Next Article in Journal
Multi-Scale CNN-Transformer Dual Network for Hyperspectral Compressive Snapshot Reconstruction
Previous Article in Journal
Distinctive Biological Properties between Mesenchymal Stem Cell Spheroids and Clumps of Mesenchymal Stem Cells/Extracellular Matrix Complexes in 3D Culture Systems
Previous Article in Special Issue
Are Toxic Substances Always Toxic? Case Studies of Different Organismal Responses Based on Brackish-Water Microphytobenthic Communities from the Baltic Sea
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Application of 4 × 44 Oligo Microarray to Transcriptomic Analysis of Immune Response in Rainbow Trout Infected with Aeromonas salmonicida

1
Institute of Oceanology Polish Academy of Sciences, Powstanców Warszawy 55, 81-712 Sopot, Poland
2
Department of Microbiology and Clinical Immunology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Oczapowskiego 13, 10-719 Olsztyn, Poland
3
Department of Salmonid Research, Inland Fisheries Institute, Rutki, 83-300 Żukowo, Poland
*
Author to whom correspondence should be addressed.
Appl. Sci. 2023, 13(23), 12793; https://doi.org/10.3390/app132312793
Submission received: 13 September 2023 / Revised: 25 November 2023 / Accepted: 27 November 2023 / Published: 29 November 2023
(This article belongs to the Special Issue Recent Developments and Emerging Trends in Marine Biotechnology)

Abstract

Rainbow trout, one of the most economically important aquaculture fish species worldwide, is affected by the pathogenic bacteria A. salmonicida, which causes furunculosis outbreaks, leading to huge economic losses. In this study, an oligonucleotide microarray was applied to identify transcriptional changes in the skin of rainbow trout individuals in response to a bacterial infection. Overall, 656 and 434 differentially expressed genes (DEGs) were identified at 2 and 6 days after a bacterial challenge (dpi), respectively. A comparison of moribund (2 dpi) and survivor fish (6 dpi) revealed 169 DEGs. Between these were many genes involved in immune response, including lysozymes, pattern recognition receptors (c-type lectins), antimicrobial peptides (cathelicidin and hepcidin), acute-phase proteins (serum amyloids and haptoglobin), complement cascade proteins (c3, c4, c6 and c7), interleukins (il11 and il1b) and chemokines (ccl19 and cxcl8). Alterations of leptin, eicosanoids and prostaglandins have been found, which suggest metabolic remodeling in conjunction with immune response. Further, the regulation of programmed cell death genes (caspase 8, bcl2 apoptosis regulator, nfkb inhibitor alpha and heme oxygenase) and structural proteins (collagens, myosins, keratins and metalloproteinases) was observed. This study provides, for the first time, a gene expression analysis of rainbow trout skin in response to A. salmonicida infection, revealing the complexity of defense strategies in response to furunculosis.

1. Introduction

Farmed fish such as rainbow trout (Oncorhynchus mykiss), which is one of the major aquaculture species, with global production reaching about 952 thousand tons of live weight in 2021 [1], must cope with multiple stressors (hypoxia, temperature and crowding) in an intensive aquaculture environment. Exposure to a stressful environment enhances the spread of pathogenic bacteria and causes disease outbreaks [2]. Infectious diseases caused by bacterial pathogens lead to the high mortality of fish in aquaculture populations and significant economic losses. One of the bacteria that affect salmonids, including rainbow trout, is a Gram-negative, non-motile and facultative anaerobic bacteria called Aeromonas salmonicida spp. salmonicida (A. salmonicida). The histopathology of A. salmonicida-infected rainbow trout includes inflammatory lesions in the dermis, kidney and liver, vascular congestion and the cytoplasmic vacuolization of hepatocytes [3]. The major virulence factor of A. salmonicida is a type three secretion system (TTSS). A TTSS functions by moving bacterial effector proteins to the cytosol of the host, affecting the immune system [4]. After host penetration, bacterial effector molecules are able to modulate and disrupt the cytoskeleton and cell-signaling cascades and may induce apoptosis [5]. Besides salmonids, this bacterium can also infect other fish species such as cod (Gadus morhua) [6], common carp (Cyprinus carpio) [7], seabream (Sparus aurata) [8], sea bass (Dicentrarchus labrax) [9], senegalese sole (Solea senegalensis) [10], halibut (Hippoglosus hippoglosus) [11], sea lamprey (Petromyzon marinus) [12] and turbot (Scophthalmus maximus) [13]. Infection by A. salmonicida causes furunculosis. The disease begins with epithelial hyperplasia, followed by furuncles, lesions and hemorrhages of the skin and muscles and darkening of the skin, and it finally leads to septicemia and fish death [14,15]. Furunculosis is transmitted via water and through direct contact between infected and healthy fish, and one of the signs of infection may be lethargic swimming and a loss of appetite [16]. Since the disease spread depends on temperature (the optimum is from 12.8 to 21.1 °C), it is expected that climate changes manifested by rising water temperatures may increase the susceptibility to the disease in aquaculture and wild fish populations [17,18].
Aquaculture global production reached over 126 million tons in live weight in 2021 [1], and according to the Food and Agriculture Organization (FAO) of the United Nations report from 2022, it will rise in the future [19]. Because aquaculture is currently the fastest growing food sector in the world, the development of effective treatments against pathogens such as A. salmonicida is very important. Despite best efforts to control furunculosis, it still poses a serious threat to salmonids, and outbreaks are common [18]; thus, new antibacterial treatments need to be found.
Previously, the response to A. salmonicida has been studied in rainbow trout through a gene expression analysis in different tissues such as the gills [20,21], head kidney [22], liver [21,23] and spleen [21,24], but not in the skin. The transcriptome response to A. salmonicida infection has also been investigated in other fish species, such as Atlantic salmon (Salmo salar) [25,26], cod [27], turbot [28] and lumpfish (Cyclopterus lumpus) [29]. More information is required since fish have shown divergent susceptibility to bacterial infection, and even closely related species such as Atlantic salmon, brook trout (Salvelinus fontinalis) and rainbow trout showed intra-specific resistance to pathogens [30,31,32]. This study applied a 4 × 44 oligonucleotide microarray to investigate the response of rainbow trout to an infection with a pathogen strain of A. salmonicida. Gene expression changes were studied in the fish skin, which is a barrier to infection. Despite many studies on the rainbow trout response to A. salmonicida, gene expression in the skin and adhering tissues including the skeletal muscles has not been analyzed.

2. Materials and Methods

2.1. Ethics Statement and Experiment Description

Experimental procedures were performed in accordance with the three Rs for the humane use of animals in scientific research and were approved by the Local Ethics Committee on Animal Experimentation of the Inland Fisheries Institute of Olsztyn, Poland (Nr 20/2011). Rainbow trout were obtained from the Department of Salmonid Fish Research, Inland Fishery Institute, Rutki, Poland. Fish were 1 year old, with an average length of 155 mm and an average weight of 50 g. The conditions of fish were inspected prior to experiment, including checking for the presence of pathogens. Polymerase chain reaction (PCR) did not reveal the presence of the following viruses: viral hemorrhagic septicemia (VHS) [33], infectious haematopoietic and pancreatic necrosis (IHN and IPN) [33,34,35] and salmonid herpesviruses [36]. Biological methods (API 20E test and growth medium) did not reveal the presence of A. salmonicida. All fish were in good condition, and no changes indicative of ongoing disease process were observed in the fish prior to the experiment. Fish were kept in plexiglass tanks with fresh water and temperature of about 15 °C, and they were fed twice daily with commercial pellets [37]. The infection experiment was carried out in the Department of Fish Pathology and Immunology, Inland Fisheries Institute (Żabieniec, Poland), according to their developed procedure, as follows [37]: Pathogenic bacteria, A. salmonicida spp. salmonicida, after growing on a solid support and washing, were cultured. The fish were infected via intraperitoneal injection [38,39] around the left pectoral fin with A. salmonicida bacteria diluted in phosphate-buffered saline (PBS) to a concentration of 1 × 107 colony-forming unit (CFU) mL−1, 0.2 mL per fish [37]. Of the infected fish, four (RT1, RT2, RT3 and RT4) were sampled up to 2 days post infection (2 dpi), and these fish were moribund. Three other fish (RT5, RT6 and RT7) were collected 6 days post infection (6 dpi), and these fish were survivors. Further, three healthy, uninfected fish (control) were kept in a separate tank in the same conditions as described above. Control fish were injected with sterile PBS [37] (Siwicki A., personal communication) and sampled after six days of experiment. Propiscin was used to anaesthetize the studied fish [40].

2.2. Immunoassay Analysis

Blood from all fish used in this study was sampled for immunoassay analysis and centrifuged for 10 min at 4 °C with 8500 revolutions per minute (rpm) [41]. Immunological tests included determining the following parameters of non-specific humoral immunity: lysozyme and ceruloplasmin activity in the plasma and the levels of gamma globulin in the serum. Lysozyme activity was measured with the turbidimetric method using a Micrococcus lysodeicticus suspension in a sodium phosphate buffer and the standard egg white lysozyme (both Sigma-Aldrich, Saint Louis, MO, USA) according to Siwicki and Anderson [42]. Ceruloplasmin activity was measured with the spectrophotometry method in an enzyme reaction mixture containing 0.2% p-phenylenediamine (PPD) in acetate buffer and 0.02% sodium azide solution according to Siwicki and Anderson [42]. The optical density was read at 540 nm. Gamma globulin was measured using modification of the Lowry micro-method, presented by Siwicki and Anderson [42], depending on the precipitation of the total immunoglobulin with polyethylene glycol (10,000 kDa; Sigma-Aldrich, Saint Louis, MO, USA) and centrifugation to separate bound immunoglobulin fraction from the supernatant.

2.3. RNA Extraction

Samples of skin with adhering skeletal muscles (1 cm × 0.2 cm) from the area of the anus, where the ulcers showed up, were collected with the aid of a scalpel and washed in sterile diethyl pyrocarbonate (DEPC) water. Total RNA was extracted using the GenEluteTM Mammalian Total RNA Miniprep Kit (Sigma-Aldrich, Saint Louis, MO, USA). The isolated RNA samples were diluted to 5 ng/µL in DEPC water and stored at −70°C. Concentration of isolated RNA was determined by measuring absorbance at 260 nm using the Epoch Microplate Spectrophotometer (BioTek Instruments, Inc., Winooski, VT, USA) [15]. Integrity of RNA was checked by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and RNA Integrity Number (RIN) > 7.5 was accepted.

2.4. Microarray Analysis

Two-color microarray analysis was performed with uninfected (n = 3) and infected fish (n = 7), labeled with Cy3 and Cy5 dyes, respectively, using the Two-Color Low Input Quick Amp Labeling kit (Agilent, Santa Clara, CA, USA). The hybridization was performed in the Department of Physiological Sciences, Warsaw University of Life Sciences (SGGW) with the Agilent-028639 RTIQ custom-commercial 4 × 44 K oligo microarray (GEO accession no. GPL16819; Agilent, Santa Clara, CA, USA) using Gene Expression Hybridization Kit (Agilent, Santa Clara, CA, USA) according to the manufacturer’s protocol. This microarray consisted of 43,509 salmonid and 60 mer oligonucleotides, and its preparation was in accordance with a previously developed protocol [43]. The hybridized arrays were washed using the Agilent Gene Expression Wash Buffer Kit and scanned in an Agilent Technologies Scanner G2505C according to the manufacturer’s protocol (GE2_1010_Sep10). The scanned microarray images were analyzed using the Agilent Feature Extraction software (version 10.10.1.1) [44]. The raw mean signal was background-corrected using the BackgroundCorrect function (normexp method) and next normalized within and between microarrays (lowess and quantile normalization, respectively) in the limma package in R [44,45]. All differentially expressed genes (DEGs) were identified using limma (fit linear model) and confirmed with the RankProd package (fold-change (FC) ≥ 2 and p-value < 0.05) [45,46].

2.5. Functional Annotation

DEGs were searched against proteins from the NCBI non-redundant (nr) database using the Basic Local Alignment Search Tool (BLASTX) implemented in BLAST+ (v.2.2.29) [47], with an E-value threshold of 10−5, using sequences from which probes were designed. For functional annotation, gene ontology (GO) terms were assigned to the DEGs using Blast2GO software (version 6.0.3) [48] with the same E-value. Further, gene symbols were assigned to each DEG using the Zebrafish Information Network (ZFIN) and the HUGO Gene Nomenclature Committee (HGNC) databases. GO and pathway enrichment analyses were performed using Kyoto Encyclopedia of Genes and Genomes (KEGG) Orthology-Based Annotation System (KOBAS v.3.0) for the human data (corrected p-value < 0.05) [49].

2.6. RT-qPCR Validation

To verify the microarray results, 10 DEGs were screened via RT-qPCR (Table 1). The primers were designed using Primer3 software, version 0.4.0 [50], and eukaryotic translation elongation factor 1 alpha (eef1a) was used as a reference gene. Sequences of the primers were analyzed for hairpin structure and self- and hetero-dimers in Vector NTI Express software (v1.1.1). Same biological RNA samples were used for RT-qPCR analysis, including uninfected fish (n = 3), moribund (n = 4) and survivors (n = 3). Annealing temperature was optimized for each primer pair. PCR reactions were performed using SensiFASTTM SYBR No-ROX One-Step Kit (Bioline, Memphis, TN, USA). The PCR Master Mix included 400 nM concentration of forward and reverse primers and 10 ng per reaction of RNA sample. Reactions were performed in Eco Real-Time PCR System (Illumina, Inc., San Diego, CA, USA). The standard cycling conditions were as follows: reverse transcription at 45 °C for 10 min and 95 °C for 2 min for polymerase activation, followed by 45 cycles of denaturation, annealing and extension. Melting curve analysis was conducted to confirm that primers did not form primer dimers and non-specific amplification product did not appear. Gene levels were calculated using the 2−ΔΔCt method [51].

2.7. Data Availability

The microarray data were deposited in the National Center for Biotechnology Information’s Gene Expression Omnibus (NCBI GEO) under the accession number GEO: GSE230658.

3. Results

3.1. Bacteriological and Immunoassay Analysis

A bacteriological analysis confirmed the presence of the A. salmonicida pathogenic strain in the fish after the intraperitoneal injection. An analysis of the blood of the infected fish in comparison with the control revealed that the ceruloplasmin (Cp) activity decreased after the infection (p-value < 0.05) in both the moribund and survivor groups, and there was no statistically significant difference between 2 dpi and 6 dpi (Figure 1a). The level of gamma globulin (Ig) decreased after 2 days of infection (p-value < 0.05) and then increased in the survivor fish (6 dpi) to the control level (Figure 1b). On the other hand, the lysozyme activity increased within 2 days post infection (p-value < 0.05) and then decreased to the control level after 6 days (Figure 1c).

3.2. Microarray Analysis

The Pearson correlation of all genes showed that the gene expression profile was similar through all of the rainbow trout specimens used in the experiment (average R = 0.71, p-value < 0.05; Figure 2).
In this study, the limma and RankProd packages in R were used to identify the DEGs among the samples (FC > 2, p-value < 0.05; Supplementary Table S1). In total, 656 and 434 genes showed statistically different expressions after 2 and 6 days of infection, respectively (Figure 3a,b). Of these, 382 and 221 were up-regulated, and 274 and 213 were down-regulated at 2 dpi and 6 dpi, respectively (Figure 3a,b). On average, 98.05% of the DEGs were annotated using NCBI nr databases (excluding uncharacterized, unnamed and hypothetical proteins), and gene symbols using Zfin and HGNC databases were assigned to 92.58% of them. Further, using Blast2GO software (version 6.0.3), gene ontology (GO) terms were assigned to 76,58% of the annotated DEGs and they were classified into three main categories: biological processes, molecular function and cellular component (Supplementary Table S1). In the moribund group, the highly expressed genes belonged to the cytokine–cytokine receptor interaction pathway, such as cd209, the c-type lectin domain family 4 member e (clec4e), interleukin 11 (il11) and potassium channel tetramerization domain-containing 12 gene (kctd12), which is involved in ion transport. In the fish that survived, the highly expressed genes were related to lipid metabolism, such as mid1 interacting protein 1 (mid1ip1) and matrix metallopeptidase 13 (mmp13), which is involved in collagen degradation. In both groups, a gene encoding calcium-binding protein and coiled-coil domain 1 (calcoco1) were highly increased (Figure 3a,b). On the other hand, in the 2 dpi group, the down-regulated genes were the immune-related c-c motif chemokine ligand 13 (ccl13), liver enriched antimicrobial peptide 2 (leap2) and c1q and tnf-related 3 (ctrp3). In the 6 dpi group, the genes with the lowest expressions were s100 calcium-binding protein p (s100p), cathepsin (ctsl1) and MHC class I heavy chain. In both groups, the heavily reduced genes were heat shock protein 90 alpha family class a member 1 (hsp90aa1) and inositol 1,4,5-trisphosphate receptor type 2 (itpr2), which is involved in cell cycle and calcium transport (Figure 3a,b).
A comparison between the moribund (2 dpi) and survivor groups (6 dpi) using a Venn diagram revealed that only 24.71% and 22.06% of the gene symbols and probe names were shared between the groups (Figure 4a,b).
Moreover, the Wilcoxon rank sum test using the absolute value of the log2FC revealed that the median expression was significantly different between the studied groups, and it was greater in the moribund fish compared to the survivor fish (p-value < 2.2 × 10−16).
Based on gene symbols, a pathway and GO enrichment analysis was performed (Figure 5a,b; Supplementary Figures S1 and S2; p-value < 0.001). A comparison between the identification numbers (IDs) revealed that 27.93% of the up-regulated pathways and 32.83% of the down-regulated pathways were shared between the moribund and survivor groups. The obtained results revealed that an infection with A. salmonicida increased the immune system response (c-type lectin receptor signaling pathway, cytokine–cytokine receptor interaction, il-17 signaling pathway and neutrophil degranulation), apoptosis, autophagy and collagen degradation in both the moribund and survivor fish. Further, the cellular senescence, chemokine signaling pathway, complement and coagulation cascades, ferroptosis, fc gamma r-mediated phagocytosis and the foxo signaling pathway were uniquely enriched at 2 dpi. After 6 days post infection, the fatty acid metabolism, DNA repair, programmed cell death, MHC class II antigen presentation, intrinsic pathway for apoptosis and the citric acid (TCA) cycle and respiratory electron transport were enriched. The pathways involved in collagen degradation and formation, glycolysis/gluconeogenesis, extracellular matrix organization and protein digestion and absorption were decreased in both of the infected groups. Further, in the 2 dpi group, genes involved with the cell cycle, DNA replication and ECM receptor interaction were down-regulated, whereas apoptosis, vitamin digestion and absorption, glycine, serine and threonine metabolisms and ion channel transport were decreased in 6 dpi.
To identify the differentially expressed genes between groups, the limma package was used. An analysis revealed 169 DEGs, of which 76 increased over time and 93 decreased over time (Figure 6a, Supplementary Table S2). To present the relationship between the samples, hierarchical clustering was carried out using all of the identified genes (169 DEGs; Figure 6b). Genes such as cerebellin 1 (cbln1; FC = 19.26), complement c1q-like protein 2 (c1ql2; FC = 17.49), proteasome subunit beta type-7 (psmb7; FC = 17.22), c-type lectin domain family 4 member e (clec4e; FC = 17.21) and proteasome subunit beta type-8 (psmb8; FC = 8.42) significantly decreased over time. On the other hand, the expressions of c1q and tnf-related 3 (ctrp3; FC= 5.03), interferon-inducible protein gig2 (gig2p; FC = 4.92), myelin and lymphocyte protein-like (mal; FC = 4.52), cytochrome c (cyc; FC = 4.35) and keratin type I cytoskeletal 13 (krt13; FC = 3.63; Supplementary Table S2) increased over time.
The KEGG orthology (ko) and GO enrichment analysis revealed that the expression of genes involved in the inflammatory response, il-17 signaling pathway, c-type lectin receptor signaling, tnf signaling and NF-kappa B signaling pathway decreased over time, whereas genes involved in oxidative phosphorylation, fatty acid metabolism, the citric acid (TCA) cycle and respiratory electron transport and mineral absorption increased over time (Figure 7 and Supplementary Figure S3).

3.3. RT-qPCR Validation

Expression of ten selected genes related to immune response, apoptosis, extracellular matrix organization and metabolism, including serum amyloid A1 (saa1), cathelicidin antimicrobial peptide (camp), prostaglandin-endoperoxide synthase 2 (ptgs2), steap4 metalloreductase (steap4), mmp13, interleukin 17d (il17d), mx dynamin-like gtpase 1 (mx1), cathepsin L and B (ctsl and ctsb) and ccl13 were verified via RT-qPCR (Figure 8a). The expression trends of these genes were significantly correlated with the microarray results (R = 0.98 and R = 0.97; Figure 8b,c). These results confirmed the reliability of the microarray analysis.

4. Discussion

Farmed fish are commonly exposed to many pathogens in intensive systems. Bacterial diseases, such as furunculosis, are a major concern for aquaculture due to heavy economic losses [52]. Fish skin is a multifunctional organ that protects the organism from the environment and is the first barrier against infection. One of the first symptoms of furunculosis is the darkening of the skin and the emergence of ulcers, which lead to sepsis and fish death. Despite massive vaccination, this disease is still a threat for fish, which can worsen because temperature increases due to climate change will promote A. salmonicida infection [18]. In the present study, we applied a 4 × 44 oligonucleotide microarray to investigate the gene expression in the skin with adhering skeletal muscles of the rainbow trout subjected to A. salmonicida infection. Further, the gene expression results obtained using the microarray method were validated via a RT-qPCR analysis of the selected genes. The results of the mRNA quantification using these two methods were consistent.
Our studies showed that in both the moribund and survivor fish (2 and 6 dpi), a bacterial infection caused the down-regulation of several genes involved in the glycolysis/gluconeogenesis pathway, such as aldolase and fructose-bisphosphate (aldoc and aldob), bisphosphoglycerate mutase (bpgm), phosphofructokinase, muscle (pfkm) and phosphoglycerate kinase 1 (pgk1). In both groups, the expression of the leptin (lep) gene was raised, which is involved in the regulation of food intake and body fat and exerts powerful peripheral modulations on immune cells; thus, it may participate in the interaction between the immune response and metabolism [23,53]. Since a bacterial infection affects the glycolysis/gluconeogenesis, leptin changes the fuel source to fatty acids (lipid) [54], and this shift might protect them from sepsis [55]. Up-regulated phospholipase A2 (pla2g12a and pla2g4a) and 5-lipoxygenase activating protein (alox5ap) are involved in biosynthesis eicosanoids, which are lipid-derived mediators of inflammation. Other genes involved in eicosanoids metabolism and lipid peroxidation such as prostaglandin-endoperoxide synthase 2 (ptgs2), 15-hydroxyprostaglandin dehydrogenase (hpgd) and prostaglandin reductase 1 (ptgr1) were differentially expressed between the moribund and survivor fish. The expression of these genes was higher in the first 2 days post infection and decreased in time to the control level (p-value < 0.05). Previously, the role of ptgs2 has been studied in the immune response against Aeromonas hydrophila infection in common carp [56]. In summary, in accordance with previous studies in vertebrates [57,58], these results indicate metabolic reprogramming in conjunction with the immune response in rainbow trout infected by A. salmonicida. Lysozyme is an important mucosal antibacterial enzyme that lyses pathogens. In this study, two types of lysozymes (c-type and g-type) were overexpressed in the skin of rainbow trout after 2 days of infection and then decreased in the next days; however, only lysozyme c showed a statistically significant difference. Further, the lysozyme activity in the blood also increased at 2 dpi compared to the uninfected fish, and then it decreased at 6 dpi to the control level, which additionally confirms the activation of the innate humoral system up to 2 days post infection. Lysozyme was decreased in the head kidney of rainbow trout stimulated with A. salmonicida [23]. On the other hand, the up-regulation of lysozyme was detected in the skin tissue of crucian carp (Carassius auratus) in response to Aeromonas hydrophila [59]. Both up- and down-regulation of lysozyme was observed in the gill tissue of rainbow trout depending on the transcript variant [20]. Thus, the expression profile of lysozymes after an infection with A. salmonicida depends on the fish species, type of tissue and time after infection.
The first line of defense against pathogens constitute pattern recognition receptors (PRRs) that are innate immune sensors responding to conserved patterns of microorganisms [60]. In this study, several c-type lectin receptors (CLR) showed up-regulation after A. salmonicida infection, and some of them, such as c-type lectin 2-1, clec4m and cd209, showed similar magnitudes in both the moribund and survivor fish. A previous study of the immune defense of rainbow trout against A. salmonicida suggested that cd209 is an essential receptor that captures this bacteria [24]. Our results showed a high up-regulation of cd209 in rainbow trout skin, which is consistent with previous studies in the spleen and head kidney tissues (after 1 and 7 days post infection) [23,24]. The expression of the other CLR (clec4e) was significantly higher at 2 dpi compared to 6 dpi (FC = 17.22) and was the highest between all of the CLRs. C-type lectins recognize the carbohydrate patterns on pathogen surfaces, opsonize them or activate complement cascade and may induce signaling cascade, leading to the activation of NF-κB, and thus, inflammatory responses [61,62].
After an infection with A. salmonicida, antimicrobial peptides (AMPs) were activated, such as camp and hepcidin (hamp). Histone h1 and camp showed similar magnitudes of expression in the moribund and survivor fish, which is in agreement with the multi-tissue gene expression analysis after 3 and 13 days of A. salmonicida infection in rainbow trout [21]. Otherwise, the expression of hamp was higher at 2 dpi and then decreased after six days. The up-regulation of these AMPs was noticed in previous studies; however, in other tissues, Hamp was previously up-regulated in the liver of rainbow trout using an ELISA test [63], whereas histone h1 was detected in Atlantic salmon after Escherichia coli infection [64]. In summary, AMPs are pivotal parts of the first line of host defense against pathogens that disrupt pathogenic bacterial membranes and regulate the innate immune response [65].
The success of the immune response depends on the signaling, communication and migration of immune cells. Chemokines and cytokines such as interleukins are small glycoproteins that play crucial roles in inflammation, hematopoiesis and immune cell activation and they induce the migration of leukocytes from blood vessels to inflamed tissues [66,67]. In this study, most of the identified chemokines were differentially expressed only at 2 dpi, and thus included down-regulated ccl2, ccl21 and cxcl11 and up-regulated ccl19, ccl25, ccl28, cxcl8 and ccr1. However, only ccl19 showed a statistically significant difference between the groups. In accordance, the expressions of cxcl8 (il-8) and ccl19 were increased in rainbow trout gill tissue after A. salmonicida infection [20]. Previously, studies on the teleost revealed that ccl19 promotes anti-viral and anti-bacterial defense and inflammation [68]. Further, in this study, we noticed an up-regulation of genes encoding interleukins and their receptors including il1b, il6, il11, il17d, il21, il1r2 and il13ra2. Contrary to rainbow trout gills, the expression of il6 was up-regulated in the skin, and according to a previous study, it might be induced by lipopolysaccharides and promote phagocyte proliferation [69]. Further, the expressions of il1b and il11 significantly increased at 2 dpi (FC = 6.49 and FC = 8.14, respectively) and decreased after 6 dpi. IL1b is a key pro-inflammatory cytokine, which was also up-regulated at early stages of infection in the gill of rainbow trout [20] and Atlantic cod [27], as well as in the head kidney infected with A. salmonicida achromogenes [70]. IL11 belongs to the il6 cytokine family and plays a major role in hematopoiesis, and it may show pro- and anti-inflammatory responses in fish [70]. In contrast to other interleukins, il17d was repressed in moribund fish and then came back to the control level in the survivors. The decreased expression of il17d is similar to that of the early stage of bacterial infection in Siberia sturgeo [71]. In summary, these results suggest that the expression of chemokines and interleukins in response to bacterial invasion depends on the type of tissue and post infection time, which has also been suggested in black rockfish (Sebastes schlegelii) infected with A. salmonicida [72].
At an early stage of bacterial infection, the inflammation process is activated and the inflammatory cells (neutrophils and monocytes/macrophages) secrete cytokines such as il1b, il8, il6 and tumor necrosis factor (tnfα) into the bloodstream, stimulating the production of acute-phase proteins (APPs) [73]. The APPs are involved in many immune processes such as the inactivation of proteolytic enzymes, the control of the distribution of infectious agents (by eliminating pathogens or by modifying surface targets) and in the recovery of damaged tissues [74]. In this study, several genes encoding APPs, such as saa1, serum amyloid a5 (saa5), haptoglobin (hp), cbln1, lysozyme c and lysozyme g, were significantly elevated after an infection in fish skin. Of these genes, the expression levels of lysozyme c, hamp, c3, c4 and steap4 were higher at 2 dpi and decreased after 6 dpi to the control level, whereas the serum amyloids were highly expressed at both 2 and 6 dpi. SAAs play roles in inflammation, opsonization, cholesterol transport and the degradation of the extracellular matrix, and they might be useful in monitoring and evaluating health in fish [75]. Previous studies on rainbow trout gill, liver and spleen confirmed the up-regulation of hp at 3 dpi [20] and the up-regulation of saa1 at 3 and 13 dpi [21]. The RT-qPCR analysis from this study also confirmed the up-regulation of saa1 (Figure 8). Otherwise, the ceruloplasmin level in the plasma decreased in both the moribund and survivor fish, which is in accordance with studies on the Nile tilapia (Oreochromis niloticus) after an infection with A. hydrophila [73].
Previous studies suggested a correlation of complement cascade to acute phase and inflammatory response [29,76]. This study revealed that in rainbow trout skin at 2 days after infection, the complement and coagulation cascades pathway was activated. The complement components c3, c4, c6 and c7, the complement c1q-like protein 2 (c1ql2) and the complement c5a receptor 1 (c5ar1) were up-regulated in the moribund fish, which is in accordance with previous studies on rainbow trout [20,21,23]. Of these, only c7 was slightly up-regulated in the survivor fish. C4 plays an important role in classical and lectin pathways, c1ql2 is the initial protein of the classical complement pathway and c7 plays an integral role in the formation of the membrane attack complex (MAC) [77]. Further, c5ar1 was also raised at 2 dpi, which may promote the development of inflammation through chemotaxis and the degranulation of granulocytes and monocytes [78].
Cell death plays a fundamental role during the homeostasis of the host and the defense against pathogens [79]. Several types of programmed cell death (PCD) such as autophagy, apoptosis, ferroptosis, necroptosis and pyroptosis have been identified and classified in vertebrates [79]. In this study, apoptosis, autophagy and necroptosis processes were enriched in both the moribund and survivor fish. Of these, several genes showed similar expression patterns in both groups, such as bcl2 apoptosis regulator (bcl2), caspase 8 (casp8), ctsl1, gamma-aminobutyric acid receptor-associated protein-like 1 and 2 (gabarapl1), rb1 inducible coiled-coil 1 (rb1cc1) and calcoco1. Members of the Bcl2 family proteins such as antiapoptotic bcl2 suppress apoptosis, whereas casp8 is an extrinsic apoptosis initiator and necroptosis suppressor [80]. Other genes were significantly increased at 2 dpi and then decreased to the control level, such as nfkb inhibitor alpha (nfkbia), jun proto-oncogene ap-1 transcription factor subunit (jun), which is involved in apoptosis, and glutamine synthetase (glul), which is involved in necroptosis. Moreover, tnfα, which stimulates macrophage activity in fish [81] and activates both necroptosis and apoptosis, was also up-regulated after 2 dpi, and then its expression decreased. Previously, a strong expression of tnfα was noticed at 3 days post infection by A. salmonicida achromogenes in the head kidney of Artic charr (Salvelinus alpinus) [82]. Otherwise, the expressions of other genes involved in apoptosis such as cyc and dynein light chain lc8-type 1 (dynll1) were similar to the uninfected fish at 2 dpi and then raised at 6 dpi. Apoptosis and necroptosis are vital parts of the host immune defense mechanism, which cleans up damaged cells and plays a role in host–pathogen interactions [83]. Further, the ferroptosis process was enriched in moribund fish. Ferroptosis is a Reactive Oxygen Species (ROS)—a dependent form of inflammatory cell death associated with iron accumulation and lipid peroxidation—that induces an inflammatory immune response in macrophages [84]. Between the genes involved in the regulation of ferroptosis, solute carrier family 3 member 2 (slc3a2), spermidine/spermine n1-acetyltransferase 1 (sat1), microtubule-associated protein 1 light chain 3 beta (map1lc3b), ferritin heavy chain 1 (fth1), heme oxygenase 1 (hmox1), alox5ap, acyl-coa synthetase long chain family member 1 (acsl1), ptgs2 and nfe2 like bzip transcription factor 2 (nfe2le) were up-regulated at two days post infection in rainbow trout. In accordance with this, the raised expressions of ferritin and hmox1 and the induction of ferroptosis in response to E. coli infection were studied in grass carp (Ctenopharyngdon idella) [85]. Altogether, programmed cell death processes are critical to maintain homeostasis and plays a role in immune response.
The cytoskeleton and extracellular matrix (ECM) play essential roles in cell structure and function. A cytoskeleton is a cellular frame inside a cell, and it plays a role in cell motility and division. The ECM is a complex structural entity surrounding and supporting cells in tissues, and it plays a role in the regulation of intercellular communication, apoptosis, angiogenesis and cell differentiation [86]. Many proteins of the cytoskeleton and ECM interact with each other, and they were mostly decreased in both the moribund and survivor fish. Of these, collagens (col1a1, col1a2, col1a3, col2a1, col5a1, col5a2, col6a1, col11a1 and col12a1), myosins (mybph and mybpc2), myomosins (myom1 and myom2) and actins (actc1 and actn3) decreased after A. salmonicida infection. Further, serpin family h member 1 (serpinh1), a collagen-specific chaperon, was also down-regulated in both groups. However, there were also some genes encoding myosins and myozenin, such as mylk2, myl4, myo6 and myoz2, that showed up-regulation in 2 dpi and 6 dpi, respectively. Tropomyosin 3 (tpm3) was differentially regulated depending on the transcript type in both groups. Moreover, metalloproteinases (mmp9, mmp13 and mmp19) were up-regulated in both the 2 dpi and 6 dpi groups. Metalloproteinases are endopeptidases, produced by macrophages, and neutrophils, which are involved in tissue turnover, the degradation of ECM components and inflammatory response [87]. One of the transcript variants of the mmp9 gene showed a statistically significant difference between the moribund and survivor fish. Previous studies on mmp9 in fish revealed the role of these metalloproteinase in collagen reorganization in tissue lesions [88], and its expression was increased in several fish species following A. hydrophila infection [89]. Further, differentially expressed genes between the moribund and survivor fish were decorin (dcn) and keratins (krt13 and krt18) that were down-regulated at 2 dpi and then increased at 6 dpi.
The results presented in this study add to the growing omics resources investigating the rainbow trout response to A. salmonicida infection. The presented differentially expressed genes in the skin might be useful as biomarkers for the molecular diagnosis of furunculosis and in new therapeutic development. However, more studies are still required including next-generation sequencing and the higher resolution of electron microscopy (EM). EM allows for the macroscopic and microscopic lesions in rainbow trout to be visualized and described in order to provide a histological and ultrastructural evaluation of the diseases. Previously, the transmission electron microscopy (TEM) method was used to investigate the skin samples of rainbow trout affected by Red Mark Syndrome (RMS) and provided an overview of the infection progression [90]. A correlation of the molecular and morphological data is necessary to explore A. salmonicida infection in the rainbow trout aquaculture.

5. Conclusions

An infection with A. salmonicida causes damages in rainbow trout aquaculture. To investigate the transcriptional profile of the skin and adhering skeletal muscle in response to A. salmonicida infection in rainbow trout, the 4 × 44 oligonucleotide microarray was applied. We identified differentially expressed genes at 2 and 6 days post infection. Further, we investigated the differences between moribund (2 dpi) and survivor (6 dpi) fish. Our results revealed a divergent expression of many genes involved in the fish immune system, mainly including inflammation, antimicrobial peptides, pattern recognition patterns, acute-phase response proteins, such as serum amyloids, lysozymes, cathelicidin, hepcidin and c-type lectins as well as genes involved in complement cascade after infection. Along with the immune response, we saw the up-regulation of leptin, prostaglandins and eicosanoids related to metabolic reprogramming. Further, a gene expression analysis revealed the differential regulation of genes involved in programmed cell death (apoptosis, necroptosis and ferroptosis) and cytoskeleton and extracellular matrix remodeling. The results from this study confirm the complexity of the response to bacterial infection and constitute a source for further studies on furunculosis in rainbow trout. This is, to our knowledge, the first study that aimed to achieve the gene expression profiling of rainbow trout skin after an A. salmonicida challenge.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/app132312793/s1, Table S1: List of differentially expressed genes with annotations identified in rainbow trout after infection with A. salmonicida in moribund (2 dpi) and survivor (6 dpi) fish; Table S2: List of differentially expressed genes with annotations between moribund (2 dpi) and survivor (6 dpi) fish; Figure S1: GO enrichment analysis of moribund (2 dpi) group. Bubble plot presents top 10 GO subcategories with highest p-value in main categories: biological process (BP), cellular component (CC), molecular function (MF). (a) Up-regulated genes. (b) Down-regulated genes; Figure S2: GO enrichment analysis of survivor (6 dpi) group. Bubble plot presents top 10 GO subcategories with highest p-value in main categories: biological process (BP), cellular component (CC), molecular function (MF). (a) Up-regulated genes. (b) Down-regulated genes; Figure S3: GO enrichment analysis between moribund (2 dpi) and survivor (6 dpi) groups. Bubble plot presents top 10 GO subcategories with highest p-value in main categories: biological process (BP), cellular component (CC), molecular function (MF). (a) Genes decreased over time. (b) Genes raised over time.

Author Contributions

Conceptualization, R.W. and M.M.; methodology, R.W., A.K.S., S.D. and M.M.; formal analysis, M.M.; investigation, M.M., A.K.S., S.D. and R.W.; resources, M.M., A.K.S., S.D. and R.W.; writing—original draft preparation, M.M. and R.W.; writing—review and editing, M.M., A.K.S., S.D. and R.W.; visualization, M.M.; supervision, R.W.; validation, R.W. and M.M; funding acquisition, R.W. All authors have read and agreed to the published version of the manuscript.

Funding

This study was partially funded by project no. 397/N-cGRASP/2009/0 of the Ministry of Science and Higher Education in Poland to RW and statutory task IV.1 in the IO PAS.

Institutional Review Board Statement

All experimental procedures were performed in accordance with the three Rs for the humane use of animals in scientific research and were approved by the Local Ethics Committee on Animal Experimentation of the Inland Fisheries Institute of Olsztyn, Poland (approval code: Nr 20/2011; approval date: 30 March 2011).

Informed Consent Statement

Not applicable.

Data Availability Statement

The microarray data were deposited in the National Center for Biotechnology Information’s Gene Expression Omnibus (NCBI GEO) under the accession number GEO: GSE230658.

Acknowledgments

This research was supported in part by PL-Grid Infrastructure. The authors would like to thank Aleksei Krasnov (NOFIMA, Norway) for providing advice, Alicja Majewska for conducting the hybridization experiments at the Warsaw University of Life Sciences (SGGW) and Agnieszka Kleszczyńska for performing the RT-qPCR tests.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. Fishery and Aquaculture Statistics. Global aquaculture production 1950–2021 (FishStatJ). In FAO Fisheries and Aquaculture Division [online]; Food and Agriculture Organization of the United Nations: Rome, Italy, 2023; Updated 2023; Available online: www.fao.org/fishery/statistics/software/fishstatj/en (accessed on 10 June 2023).
  2. Hamed, S.B.; Ranzani-Paiva, M.J.T.; Tachibana, L.; Dias, D.; Ishikawa, C.M.; Esteban, M.A. Fish pathogen bacteria: Adhesion, parameters influencing virulence and interaction with host cells. Fish Shellfish. Immunol. 2018, 80, 550–562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Ebanks, R.O.; Knickle, L.C.; Goguen, M.; Boyd, J.M.; Pinto, D.M.; Reith, M.; Ross, N.W. Expression of and secretion through the Aeromonas salmonicida type III secretion system. Microbiology 2006, 152, 1275–1286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Zepeda-Velázquez, A.P.; Vega-Sánchez, V.; Salgado-Miranda, C.; Soriano-Vargas, E. Histopathological findings in farmed rainbow trout (Oncorhynchus mykiss) naturally infected with 3 different Aeromonas species. Can. J. Vet. Res. 2015, 79, 250–254. [Google Scholar] [PubMed]
  5. Burr, S.E.; Wahli, T.; Segner, H.; Pugovkin, D.; Frey, J. Association of Type III secretion genes with virulence of Aeromonas salmonicida subsp. salmonicida. Dis. Aquat. Org. 2003, 57, 167–171. [Google Scholar] [CrossRef] [Scilit]
  6. Cornick, J.W.; Morrison, C.M.; Zwicker, B.; Shum, G. Atypical Aeromonas salmonicida infection in Atlantic cod, Gadus morhua L. J. Fish Dis. 1984, 7, 495–499. [Google Scholar] [CrossRef] [Scilit]
  7. Falco, A.; Frost, P.; Miest, J.; Pionnier, N.; Irnazarow, I.; Hoole, D. Reduced inflammatory response to Aeromonas salmonicida infection in common carp (Cyprinus carpio L.) Fed with β-Glucan supplements. Fish Shellfish Immunol. 2012, 32, 1051–1057. [Google Scholar] [CrossRef] [Scilit]
  8. Real, F.; Acosta, B.; Déniz, S.; Oros, J.; Rodriguez, E. Aeromonas salmonicida infection in Sparus aurata in the Canaries. Bull. Eur. Assoc. Fish. Pathol. 1944, 14, 153–155. [Google Scholar]
  9. Fernández-Álvarez, C.; Gijón, D.; Álvarez, M.; Santos, Y. First isolation of Aeromonas salmonicida subspecies salmonicida from diseased sea bass, Dicentrarchus Labrax (L.), cultured in Spain. Aquac. Rep. 2016, 4, 36–41. [Google Scholar] [CrossRef] [Scilit]
  10. Magariños, B.; Devesa, S.; González, A.; Castro, N.; Toranzo, A.E. Furunculosis in Senegalese sole (Solea senegalensis) cultured in a recirculation system. Vet. Rec. 2011, 168, 431b. [Google Scholar] [CrossRef] [Scilit]
  11. Bricknell, I.R.; Bowden, T.J.; Bruno, D.W.; MacLachlan, P.; Johnstone, R.; Ellis, A.E. Susceptibility of Atlantic halibut, Hippoglossus hippoglossus (L.) to infection with typical and atypical Aeromonas salmonicida. Aquaculture 1999, 175, 1–13. [Google Scholar] [CrossRef] [Scilit]
  12. El Morabit, A.; García-Márquez, S.; Santos, Y. Is sea lamprey a potential source of infection with Aeromonas salmonicida for wild and farmed fish? Bull. Eur. Assoc. Fish. Pathol. 2004, 24, 100–103. [Google Scholar]
  13. Toranzo, A.E.; Magariños, B.; Romalde, J.L. A review of the main bacterial fish diseases in mariculture systems. Aquaculture 2005, 246, 37–61. [Google Scholar] [CrossRef] [Scilit]
  14. McCarthy, D.H.; Roberts, R.J. Furunculosis of fish-the present state of our knowledge. In Advances in Aquatic Microbiology; Droop, M.R., Jannasch, H.W., Eds.; Academic Press: London, UK, 1980; pp. 293–341. [Google Scholar]
  15. Malachowicz, M.; Wenne, R.; Burzynski, A. De novo assembly of the sea trout (Salmo trutta m. trutta) skin transcriptome to identify putative genes involved in the immune response and epidermal mucus secretion. PLoS ONE 2017, 17, e0172282. [Google Scholar] [CrossRef] [Scilit]
  16. Scott, M. The pathogenicity of Aeromonas salmonicida (Griffin) in sea and brackish waters. J. Gen. Microbiol. 1968, 50, 321–327. [Google Scholar] [CrossRef] [Scilit]
  17. Tam, B.; Gough, W.A.; Tsuji, L. The impact of warming on the appearance of furunculosis in fish of the James Bay region, Quebec, Canada. Region. Environ. Chang. 2011, 11, 123–132. [Google Scholar] [CrossRef] [Scilit]
  18. De Silva, S.S.; Soto, D. Climate Change and Aquaculture: Potential Impacts, Adaptation and Mitigation. Climate Change Implications for Fisheries and Aquaculture: Overview of Current Scientific Knowledge. FAO Fish. Aquac. Tech. Pap. 2009, 530, 151–212. [Google Scholar]
  19. FAO. The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation; FAO: Rome, Italy, 2022. [Google Scholar] [CrossRef] [Scilit]
  20. Rebl, A.; Korytář, T.; Köbis, J.M.; Verleih, M.; Krasnov, A.; Jaros, J.; Kühn, C.; Köllner, B.; Goldammer, T. Transcriptome profiling reveals insight into distinct immune responses to Aeromonas salmonicida in gill of two rainbow trout strains. Mar. Biotechnol. 2014, 16, 333–348. [Google Scholar] [CrossRef] [Scilit]
  21. Marana, M.H.; Karami, A.M.; Ødegård, J.; Zuo, S.; Jaafar, R.M.; Mathiessen, H.; von Gersdorff Jørgensen, L.; Kania, P.W.; Dalsgaard, I.; Nielsen, T.; et al. Whole-genome association study searching for QTL for Aeromonas salmonicida resistance in rainbow trout. Sci. Rep. 2021, 11, 17857. [Google Scholar] [CrossRef] [Scilit]
  22. Sarais, F.; Montero, R.; Ostermann, S.; Rebl, A.; Köllner, B.; Goldammer, T. The early immune response of lymphoid and myeloid head-kidney cells of rainbow trout (Oncorhynchus mykiss) stimulated with Aeromonas salmonicida. Fishes 2022, 7, 12. [Google Scholar] [CrossRef] [Scilit]
  23. Causey, D.R.; Pohl, M.A.N.; Stead, D.A.; Martin, S.A.M.; Secombes, C.J.; Macqueen, D.J. High-throughput proteomic profiling of the fish liver following bacterial infection. BMC Genom. 2018, 19, 719. [Google Scholar] [CrossRef] [Scilit]
  24. Long, M.; Zhao, J.; Li, T.; Tafalla, C.; Zhang, Q.; Wang, X.; Gong, X.; Shen, Z.; Li, A. Transcriptomic and proteomic analyses of splenic immune mechanisms of rainbow trout (Oncorhynchus mykiss) infected by Aeromonas salmonicida subsp. salmonicida. J. Proteom. 2015, 122, 41–54. [Google Scholar] [CrossRef] [Scilit]
  25. Valderrama, K.; Soto-Dávila, M.; Segovia, C.; Vásquez, I.; Dang, M.; Santander, J. Aeromonas salmonicida infects Atlantic salmon (Salmo salar) erythrocytes. J. Fish Dis. 2019, 42, 1601–1608. [Google Scholar] [CrossRef] [Scilit]
  26. Taylor, R.S.; Ruiz Daniels, R.; Dobie, R.; Naseer, S.; Clark, T.C.; Henderson, N.C.; Boudinot, P.; Martin, S.A.M.; Macqueen, D.J. Single cell transcriptomics of Atlantic salmon (Salmo salar L.) liver reveals cellular heterogeneity and immunological responses to challenge by Aeromonas salmonicida. Front. Immunol. 2022, 13, 984799. [Google Scholar] [CrossRef] [Scilit]
  27. Soto-Dávila, M.; Hossain, A.; Chakraborty, S.; Rise, M.L.; Santander, J. Aeromonas salmonicida subsp. salmonicida early infection and immune response of Atlantic cod (Gadus corhua L.) primary macrophages. Front. Immunol. 2019, 10, 1237. [Google Scholar] [CrossRef] [Scilit]
  28. Librán-Pérez, M.; Pereiro, P.; Figueras, A.; Novoa, B. Transcriptome analysis of turbot (Scophthalmus maximus) infected with Aeromonas salmonicida reveals a direct effect on leptin synthesis as a neuroendocrine mediator of inflammation and metabolism regulation. Front. Mar. Sci. 2022, 9, 888115. [Google Scholar] [CrossRef] [Scilit]
  29. Chakraborty, S.; Hossain, A.; Cao, T.; Gnanagobal, H.; Segovia, C.; Hill, S.; Monk, J.; Porter, J.; Boyce, D.; Hall, J.R.; et al. Multi-organ transcriptome response of lumpfish (Cyclopterus lumpus) to Aeromonas salmonicida subspecies salmonicida systemic infection. Microorganisms 2022, 10, 2113. [Google Scholar] [CrossRef] [Scilit]
  30. Braden, L.M.; Whyte, S.K.; Brown, A.B.J.; Iderstine, C.V.; Letendre, C.; Groman, D.; Lewis, J.; Purcell, S.L.; Hori, T.; Fast, M.D. Vaccine-induced protection against furunculosis involves pre-emptive priming of humoral immunity in Arctic charr. Front. Immunol. 2019, 10, 120. [Google Scholar] [CrossRef] [Scilit]
  31. Holten-Andersen, L.; Dalsgaard, I.; Buchmann, K. Baltic salmon, Salmo salar, from Swedish river Lule Älv is more resistant to furunculosis compared to rainbow trout. PLoS ONE 2012, 7, e29571. [Google Scholar] [CrossRef] [Scilit]
  32. Cipriano, R.C.; Ford, L.A.; Jones, T.E. Relationship between resistance of salmonids to furunculosis and recovery of Aeromonas salmonicida from external mucus. J. Wildl. Dis. 1994, 30, 577–580. [Google Scholar] [CrossRef] [Scilit]
  33. Miller, T.A.; Rapp, J.; Wastlhuber, U.; Hoffmann, R.W.; Enzmann, P.J. Rapid and sensitive reverse transcriptase-polymerase chain reaction based detection and differential diagnosis of fish pathogenic rhabdoviruses in organ samples and cultured cells. Dis. Aquat. Org. 1988, 34, 13–20. [Google Scholar] [CrossRef] [Scilit]
  34. Siwicki, A.K.; Terech-Majewska, E.; Lepa, A.; Grudniewska, J. Zakaźna martwica układu krwiotwórczego (IHN) u pstrąga tęczowego (Oncorhynchus mykiss): Diagnostyka i immunoprofilaktyka. Komun. Ryb. 2012, 6, 10–14. [Google Scholar]
  35. Saint-Jean, S.R.; Borrego, J.J.; Perez-Prieto, S.I. Comparative evaluation of five serological methods and RT-PCR assay for the detection of IPNV in fish. J. Virol. Methods 2001, 97, 23–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Aso, Y.; Wani, J.; Klenner, D.A.S.; Yoshimizu, M. Detection and identification of Oncorhynchus masou virus (OMV) by polymerase chain reaction (PCR). Bull. Fac. Fish. Hokkaido Univ. 2001, 52, 111–116. [Google Scholar]
  37. Siwicki, A.K.; Miyazaki, T.; Komatsu, I.; Matsusato, T.; Goryczko, K.; Terech-Majewska, E. Effects of heat extract from firefly squid, Watasenia scintillans, on the nonspecific defence mechanisms and protection against furunculosis in rainbow trout [Oncorhynchus mykiss]. Arch. Pol. Fish. 1998, 6, 59–66. [Google Scholar]
  38. Soltanian, S.; Fereidouni, M.S. Effect of Henna (Lawsonia inermis) extract on the immunity and survivor of common carp, Cyprinus carpio infected with Aeromonas hydrophila. Int. Aquat. Res. 2016, 8, 247–261. [Google Scholar] [CrossRef] [Scilit]
  39. Lu, L.F.; Jiang, J.Y.; Du, W.X.; Wang, X.L.; Li, Z.C.; Zhou, X.Y.; Zhang, C.; Mou, C.Y.; Chen, D.D.; Li, Z.; et al. Fish female-biased gene cyp19a1a leads to female antiviral response attenuation between sexes by autophagic degradation of MITA. PLoS Pathog. 2022, 18, e1010626. [Google Scholar] [CrossRef] [Scilit]
  40. Kazun, K.; Siwicki, A.K. Propiscin—A safe new anaesthetic for fish. Arch. Pol. Fish. 2001, 9, 183–190. [Google Scholar]
  41. Pajdak-Czaus, J.; Schulz, P.; Terech-Majewska, E.; Szweda, W.; Siwicki, A.K.; Platt-Samoraj, A. Influence of infectious pancreatic necrosis virus and Yersinia ruckeri co-infection on a non-specific immune system in rainbow trout (Oncorhynchus mykiss). Animals 2021, 11, 1974. [Google Scholar] [CrossRef] [Scilit]
  42. Siwicki, A.K.; Anderson, D.P. Immunostimulation in Fish: Measuring the Effects of Stimulants by Serological and Immunological Methods. In Proceedings of the Nordic Symposium on Fish Immunology, Lysekil, Sweden, 19–22 May 1993; Inland Fisheries Institute: Olsztyn, Poland, 1993; pp. 1–17. [Google Scholar]
  43. Krasnov, A.; Timmerhaus, G.; Afanasyev, S.; Jørgensen, S.M. Development and assessment of oligonucleotide microarrays for Atlantic salmon (Salmo salar L.). Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 6, 31–38. [Google Scholar] [CrossRef] [Scilit]
  44. Malachowicz, M.; Wenne, R. Microarray analysis of gene expression of Atlantic cod from different Baltic Sea regions: Adaptation to salinity. Mar. Genom. 2019, 48, 100681. [Google Scholar] [CrossRef] [Scilit]
  45. Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. Limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Hong, F.; Breitling, R.; McEntee, C.W.; Wittner, B.S.; Nemhauser, J.L.; Chory, J. RankProd: A bioconductor package for detecting differentially expressed genes in meta-analysis. Bioinformatics 2006, 22, 2825–2827. [Google Scholar] [CrossRef] [Scilit]
  47. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  48. Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Bu, D.; Luo, H.; Huo, P.; Wang, Z.; Zhang, S.; He, Z.; Wu, Y.; Zhao, L.; Liu, J.; Guo, J.; et al. KOBAS-i: Intelligent prioritization and exploratory visualization of biological functions for gene enrichment analysis. Nucleic Acids Res. 2021, 49, W317–W325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [Scilit]
  51. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  52. Irshath, A.A.; Rajan, A.P.; Vimal, S.; Prabhakaran, V.-S.; Ganesan, R. Bacterial pathogenesis in various fish diseases: Recent advances and specific challenges in vaccine development. Vaccines 2023, 11, 470. [Google Scholar] [CrossRef] [Scilit]
  53. Francisco, V.; Pino, J.; Campos-Cabaleiro, V.; Ruiz-Fernández, C.; Mera, A.; Gonzalez-Gay, M.A.; Gómez, R.; Gualillo, O. Obesity, fat mass and immune system: Role for leptin. Front. Physiol. 2018, 9, 640. [Google Scholar] [CrossRef] [Scilit]
  54. Reidy, S.P.; Weber, J. Leptin: An essential regulator of lipid metabolism. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2000, 125, 285–298. [Google Scholar] [CrossRef] [Scilit]
  55. Wang, A.; Huen, S.C.; Luan, H.H.; Yu, S.; Zhang, C.; Gallezot, J.-D.; Booth, C.J.; Medzhitov, R. Opposing effects of fasting metabolism on tissue tolerance in bacterial and viral inflammation. Cell 2016, 166, 1512–1525.e12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Gao, F.; Shi, X.; Zhao, Y.; Qiao, D.; Pei, C.; Li, C.; Zhao, X.; Kong, X. The role of CcPTGS2a in immune response against Aeromonas hydrophila infection in common carp (Cyprinus carpio). Fish Shellfish. Immunol. 2023, 141, 109058. [Google Scholar] [CrossRef] [Scilit]
  57. Escoll, P.; Buchrieser, C. Metabolic reprogramming of host cells upon bacterial infection: Why shift to a Warburg-like metabolism? FEBS J. 2018, 285, 2146–2160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Zeng, Z.H.; Du, C.C.; Liu, S.R.; Li, H.; Peng, X.X.; Peng, B. Glucose enhances tilapia against Edwardsiella tarda infection through metabolome reprogramming. Fish Shellfish Immunol. 2017, 61, 34–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Li, X.; Hu, X.; Lv, A.; Guan, Z. Skin immune response to Aeromonas hydrophila infection in crucian carp Carassius auratus revealed by multi-omics analysis. Fish Shellfish Immunol. 2022, 127, 866–875. [Google Scholar] [CrossRef] [Scilit]
  60. Soomro, M.A.; Pavase, T.R.; Hu, G. Role of pattern recognition receptors in teleost fish: Recent advances. Int. J. Fish. Aquat. Stud. 2021, 9, 136–151. [Google Scholar]
  61. Soanes, K.H.; Figuereido, K.; Richards, R.C.; Mattatall, N.R.; Ewart, K.V. Sequence and expression of C-type lectin receptors in Atlantic salmon (Salmo salar). Immunogenetics 2004, 56, 572–584. [Google Scholar] [CrossRef] [Scilit]
  62. Kingeter, L.M.; Lin, X. C-type lectin receptor-induced NF-κB activation in innate immune and inflammatory responses. Cell. Mol. Immunol. 2012, 9, 105–112. [Google Scholar] [CrossRef] [Scilit]
  63. Santana, P.A.; Álvarez, C.A.; Guzmán, F.; Mercado, L. Development of a sandwich ELISA for quantifying hepcidin in rainbow trout. Fish Shellfish Immunol. 2013, 35, 748–755. [Google Scholar] [CrossRef] [Scilit]
  64. Richards, R.C.; O’Neil, D.B.; Thibault, P.; Ewart, K.V. Histone H1: An antimicrobial protein of Atlantic salmon (Salmo salar). Biochem. Biophys. Res. Commun. 2001, 284, 549–555. [Google Scholar] [CrossRef] [Scilit]
  65. Chen, C.; Wang, A.; Zhang, F.; Zhang, M.; Yang, H.; Li, J.; Su, P.; Chen, Y.; Yu, H.; Wang, Y. The protective effect of fish-derived cathelicidins on bacterial infections in zebrafish, Danio rerio. Fish Shellfish Immunol. 2019, 92, 519–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Semple, S.L.; Dixon, B. Salmonid antibacterial immunity: An aquaculture perspective. Biology 2020, 9, 331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Sakai, M.; Hikima, J.; Kono, T. Fish cytokines: Current research and applications. Fish Sci. 2021, 87, 1–9. [Google Scholar] [CrossRef] [Scilit]
  68. Xu, H.; Liu, F. Advances in chemokines of teleost fish species. Aquac. Fish. 2023, in press. [CrossRef] [Scilit]
  69. Costa, M.M.; Maehr, T.; Diaz-Rosales, P.; Secombes, C.J.; Wang, T. Bioactivity studies of rainbow trout (Oncorhynchus mykiss) interleukin-6: Effects on macrophage growth and antimicrobial peptide gene expression. Mol. Immunol. 2011, 48, 1903–1916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Redivo, B.; Derôme, N.; Kestemont, P.; Cornet, V. The Pathogen Aeromonas salmonicida achromogenes Induces Fast Immune and Microbiota Modifications in Rainbow Trout. Microorganisms 2023, 11, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  71. Zhu, H.; Song, R.; Wang, X.; Hu, H.; Zhang, Z. Peritoneal bacterial infection repressed the expression of IL17D in Siberia sturgeon a chondrostean fish in the early immune response. Fish Shellfish Immunol. 2017, 64, 39–48. [Google Scholar] [CrossRef] [Scilit]
  72. Li, Y.; Zhang, P.; Gao, C.; Cao, M.; Yang, N.; Li, X.; Li, C.; Fu, Q. CXC chemokines and their receptors in black rockfish (Sebastes schlegelii): Characterization, evolution analyses, and expression pattern after Aeromonas salmonicida infection. Int. J. Biol. Macromol. 2021, 186, 109–124. [Google Scholar] [CrossRef] [Scilit]
  73. Charlie-Silva, I.; Klein, A.; Gomes, J.M.M.; Prado, E.J.R.; Moraes, A.C.; Eto, S.F.; Fernandes, D.C.; Fagliari, J.J.; Junior, J.D.C.; Lima, C.; et al. Acute-phase proteins during inflammatory reaction by bacterial infection: Fish-model. Sci. Rep. 2019, 9, 4776. [Google Scholar] [CrossRef] [Scilit]
  74. Roy, S.; Kumar, V.; Kumar, V.; Behera, B.K. Acute phase proteins and their potential role as an indicator for fish health and in diagnosis of fish diseases. Protein Pept. Lett. 2017, 24, 78–89. [Google Scholar] [CrossRef] [Scilit]
  75. Buks, R.; Alnabulsi, A.; Zindrili, R.; Alnabulsi, A.; Wang, A.; Wang, T.; Martin, S.A.M. Catch of the Day: New Serum Amyloid A (SAA) Antibody Is a Valuable Tool to Study Fish Health in Salmonids. Cells 2023, 12, 2097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Stearns-Kurosawa, D.J.; Osuchowski, M.F.; Valentine, C.; Kurosawa, S.; Remick, D.G. The pathogenesis of sepsis. Annu. Rev. Pathol. 2011, 6, 19–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Shen, Y.; Zhang, J.; Xu, X.; Fu, J.; Li, J. Expression of complement component C7 and involvement in innate immune responses to bacteria in grass carp. Fish Shellfish Immunol. 2012, 33, 448–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Kato, Y.; Nakao, M.; Shimizu, M.; Wariishi, H.; Yano, T. Purification and functional assessment of C3a, C4a and C5a of the common carp (Cyprinus carpio) complement. Dev. Comp. Immunol. 2004, 28, 901–910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Yan, G.; Elbadawi, M.; Efferth, T. Multiple cell death modalities and their key features (Review). World Acad. Sci. J. 2020, 2, 39–48. [Google Scholar] [CrossRef] [Scilit]
  80. Park, M.Y.; Ha, S.E.; Vetrivel, P.; Kim, H.H.; Bhosale, P.B.; Abusaliya, A.; Kim, G.S. Differences of Key Proteins between Apoptosis and Necroptosis. Biomed. Res. Int. 2021, 12, 3420168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  81. Goetz, F.W.; Planas, J.V.; MacKenzie, S. Tumor necrosis factors. Dev. Comp. Immunol. 2004, 28, 487–497. [Google Scholar] [CrossRef] [Scilit]
  82. Schwenteit, J.M.; Breithaupt, A.; Teifke, J.P.; Koppang, E.O.; Bornscheuer, U.T.; Fischer, U.; Gudmundsdottir, B.K. Innate and Adaptive Immune Responses of Arctic Charr (Salvelinus alpinus, L.) during Infection with Aeromonas Salmonicida Subsp. Achromogenes and the Effect of the AsaP1 Toxin. Fish Shellfish Immunol. 2013, 35, 866–873. [Google Scholar]
  83. Liu, C.; Ma, J.; Zhang, D.; Li, W.; Jiang, B.; Qin, Z.; Su, Y.; Lin, L.; Wang, Q. Immune Response and Apoptosis-Related Pathways Induced by Aeromonas schubertii Infection of Hybrid Snakehead (Channa maculata♀ × Channa argus♂). Pathogens 2021, 10, 997. [Google Scholar] [CrossRef] [Scilit]
  84. Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021, 31, 107–125. [Google Scholar] [CrossRef] [Scilit]
  85. Yang, M.; Lu, Z.; Li, F.; Shi, F.; Zhan, F.; Zhao, L.; Li, Y.; Li, J.; Lin, L.; Qin, Z. Escherichia coli induced ferroptosis in red blood cells of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2021, 112, 159–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  86. Bachir, A.I.; Horwitz, A.R.; Nelson, W.J.; Bianchini, J.M. Actin-based adhesion modules mediate cell interactions with the extracellular matrix and neighboring cells. Cold Spring Harb. Perspect. Biol. 2017, 9, a023234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  87. Pedersen, M.E.; Vuong, T.T.; Rønning, S.B.; Kolset, S.O. Matrix metalloproteinases in fish biology and matrix turnover. Matrix biology. J. Int. Soc. Matrix Biol. 2015, 44–46, 86–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. LeBert, D.C.; Squirrell, J.M.; Rindy, J.; Broadbridge, E.; Lui, Y.; Zakrzewska, A.; Eliceiri, K.W.; Meijer, A.H.; Huttenlocher, A. Matrix metalloproteinase 9 modulates collagen matrices and wound repair. Development 2015, 142, 2136–2146. [Google Scholar] [CrossRef] [Scilit]
  89. Mou, C.-Y.; Zhang, L.; Zhao, H.; Huang, Z.-P.; Duan, Y.-L.; Zhao, Z.-M.; Ke, H.-Y.; Du, J.; Li, Q.; Zhou, J. Single-nuclei RNA-seq reveals skin cell responses to Aeromonas hydrophila infection in Chinese longsnout catfish Leiocassis longirostris. Front. Immunol. 2023, 14, 1271466. [Google Scholar] [CrossRef] [Scilit]
  90. Orioles, M.; Galeotti, M.; Saccà, E.; Bulfoni, M.; Corazzin, M.; Bianchi, S.; Torge, D.; Macchiarelli, G.; Magi, G.E.; Schmidt, J.G. Effect of temperature on transfer of Midichloria-like organism and development of red mark syndrome in rainbow trout (Oncorhynchus mykiss). Aquaculture 2022, 560, 738577. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Immunoassay analysis of infected fish: 2 dpi (moribund, n = 4), 6 dpi (survivors, n = 3) and uninfected (control, n = 3). Statistical comparison was carried out using Kruskal–Wallis test. (a) Ceruloplasmin activity in the plasma. (b) Gamma globulin level in the serum. (c) Lysozyme activity in the plasma. Significant differences are indicated by different lowercase letters (p-value < 0.05); same letter indicates no statistical difference.
Figure 1. Immunoassay analysis of infected fish: 2 dpi (moribund, n = 4), 6 dpi (survivors, n = 3) and uninfected (control, n = 3). Statistical comparison was carried out using Kruskal–Wallis test. (a) Ceruloplasmin activity in the plasma. (b) Gamma globulin level in the serum. (c) Lysozyme activity in the plasma. Significant differences are indicated by different lowercase letters (p-value < 0.05); same letter indicates no statistical difference.
Applsci 13 12793 g001
Figure 2. Pearson correlation coefficient analysis between infected fish, presented as matrix graphic (RT1, RT2, RT3 and RT4 were moribund, whereas RT5, RT6 and RT7 were survivor fish). All samples showed positive correlation. Color and size of circles (light blue to dark blue) indicate rising correlation value.
Figure 2. Pearson correlation coefficient analysis between infected fish, presented as matrix graphic (RT1, RT2, RT3 and RT4 were moribund, whereas RT5, RT6 and RT7 were survivor fish). All samples showed positive correlation. Color and size of circles (light blue to dark blue) indicate rising correlation value.
Applsci 13 12793 g002
Figure 3. Volcano map of differentially expressed genes (DEGs) in (a) moribund fish (2 dpi group) and (b) survivor fish (6 dpi group). Red color represents up-regulated genes, whereas blue color shows down-regulated genes. Grey color shows non-significant genes. Differentially expressed genes were identified based on fold change (FC) > 2 (FC(log2) > 1 on x-axis) and significance(−log10) over 1.3 (y-axis), which represents p-value < 0.05. Gene symbols are presented for top five DEGs with highest and lowest expression values in each experimental group. Gene symbols: liver-enriched antimicrobial peptide 2 (leap2), c-c motif chemokine ligand 13 (ccl13), inositol 1,4,5-trisphosphate receptor type 2 (itpr2), c1q and tnf-related 3 (ctrp3), heat shock protein 90 alpha family class a member 1 (hsp90aa1), cd209 molecule (cd209), c-type lectin domain family 4 member e (clec4e), ion transport potassium channel tetramerization domain containing 12 gene (kctd1), interleukin 11 (il11), calcium binding and coiled-coil domain 1 (calcoco1), s100 calcium binding protein p (s100p), cathepsin (ctsl1), MHC class I heavy chain (mhcI), mid1 interacting protein 1 (mid1ip1), matrix metallopeptidase 13 (mmp13) and polyubiquitin 11 (ubq11).
Figure 3. Volcano map of differentially expressed genes (DEGs) in (a) moribund fish (2 dpi group) and (b) survivor fish (6 dpi group). Red color represents up-regulated genes, whereas blue color shows down-regulated genes. Grey color shows non-significant genes. Differentially expressed genes were identified based on fold change (FC) > 2 (FC(log2) > 1 on x-axis) and significance(−log10) over 1.3 (y-axis), which represents p-value < 0.05. Gene symbols are presented for top five DEGs with highest and lowest expression values in each experimental group. Gene symbols: liver-enriched antimicrobial peptide 2 (leap2), c-c motif chemokine ligand 13 (ccl13), inositol 1,4,5-trisphosphate receptor type 2 (itpr2), c1q and tnf-related 3 (ctrp3), heat shock protein 90 alpha family class a member 1 (hsp90aa1), cd209 molecule (cd209), c-type lectin domain family 4 member e (clec4e), ion transport potassium channel tetramerization domain containing 12 gene (kctd1), interleukin 11 (il11), calcium binding and coiled-coil domain 1 (calcoco1), s100 calcium binding protein p (s100p), cathepsin (ctsl1), MHC class I heavy chain (mhcI), mid1 interacting protein 1 (mid1ip1), matrix metallopeptidase 13 (mmp13) and polyubiquitin 11 (ubq11).
Applsci 13 12793 g003
Figure 4. (a) Venn diagram of shared gene symbols between moribund and survivor fish (2 dpi vs. 6 dpi). (b) Venn diagram of shared probe names between moribund and survivor fish (2 dpi vs. 6 dpi).
Figure 4. (a) Venn diagram of shared gene symbols between moribund and survivor fish (2 dpi vs. 6 dpi). (b) Venn diagram of shared probe names between moribund and survivor fish (2 dpi vs. 6 dpi).
Applsci 13 12793 g004
Figure 5. Bubble plot of pathway enrichment analysis using KEGG database. Plot presents top 10 KO subcategories with highest p-value. (a) Moribund fish (2 dpi). (b) Survivor fish (6 dpi).
Figure 5. Bubble plot of pathway enrichment analysis using KEGG database. Plot presents top 10 KO subcategories with highest p-value. (a) Moribund fish (2 dpi). (b) Survivor fish (6 dpi).
Applsci 13 12793 g005
Figure 6. (a) Volcano map of differentially expressed genes (FC > 2; p-value < 0.05). (b) Hierarchical clustering of 7 infected fish using identified DEGs. Column represents infected individuals, and row represents a gene.
Figure 6. (a) Volcano map of differentially expressed genes (FC > 2; p-value < 0.05). (b) Hierarchical clustering of 7 infected fish using identified DEGs. Column represents infected individuals, and row represents a gene.
Applsci 13 12793 g006
Figure 7. Bubble plot of pathway enrichment analysis using KEGG database of 169 DEGs. Plot presents top 10 pathways with highest p-value that decreased and increased over time.
Figure 7. Bubble plot of pathway enrichment analysis using KEGG database of 169 DEGs. Plot presents top 10 pathways with highest p-value that decreased and increased over time.
Applsci 13 12793 g007
Figure 8. (a) RT-qPCR results for moribund (blue) and survivor (orange) fish; (b) Pearson correlation between microarray and RT-qPCR expression levels for moribund fish (2 dpi); (c) Pearson correlation between microarray and RT-qPCR expression levels for survivor fish (6 dpi). Red line represents a best fit line (with confidence intervals around the slope).
Figure 8. (a) RT-qPCR results for moribund (blue) and survivor (orange) fish; (b) Pearson correlation between microarray and RT-qPCR expression levels for moribund fish (2 dpi); (c) Pearson correlation between microarray and RT-qPCR expression levels for survivor fish (6 dpi). Red line represents a best fit line (with confidence intervals around the slope).
Applsci 13 12793 g008
Table 1. Primers used for RT-qPCR.
Table 1. Primers used for RT-qPCR.
Microarray SPOT_IDGenePrimers (5′-3′)Product Size (bp)
Omy#S27585481Serum amyloid a1 (saa1)F: GGAAGCTGGTAGTGGTTCAC
R: TGTACTCCTCGTTATCCATG
100
Omy#S26387020Cathelicidin antimicrobial peptide (camp)F: GTATGAAGACATCATCACAG
R: CATCCTCTGTATTCAAAGTC
110
Omy#S15341081Prostaglandin-endoperoxide synthase 2 (ptgs2)F: TCAACAACTCCCTGGTCAC
R: GAGGCAGGTTCCGTCCAC
99
Omy#S34308694Steap4 metalloreductase (steap4)F: CAACAGGCTTCCCTTTCATC
R: GCATCCACACAAACAACCAG
108
Omy#S15301030Matrix metallopeptidase 13 (mmp13)F: GGACCAGGAGACAGTTACGC
R: CATTCATTGTTGTTCATGGC
106
Omy#S16761102Interleukin 17D (il17d)F: TTCGTGTCCAACAGAAGTGC
R: GACACCTTGGCTACCGATGC
99
Omy#S15341279Mx dynamin like gtpase 1 (mx1)F: GGCAGAGAGGCTGTATTTCC
R: TGAGACGAACTCCGCTTTTC
101
Omy#S18101422Cathepsin L (ctsl)F: GGAAGCTGGTAGTGGTTCAC
R: TGTACTCCTCGTTATCCATG
99
Omy#S18164841C-C motif chemokine ligand 13 (ccl13)F: CCATGAAGACCCTGACTGC
R: TCCTCGGGCTGAACTTTAG
120
Omy#S15340857Cathepsin B (ctsb)F: AGAACTTCCACAATGTTGAC
R: CTGGCAGACTCATGTCCTC
111
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Małachowicz, M.; Siwicki, A.K.; Dobosz, S.; Wenne, R. Application of 4 × 44 Oligo Microarray to Transcriptomic Analysis of Immune Response in Rainbow Trout Infected with Aeromonas salmonicida. Appl. Sci. 2023, 13, 12793. https://doi.org/10.3390/app132312793

AMA Style

Małachowicz M, Siwicki AK, Dobosz S, Wenne R. Application of 4 × 44 Oligo Microarray to Transcriptomic Analysis of Immune Response in Rainbow Trout Infected with Aeromonas salmonicida. Applied Sciences. 2023; 13(23):12793. https://doi.org/10.3390/app132312793

Chicago/Turabian Style

Małachowicz, Magdalena, Andrzej K. Siwicki, Stefan Dobosz, and Roman Wenne. 2023. "Application of 4 × 44 Oligo Microarray to Transcriptomic Analysis of Immune Response in Rainbow Trout Infected with Aeromonas salmonicida" Applied Sciences 13, no. 23: 12793. https://doi.org/10.3390/app132312793

APA Style

Małachowicz, M., Siwicki, A. K., Dobosz, S., & Wenne, R. (2023). Application of 4 × 44 Oligo Microarray to Transcriptomic Analysis of Immune Response in Rainbow Trout Infected with Aeromonas salmonicida. Applied Sciences, 13(23), 12793. https://doi.org/10.3390/app132312793

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop