiatric, and malignant diseases.
For biochemical analysis, venous fasting blood was collected in vacutainers (EDTA). Plasma was separated by centrifugation at 1500 rpm for 15 min, aliquoted, and stored at −20 °C. Subsequent analyses were performed immediately after the thawing of the samples. Plasma lipid parameters (total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides) were measured using routine methods.

2.2. Laboratory Tests

Plasma MDA as a lipid peroxidation marker was measured according to its thiobarbituric acid (TBA) reactivity in plasma using the method of Porter et al. [25]. Data are presented in mmol/L. Plasma ADMA concentrations were determined using an ELISA assay kit (DLD Diagnostica GMBH, Hamburg, Germany) after it was validated locally. The method was validated in compliance with the international standard of quality and competence of medical laboratories (BDS/EN/ISO 15189). Measurements were performed in duplicate. Data are presented in mmol/L. Plasma HO-1 concentrations were determined using an ELISA assay kit (EKS-800, Stressgen Bioreagents; now Assay Designs, Ann Arbor, MI, USA). Data are presented in ng/mL.

2.3. Peripheral Blood Mononuclear Cell (PBMC) Collection

Peripheral blood mononuclear cells were separated from whole blood (6 mL) and collected in lithium heparin vacutainers. The separation of PBMCs was carried out using a Ficoll separation medium with a density of 1.077 g/L and 50 mL LeucoSep™ centrifuge separation tubes (GreinerBioOne, Kremsmünster, Austria) with a separation barrier for PBMC separation based on density gradient centrifugation and purification, following the manufacturer’s instructions.

2.4. Gene Expression Analysis

TRI reagent (Ambion®, Life Technologies, Waltham, MA, USA) was used for total RNA extraction from PBMCs. cDNA was synthesized from 0.1 μg of total RNA with a Revert Aid First Strand cDNA Synthesis Kit (ThermoScientific, Waltham, MA, USA). Relative gene expression analysis was performed with two-step real-time qPCR. SYBR Green qPCR MasterMix with ROX (KAPA SYBR FAST qPCR Kit, KAPA BIOSYSTEMS, Wilmington, MA, USA) was used for the real-time PCR reaction and primer sets were as follows: U6 F: GCTTCGGCAGCACATATACTAAAAT; R: CGCTTCACGAATTTGCGTGTCAT; HMOX1 F: TCAGGCAGAGGGTGATAGAAG; R: TTGGTGTCATGGGTCAGC; NRF2 F: TCCAGTCAGAAACCAGTGGAT; R: GAATGTCTGCGCCAAAAGCTG; NF-kB F: AGAGGCTTCCGATTTCGATATGG; R: GGATAGGTCTTTCGGCCCTTC. Real-time PCR was carried out on an Applied Biosystems® 7500 Real-Time qPCR instrument (Waltham, MA, USA). Gene expression levels of the genes of interest were calculated according to the 2−∆∆Ct method, where U6 served as endogenous control.

2.5. Carotid Ultrasonography

Carotid intima–media thickness, which is a surrogate marker for the presence and progression of atherosclerosis, was determined by B-mode ultrasound [23]. In the study, we examined the carotid arteries of patients using an Aloka Alpha 6 device (ProSound Digital Color System) by B-mode ultrasound and a linear transducer (38 mm) with a frequency of 4–13 MHz (16 MHz BBH-Rx). Determining in advance the depth, the course of the artery, and the level of its division into external and internal branches with Doppler sonography, we followed the blood flow and visualized the changes in the vessel wall.
The main indicator that could be calculated in this study was CIMT, which is considered by many authors as a surrogate marker for the presence and progression of atherosclerosis [26]. We made three standard measurements for the CIMT indicator on each side, resp. at 0.5, 1, and 2 cm below the bifurcation of the carotid artery, taking as reliable the mean value of the intima–media thickness (IMT). We measured arterial intima thickness and intimal thickening as an indicator of early atherosclerosis. Using the ESC/ESH criteria for arterial hypertension (AH), we defined normal CIMT (<0.9 mm) and increased CIMT (>0.9 mm) [26].

2.6. Statistical Analysis

Data were presented as mean ± SEM or percentage (%), depending on what was deemed more appropriate for the purpose. Data analysis was performed on GraphPad Prism v. 8.3. and SPSS v. 23. Standard statistical methods, such as descriptive statistics, unpaired Student’s t-tests for normally distributed parameters, and one-way ANOVA, GraphPad Prism v. 8.3., with Bonferroni correction, were used.

3. Results

3.1. Baseline Characteristics of Study Subjects

Baseline characteristics of participants involved in this study are presented in Table 1.

3.2. CIMT in MetS Based on Age

A gradual increase in CIMT in MetS with age was established (Figure 1). A statistically significant higher average CIMT was established in the MetS age ≥ 55 subgroup as compared with the control group (0.96 ± 0.29 vs. 0.74 ± 0.21, p < 0.05).

3.3. NF-kB, Nrf2, and HO-1 Expression in PBMC Based on Age

A significantly increased expression of the three studied genes in the age < 55 MetS subgroup was detected (Figure 2). The increase in mRNA levels was as follows: 83% for NF-kb (p < 0.05), 251% for Nrf2 (p < 0.05), and 337% for HO-1 (p < 0.05). It is obvious that the expression level of these genes in PBMC is elevated in patients under 55 years of age, and HO-1 appears to be the most affected among the studied genes. In contrast, in the MetS subgroup with individuals over 55 years of age, the genes were under-regulated, achieving the levels of the control group, resulting in a statistically significant difference between the age < 55 and age ≥ 55 MetS subgroups (Figure 1).

3.4. NF-kB, Nrf2, and HO-1 Expression in PBMC Based on CIMT

The NF-kB, NRF2, and HO-1 expression, depending on CIMT, followed the same pattern as the dependence on age. The MetS group was subdivided according to the values of their CIMT: MetS with CIMT < 0.90 mm and MetS with CIMT ≥ 0.90 mm. A CIMT of 0.90 mm was considered a cut-off value.
A significantly increased expression of the three studied genes in the MetS group with CIMT < 0.90 mm was detected as follows: 80% for NF-kB (p < 0.01); 260% for Nrf2 (p < 0.05), and 303% for HO-1 (p < 0.05). Again, a trend was observed with NF-kB, NRf2, and HO-1 expression levels in PBMC changing with age and HO-1 being the most affected among the three studied genes. Similar to the results about the dependence of NF-kB, NRf2, and HO-1 expression on age, here, data show that in the MetS subgroup with individuals with CIMT ≥ 0.90 mm, these genes were under-regulated, achieving the levels of the control group or even lower, with a statistically significant difference between the MetS subgroups with different CIMT being established (Figure 3).

3.5. Age Dependence of Plasma ADMA, MDA, and HO-1 Levels

We studied how the plasma levels of MDA, ADMA, and HO-1 enzymes changed with age. Data indicated significantly higher plasma levels for MDA and ADMA in both age < 55 and age ≥ 55 MetS subgroups. HO-1 was higher in the age < 55 subgroup only (Figure 4). The difference between the two MetS subgroups was not significant.

3.6. MDA, ADMA, and HO-1 Plasma Levels Based on CIMT

Data about plasma levels of MDA, ADMA, and HO-1 based on CIMT (mm) are shown in Figure 5. There were significantly higher plasma levels of the studied parameters in both MetS subgroups, based on CIMT, as compared to the control group. A difference between the two MetS subgroups based on CIMT was not established (Figure 5).

4. Discussion

In the present study, we investigated the relationship between CIMT, plasma ADMA as a marker of ED, and MDA as a marker for oxidative stress, as well as the expressions of Nrf2, HO-1, and NF-kB in PBMCs in MetS.
Data in Figure 1 indicate a gradual increase in CIMT with age. However, a statistically significant higher average IMT was established in the age < 55 MetS subgroup only, compared with the control group (0.96 ± 0.29 vs. 0.74 ± 0.21, p < 0.05). It has been reported that CIMT is elevated in diabetes mellitus, hypertension, and obesity, all of them components of MetS [27,28,29]. An increase in CIMT, measured by ultrasonography, is directly associated with an increased risk of myocardial infarction and stroke, even in older people without a history of CVD [23].
It has been reported that the presence and severity of MetS is associated with an increase in vascular thickness in different populations, a phenomenon conceptualized as early vascular aging [30]. The consequences of oxidative stress and low-grade inflammation, causing ED and impairment, are exacerbated with the increase in age [31]. There is strong evidence suggesting that Nrf2 protects against the induction of cellular senescence. Vascular oxidative stress in aging is associated with Nrf-2 dysfunction [31].
Nrf2, a redox-sensitive transcription factor, transcribes HO-1 and many antioxidant genes [31]. They play an important role in endothelial protection in oxidative stress in MetS [11,12]. Reactive oxygen species and products of lipid peroxidation, as well as low-grade inflammation, are crucial factors for the activation of Nrf2 and NF-kB [32,33]. We can speculate that protective mechanisms involving Nrf2 and HO-1 decline with age. This could be a reason for the worsening of endothelial function and the accelerated endothelial damage in vessels, registered by an increase in CIMT and risk of cardiovascular complications and incidents. For this reason, we analysed how the average IMT in the MetS group depended on age on the one hand and how NF-kB, Nrf2, and HO-1 expression in PBMC depended on IMT on the other. Data are shown in Figure 2 and Figure 3.
We studied how expression levels of NF-kB, Nrf2, and HO-1 in PBMCs of MetS individuals varied according to age and CIMT. The control group was designed to contain healthy individuals aged < 55 years. The MetS group included individuals both under and over 55 years of age. As shown in Figure 2, a significantly increased expression of the three studied genes in the age < 55 MetS subgroup was detected. The increase in the mRNA levels in the age < 50 MetS subgroup was as follows: 83% for NF-kB (p < 0.05), 251% for Nrf2 (p < 0.05), and 337% for HO-1 (p < 0.05). It is obvious that the expression level of these genes in PBMC changes with age and that HO-1 appears to be the most affected among the studied genes. In contrast, in the MetS subgroup with individuals aged over 55 years, it is visible that these genes are under-regulated, achieving the levels of the control group. Thus, the difference between the age < 55 MetS and age ≥ 55 MetS subgroups was determined to be statistically significant (Figure 2).
As shown in Figure 3, a significantly increased expression of the three studied genes in the MetS group with IMT < 0.9 mm was detected. The increase in the mRNA levels in the MetS with CIMT < 0.90 mm subgroup was as follows: 80% for NF-kB (p < 0.01), 260% for Nrf2 (p < 0.05), and 303% for HO-1 (p < 0.05). Again, a trend was detected with NF-kB, NRf2, and HO-1 expression levels in PBMC changing with age and HO-1 being the most affected among the studied genes. Similar to the results about the dependence of NF-kB, Nrf2, and HO-1 expressions on age, here, data show that in the MetS subgroup with individuals with IMT ≥ 0.90 mm, these genes were under-regulated, achieving the levels of the control group or even lower, leading to the establishment of statistical significance between the MetS subgroups with different CIMT (Figure 3).
HO-1 is an enzyme induced by Nrf2, playing a critical role in antioxidant defence. It is considered beneficial due to its protective effect against oxidative damage [15]. HO-1 has been described as a key regulator of adaptive cellular response to oxidative stress and low-grade inflammation. It plays a role in cellular homeostasis through the strong antioxidant activity of bilirubin and the anti-inflammatory effect of carbon monoxide [34,35]. In humans, HO-1 deficiency has been known to cause oxidative stress and endothelial cell injury [14]. In brief, upregulation of the HO-1 protein may represent an attempt to minimize endothelial injury [13].
The difference between the MetS subgroups (MetS with age < 55 and MetS with age ≥ 55) was not significant, indicating that these parameters do not vary with age. Similarly, MDA, ADMA, and HO-1 plasma levels were significantly higher in the MetS subgroups based on IMT as compared to the controls and did not differ between the two MetS subgroups divided according to their CIMT (Figure 5).
It has been proven that increased MDA levels as a marker of oxidative stress and lipid peroxidation and ADMA as an endogenous competitive inhibitor of nitric oxide synthase may lead to reduced eNOS activity and NO levels, contributing to ED in diabetes mellitus [36].
Asymmetric dimethylarginine may activate NF-B, which is responsible for the expression of endothelin-1 and other proinflammatory mediators, such as TNF-alpha, interleukin 6 (IL-6), free radicals, chemokines, and adhesives molecules, as well as inducible NO synthase (iNOS), contributing to endothelial injury [10,16]. We showed that increased NF-kB expression corresponds to elevated plasma ADMA and MDA levels. In addition, the increased plasma ADMA concentrations were found to cause an increase in superoxide (O2−) production. Superoxide can combine with NO to form peroxynitrite [37], a radical with potentially deleterious effects on the vascular wall, which further contributes to the exacerbation of endothelial injury and the increase of IMT.
The activation of the Nrf2/HO-1 signalling pathway plays a critical role in the antioxidant defence of endothelial cells in response to various inflammatory and oxidative stimuli [38]. Increased plasma HO-1 levels can inhibit oxidative stress and low-grade inflammation, thus improving endothelial function by enhancing NO levels [39]. It has been reported that the increased HO-1 and heme degradation products can improve endothelial function, at least in part, by compensating for the loss of NO bioavailability due to elevated plasma ADMA levels [39].
Our data indicate increased CIMT and elevated plasma ADMA and MDA levels, which are markers of oxidative stress in individuals with MetS. This is in accordance with other investigations [7,8,9,40]. Increased ADMA levels, a marker of ED, and increased CIMT are among the early manifestations of atherosclerosis [41,42]. Our data show that plasma HO-1 and CIMT are elevated in people with MetS, which corresponds with the findings of other authors [17]. High plasma HO-1 levels may reflect an increased oxidative stress condition and may be aimed at protecting against carotid atherosclerosis progression [18]. The imbalanced production of ROS and/or the damaged antioxidant defence system at an advanced age are probably the cause of the earlier development of morphological changes in the endothelium, registered by the increase of CIMT and the risk of late clinical complications and incidents [18].
Nrf2 decreases oxidative stress by regulating the expression of HO-1 and other antioxidant genes, while ADMA, MDA, and NF-kB increase oxidative stress and low-grade inflammation by contributing to ED, inhibiting the nitric oxide synthase pathway [43]. Endothelial damage caused by atherosclerosis risk factors occurs early, before measurable changes in the vascular wall, such as CIMT [44]. Our study assesses, for the first time, the relationship between CIMT, ED biomarkers, and oxidative stress in MetS. As ED and increased IMT are interrelated, indicative of different aspects of the atherosclerotic process, their early detection may be important for cardiovascular prevention.
Based on the present and previous findings, we suggest that measuring ADMA levels, together with oxidative stress markers (MDA, HO-1, and Nrf2), may be a promising step in developing an effective model to monitor the severity of CIMT and atherosclerosis in patients with MetS. Carotid intima–media thickness is an important tool for early screening to assess subclinical manifestations of cardiovascular and metabolic diseases and a strong predictor of future cerebral and cardiovascular complications [45]. There are convincing data that the protective effect of some natural agents (phenylpropanoids, flavonoids, terpenoids, alkaloids, stilbenes, and quinones) on endothelial cells against oxidative stress-induced injury is mainly due to the activation of the Nrf2/HO-1 signalling pathway [19].
A limitation of the study is the size of the cohort. This is a pilot study to check the hypothesis that expression of oxidative stress- and inflammation-related genes in PBMC may reflect pathologies. Particularly, we found that in MetS, expression is dependent on IMT. In addition, age appears to be a factor, defining the expression in PBMC in MetS. Increasing the size of the study population would provide more detailed data about the molecular mechanisms of MetS impairments. Furthermore, the applicability of molecular biomarkers, including the PBMC expression levels of the selected genes in personalized and translational medicine, can be assessed. In addition, in this cohort, there was a gender imbalance. Improving the study in this direction will elucidate whether there are gender-dependent differences in MetS.

5. Conclusions

Our study establishes that individuals with imbalanced ROS production and/or impaired antioxidant defence systems are at high risk of increased CIMT and cardiovascular risk. Investigating the relationship among CIMT, the expressions of Nrf2, HO-1, NF-kB in PBMC, and plasma ADMA and MDA would contribute to elucidating the complex pathophysiological mechanisms of endothelial injury, which is important for the prevention, early diagnosis, and treatment strategy of MetS. Profound transcriptome analyses of PBMC in MetS would be of help for the identification of reliable biomarkers for fundamental research and, eventually, for the implementation of translational research and personalized medicine.

Author Contributions

Conceptualization, G.Y.B. and Y.D.K.-K.; methodology, D.G.V., A.S.S. and E.D.K.; validation, V.H.M.; formal analysis, D.G.V., A.S.S., N.A.B. and C.R.M.; investigation, N.A.B., D.G.V., A.S.S., C.R.M., V.H.M. and E.D.K.; resources, V.H.M.; data curation, N.A.B., D.G.V., A.S.S. and D.G.I.; writing—original draft preparation, G.Y.B.; writing—review and editing, Y.D.K.-K. and D.G.I.; visualization, Y.D.K.-K. and C.R.M.; supervision, Y.D.K.-K.; project administration, Y.D.K.-K.; funding acquisition, D.G.I. All authors have read and agreed to the published version of the manuscript.

Funding

This study is financed by the European Union-NextGenerationEU through the National Recovery and Resilience Plan of the Republic of Bulgaria, project No. BG-RRP-2.004-0009-C02, Research group 3.1.1. Natura4Health.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Ethics Committee of the Medical University of Varna (Protocol No. 86/26 September 2019).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data will be available after reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Saklayen, M.G. The Global Epidemic of the Metabolic Syndrome. Curr. Hypertens. Rep. 2018, 20, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Mathieu, P.; Pibarot, P.; Després, J.P. Metabolic syndrome: The danger signal in atherosclerosis. Vasc. Health Risk Manag. 2006, 2, 285–302. [Google Scholar] [CrossRef] [Scilit]
  3. Tziomalos, K.; Athyros, V.G.; Karagiannis, A.; Mikhailidis, D.P. Endothelial dysfunction in metabolic syndrome: Prevalence, pathogenesis and management. Nutr. Metab. Cardiovasc. Dis. 2010, 20, 140–146. [Google Scholar] [CrossRef] [Scilit]
  4. Zhang, J. Biomarkers of endothelial activation and dysfunction in cardiovascular diseases. Rev. Cardiovasc. Med. 2022, 23, 73. [Google Scholar] [CrossRef] [Scilit]
  5. Böger, R.H. Association of asymmetric dimethylarginine and endothelial dysfunction. Clin. Chem. Lab. Med. 2003, 41, 1467–1472. [Google Scholar] [CrossRef] [Scilit]
  6. Bouras, G.; Deftereos, S.; Tousoulis, D.; Giannopoulos, G.; Chatzis, G.; Tsounis, D.; WCleman, M.; Stefanadis, C. Asymmetric Dimethylarginine (ADMA): A promising biomarker for cardiovascular disease? Curr. Top. Med. Chem. 2013, 13, 180–200. [Google Scholar] [CrossRef] [Scilit]
  7. Scuteri, A.; Najjar, S.S.; Muller, D.C.; Andres, R.; Hougaku, H.; Metter, E.J.; Lakatta, E.G. Metabolic syndrome amplifies the age-associated increases in vascular thickness and stiffness. J. Am. Coll. Cardiol. 2004, 43, 1388–1395. [Google Scholar] [CrossRef] [Scilit]
  8. Jung, J.M.; Young Kwon, D.; Han, C.; Park, M.H. Metabolic syndrome and early carotid atherosclerosis in the elderly. J. Atheroscler. Thromb. 2014, 21, 435–444. [Google Scholar] [CrossRef] [Scilit]
  9. Kawada, T.; Andou, T.; Fukumitsu, M. Metabolic syndrome showed significant relationship with carotid atherosclerosis. Heart Vessels 2016, 31, 664–670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Mangoni, A.A.; Tommasi, S.; Sotgia, S.; Zinellu, A.; Paliogiannis, P.; Piga, M.; Cauli, A.; Pintus, G.; Carru, C.; Erre, G.L. Asymmetric Dimethylarginine: A Key Player in the Pathophysiology of Endothelial Dysfunction, Vascular Inflammation and Atherosclerosis in Rheumatoid Arthritis? Curr. Pharm. Des. 2021, 27, 2131–2140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Ungvari, Z.; Bailey-Downs, L.; Gautam, T.; Jimenez, R.; Losonczy, G.; Zhang, C.; Ballabh, P.; Recchia, F.A.; Wilkerson, D.C.; Sonntag, W.E.; et al. Adaptive induction of NF-E2-related factor-2-driven antioxidant genes in endothelial cells in response to hyperglycemia. Am. J. Physiol. Heart Circ. Physiol. 2011, 300, H1133–H1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Chen, B.; Lu, Y.; Chen, Y.; Cheng, J. The role of Nrf2 in oxidative stress-induced endothelial injuries. J. Endocrinol. 2015, 225, R83–R99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Abraham, N.G.; Kappas, A. Heme oxygenase and the cardiovascular-renal system. Free Radic. Biol. Med. 2005, 139, 1–25. [Google Scholar] [CrossRef] [Scilit]
  14. Abraham, N.G.; Kappas, A. Pharmacological and clinical aspects of heme oxygenase. Pharmacol. Rev. 2008, 60, 79–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Kim, Y.-M.; Pae, H.-O.; Park, J.E.; Lee, Y.C.; Woo, J.M.; Kim, N.-H.; Choi, Y.K.; Lee, B.-S.; Kim, S.R.; Gong, Y.-Y.; et al. Heme oxygenase in the regulation of vascular biology: From molecular mechanisms to therapeutic opportunities. Antioxid. Redox Signal 2011, 14, 137–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Kushida, T.; Li Volti, G.; Quan, S.; Goodman, A.; Abraham, N.G. Role of human heme oxygenase-1 in attenuating TNF-alphamediated inflammation injury in endothelial cells. J. Cell Biochem. 2002, 87, 377–385. [Google Scholar] [CrossRef] [Scilit]
  17. Idriss, N.K.; Lip, G.Y.; Balakrishnan, B.; Jaumdally, R.; Boos, C.J.; Blann, A.D. Plasma haemoxygenase-1 in coronary artery disease. A comparison with angiogenin, matrix metalloproteinase-9, tissue inhibitor of metalloproteinase-1 and vascular endothelial growth factor. Thromb. Haemost. 2010, 104, 1029–1037. [Google Scholar] [CrossRef] [Scilit]
  18. Kishimoto, Y.; Kondo, K.; Momiyama, Y. The Protective Role of Heme Oxygenase-1 in Atherosclerotic Diseases. Int. J. Mol. Sci. 2019, 20, 3628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. .Zhang, Q.; Liu, J.; Duan, H.; Li, R.; Peng, W.; Wu, C. Activation of Nrf2/HO-1 signaling: An important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J. Adv. Res. 2021, 34, 43–63. [Google Scholar] [CrossRef] [Scilit]
  20. Pezzano, A.; La Carrubba, S.; Gullace, G. Carotid intima-media thickness. J. Cardiovasc. Med. 2006, 7, 555–559. [Google Scholar] [CrossRef] [Scilit]
  21. Nezu, T.; Hosomi, N.; Aoki, S.; Matsumoto, M. Carotid Intima-Media Thickness for Atherosclerosis. J. Atheroscler. Thromb. 2016, 23, 18–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Luna-Ceron, E.; González-Gil, A.M.; Elizondo-Montemayor, L. Current Insights on the Role of Irisin in Endothelial Dysfunction. Curr. Vasc. Pharmacol. 2022, 20, 205–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Robertson, C.M.; Gerry, F.; Fowkes, R.; Price, J.F. Carotid intima-media thickness and the prediction of vascular events. Vasc. Med. 2012, 17, 239–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Executive Summary of the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III). JAMA 2001, 285, 2486–2497. [CrossRef] [Scilit] [PubMed]
  25. Porter, N.A.; Nixon, J.R.; Isaac, R. Cyclic peroxidase and thiobarbituric assay. Biochem. Biophys. Acta 1976, 441, 506–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Novo, S.; Visconti, C.L.; Amoroso, G.R.; Corrado, E.; Fazio, G.; Muratori, I.; Tantillo, R.; Lunetta, M.; D’Angelo, L.; Novo, G. Asymptomatic carotid lesions add to cardiovascular risk prediction. Eur. J. Cardiovasc. Prev. Rehabil. 2010, 17, 514–518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Kotsis, V.T.; Stabouli, S.V.; Papamichael, C.M.; Zakopoulos, N.A. Impact of obesity in intima media thickness of carotid arteries. Obesity 2006, 14, 1708–1715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Dawson, J.D.; Sonka, M.; Blecha, M.B.; Lin, W.; Davis, P.H. Risk factors associated with aortic and carotid intima-media thickness in adolescents and young adults: The Muscatine Offspring Study. J. Am. Coll. Cardiol. 2009, 53, 2273–2279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Rubio-Guerra, A.F.; Vargas-Robles, H.; Serrano, A.M.; Vargas-Ayala, G.; Rodriguez-Lopez, L.; Escalante-Acosta, B.A. Correlation between the levels of circulating adhesion molecules and atherosclerosis in hypertensive type-2 diabetic patients. Clin. Exp. Hypertens. 2010, 32, 308–310. [Google Scholar] [CrossRef] [Scilit]
  30. Koç, A.S.; Sümbül, H.E. Age should be considered in cut-off values for increased carotid intima-media thickness. Turk. Kardiyol. Dern. Ars. 2019, 47, 301–311. [Google Scholar]
  31. Jia, G.; Aroor, A.R.; Jia, C.; Sowers, J.R. Endothelial cell senescence in aging-related vascular dysfunction. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 1802–1809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Lee, J.M.; Li, J.; Johnson, D.A.; Stein, T.D.; Kraft, A.D.; Calkins, M.J.; Jakel, R.J.; Johnson, J.A. Nrf2, a multi-organ protector? FASEB J. 2005, 19, 1061–1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Motohashi, H.; Yamamoto, M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef] [Scilit]
  34. Ferrándiz, M.L.; Devesa, I. Inducers of heme oxygenase-1. Curr. Pharm. Des. 2008, 14, 473–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. He, M.; Nitti, M.; Piras, S.; Furfaro, A.L.; Traverso, N.; Pronzato, M.A.; Mann, G.E. Heme oxygenase-1-derived bilirubin protects endothelial cells against high glucose-induced damage. Free Radic. Biol. Med. 2015, 89, 91–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Said, M.A. Vitamin D attenuates endothelial dysfunction in streptozotocin induced diabetic rats by reducing oxidative stress. Arch. Physiol. Biochem. 2022, 128, 959–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Zoccali, C.; Benedetto, F.A.; Maas, R.; Mallamaci, F.; Tripepi, G.; Salvatore Malatino, L.; Böger, R. Asymmetric dimethylarginine, C-reactive protein, and carotid intima-media thickness in end-stage renal disease. J. Am. Soc. Nephrol. 2002, 13, 490–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Peterson, S.J.; Rubinstein, R.; Faroqui, M.; Raza, A.; Boumaza, I.; Zhang, Y.; Stec, D.; Abraham, N.G. Positive Effects of Heme Oxygenase Upregulation on Adiposity and Vascular Dysfunction: Gene Targeting vs. Pharmacologic Therapy. Int. J. Mol. Sci. 2019, 20, 2514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Pae, H.O.; Son, Y.; Kim, N.H.; Jeong, H.J.; Chang, K.C.; Chung, H.T. Role of heme oxygenase in preserving vascular bioactive NO. Nitric Oxide 2010, 23, 251–257. [Google Scholar] [CrossRef] [Scilit]
  40. Wu, S.S.; Kor, C.T.; Chen, T.Y.; Liu, K.H.; Shih, K.L.; Su, W.W.; Wu, H.M. Relationships between Serum Uric Acid, Malondialdehyde Levels, and Carotid Intima-Media Thickness in the Patients with Metabolic Syndrome. Oxid. Med. Cell Longev. 2019, 2019, 6859757. [Google Scholar] [CrossRef] [Scilit]
  41. Lundman, P.; Eriksson, M.J.; Stühlinger, M.; Cooke, J.P.; Hamsten, A.; Tornvall, P. Mild-to-moderate hypertriglyceridemia in young men is associated with endothelial dysfunction and increased plasma concentrations of asymmetric dimethylarginine. J. Am. Coll. Cardiol. 2001, 38, 111–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Furuki, K.; Adachi, H.; Enomoto, M.; Otsuka, M.; Fukami, A.; Kumagae, S.; Matsuoka, H.; Nanjo, Y.; Kakuma, T.; Imaizumi, T. Plasma level of asymmetric dimethylarginine (ADMA) as a predictor of carotid intima-media thickness progression: Six-year prospective study using carotid ultrasonography. Hypertens. Res. 2008, 31, 1185–1189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Nair, N.; Gongora, E. Oxidative Stress and Cardiovascular Aging: Interaction Between NRF-2 and ADMA. Curr. Cardiol. Rev. 2017, 13, 183–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Poredos, P.; Kek Ljubec, A.; Poredos, P.; Visnovic Poredos, A. Endothelial dysfunction predictor of structural changes of arterial wall in type I diabetes. Int. Angiol. 2006, 25, 280–286. [Google Scholar]
  45. Aydin, M.; Bulur, S.; Alemdar, R.; Yalçin, S.; Türker, Y.; Basar, C.; Aslantas, Y.; Yazgan, Ö.; Albayrak, S.; Özhan, H.; et al. The impact of metabolic syndrome on carotid intima media thickness. Eur. Rev. Med. Pharmacol. Sci. 2013, 17, 2295–2301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Average CIMT according to the age of the MetS patient. Data are presented as mean ± SEM. Control group: CIMT < 0.9 mm, age < 55. The MetS group was divided into two subgroups: MetS with age < 55 and MetS with age ≥ 55. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 1. Average CIMT according to the age of the MetS patient. Data are presented as mean ± SEM. Control group: CIMT < 0.9 mm, age < 55. The MetS group was divided into two subgroups: MetS with age < 55 and MetS with age ≥ 55. * p < 0.05, ** p < 0.01, *** p < 0.001.
Applsci 14 07218 g001
Figure 2. Relative expression levels of NF-kB, NRf2, and HO-1 in PBMC, depending on age in MetS. Control group: age < 55. The MetS group was divided into two subgroups: MetS with age < 55 and MetS with age ≥ 55. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 2. Relative expression levels of NF-kB, NRf2, and HO-1 in PBMC, depending on age in MetS. Control group: age < 55. The MetS group was divided into two subgroups: MetS with age < 55 and MetS with age ≥ 55. * p < 0.05, ** p < 0.01, *** p < 0.001.
Applsci 14 07218 g002
Figure 3. Relative expression levels of NF-kB, NRf2, and HO-1 in PBMC, depending on CIMT. Control group: IMT < 0.90 mm. The MetS group was divided into two subgroups: MetS with CIMT < 0.90 mm and MetS with CIMT ≥ 0.90 mm. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 3. Relative expression levels of NF-kB, NRf2, and HO-1 in PBMC, depending on CIMT. Control group: IMT < 0.90 mm. The MetS group was divided into two subgroups: MetS with CIMT < 0.90 mm and MetS with CIMT ≥ 0.90 mm. * p < 0.05, ** p < 0.01, *** p < 0.001.
Applsci 14 07218 g003
Figure 4. Plasma levels of MDA, ADMA, and HO-1 in study subjects based on age. Control group: age < 55. The MetS group was divided into two subgroups: MetS with age < 55 and MetS with age ≥ 55. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4. Plasma levels of MDA, ADMA, and HO-1 in study subjects based on age. Control group: age < 55. The MetS group was divided into two subgroups: MetS with age < 55 and MetS with age ≥ 55. * p < 0.05, ** p < 0.01, *** p < 0.001.
Applsci 14 07218 g004
Figure 5. Plasma levels of MDA, ADMA, and HO-1 in study subjects based on CIMT. Control group: CIMT < 0.90 mm. The MetS group was divided into two subgroups: MetS with CIMT < 0.90 mm and MetS with CIMT ≥ 0.90 mm. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 5. Plasma levels of MDA, ADMA, and HO-1 in study subjects based on CIMT. Control group: CIMT < 0.90 mm. The MetS group was divided into two subgroups: MetS with CIMT < 0.90 mm and MetS with CIMT ≥ 0.90 mm. * p < 0.05, ** p < 0.01, *** p < 0.001.
Applsci 14 07218 g005
Table 1. Baseline characteristics of the participants in the study.
Table 1. Baseline characteristics of the participants in the study.
GroupsControl
N = 30
MetS
N = 44
p Valuep Value Adjusted by Age
Age40 ± 1.1144 ± 1.270.001
BMI kg/m22.99 ± 0.5129.13 ± 0.690.00010.001
WC74.60 ± 2.5393.00 ± 1.30.00010.001
SBP mmHg123.00 ± 3.01144.00 ± 1.070.00010.001
DBP mmHg79.50 ± 1.8990.10 ± 0.990.00010.001
TG mmol/L0.70 ± 0.071.72 ± 0.120.00010.001
HDL mmol/L2.28 ± 0.271.38 ± 0.070.00010.001
Data expressed as mean SEM. MetS indicates metabolic syndrome; BMI—body mass index; WC—waist circumference; SBP—systolic blood pressure; DBP—diastolic blood pressure; HDL—high-density lipoprotein; TG—triglycerides.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bekyarova, G.Y.; Bekyarov, N.A.; Madjova, V.H.; Madjova, C.R.; Kalevska, E.D.; Salim, A.S.; Vankova, D.G.; Ivanova, D.G.; Kiselova-Kaneva, Y.D. Age-Associated Changes in Carotid Intima–Media Thickness in Relation to Redox Balance Indices in Metabolic Syndrome. Appl. Sci. 2024, 14, 7218. https://doi.org/10.3390/app14167218

AMA Style

Bekyarova GY, Bekyarov NA, Madjova VH, Madjova CR, Kalevska ED, Salim AS, Vankova DG, Ivanova DG, Kiselova-Kaneva YD. Age-Associated Changes in Carotid Intima–Media Thickness in Relation to Redox Balance Indices in Metabolic Syndrome. Applied Sciences. 2024; 14(16):7218. https://doi.org/10.3390/app14167218

Chicago/Turabian Style

Bekyarova, Ganka Y., Nicolai A. Bekyarov, Valentina H. Madjova, Christiana R. Madjova, Evgenia D. Kalevska, Ayshe S. Salim, Deyana G. Vankova, Diana G. Ivanova, and Yoana D. Kiselova-Kaneva. 2024. "Age-Associated Changes in Carotid Intima–Media Thickness in Relation to Redox Balance Indices in Metabolic Syndrome" Applied Sciences 14, no. 16: 7218. https://doi.org/10.3390/app14167218

APA Style

Bekyarova, G. Y., Bekyarov, N. A., Madjova, V. H., Madjova, C. R., Kalevska, E. D., Salim, A. S., Vankova, D. G., Ivanova, D. G., & Kiselova-Kaneva, Y. D. (2024). Age-Associated Changes in Carotid Intima–Media Thickness in Relation to Redox Balance Indices in Metabolic Syndrome. Applied Sciences, 14(16), 7218. https://doi.org/10.3390/app14167218

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop