Next Article in Journal
Predicting Institution Outcomes for Inter Partes Review (IPR) Proceedings at the United States Patent Trial & Appeal Board by Deep Learning of Patent Owner Preliminary Response Briefs
Previous Article in Journal
Prolonged Endurance Exercise Adaptations Counteract Doxorubicin Chemotherapy-Induced Myotoxicity in Mice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC)

Department of Food Safety Coordination, Istituto Zooprofilattico Sperimentale del Mezzogiorno, via Salute n.2, 80055 Portici, Naples, Italy
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Appl. Sci. 2022, 12(7), 3654; https://doi.org/10.3390/app12073654
Submission received: 2 March 2022 / Revised: 31 March 2022 / Accepted: 2 April 2022 / Published: 5 April 2022
(This article belongs to the Special Issue New Insights into Food Safety)

Abstract

Verocytotoxin-producing Escherichia coli, also referred to as Shiga-toxin-producing Escherichia coli (STEC), can be transmitted to humans through person-to-person contact, consumption of contaminated food or water, or by direct contact with animals. Its clinical and economic consequences have prompted the development of alternative approaches to the official method of analysis “UNI CEN ISO/TS 13136: 2012”, which describes the identification of STEC through the detection of its main virulence genes. Recently, droplet digital PCR (ddPCR) has been proposed as a technique for the sequence-specific detection and direct quantification of nucleic acids. The present study aimed to investigate if ddPCR could be able to detect STEC in less time than that required by the official method. This study consisted of the ddPCR of slices of beef contaminated with STEC and of the sponges used for beef official control at the slaughter stage. The results showed the ability of ddPCR to detect STEC in slices of beef already after sample incubation for 7 h at 37 °C while, in the case of sponges used for official controls, 9 h at 37 °C was needed. In this way, the ddPCR could represent an efficient method for detecting STEC and providing results in less time than the official method.

1. Introduction

Verocytotoxin-producing Escherichia coli (VTEC)—also called Shiga-toxin-producing Escherichia coli (STEC)—are zoonotic agents that can cause several human illnesses, such as diarrhea, hemorrhagic colitis (HC), and hemolytic uremic syndrome (HUS) [1]. STEC infections are continuously growing and are the third most commonly reported zoonosis in the EU. In 2018, 8161 confirmed cases of human STEC infections occurred in the EU, mostly in Ireland, Sweden, Malta, and Denmark, with an increase of 39% from 2017 [2].
The bacteria can be transmitted to humans through person-to-person contact, consumption of food or water contaminated with animal feces, or by direct contact with animals [3,4]. Data reported by the EFSA over the period 2014–2018, revealed that beef and its derivatives continued to be the main vehicles of human STEC infections [2].
Furthermore, the easy transmission and very low infectious dose (i.e., <10 cells) of this bacterium make it able to induce both outbreaks and sporadic cases of human disease [5].
In addition to verocytotoxin (vtx/stx) genes, another virulence factor is the protein “intimin”, which is encoded by the “eae” gene. Intimin is involved in the attachment of STEC bacteria to the intestinal epithelial cells [6].
Since E. coli O157:H7 represent one of the most common causes of STEC infections [7], the simplest classification of STEC bacteria consists of E. coli O157 and non-O157 STEC (i.e., O26, O91, O103, O104, O111, O117, O128, etc) [8,9]. The rate of STEC infection rises markedly during the summer period, owing to several factors: greater consumption of barbecued hamburgers, the shedding of STEC by cattle, a higher bacterial load in minced beef, increased environmental contamination, and longer survival of the bacteria at the time of slaughter [10,11]. In particular, the contamination of carcasses with STEC bacteria can occur when gut contents or fecal matter come into direct contact with meat surfaces or by cross-contamination through contact with contaminated carcasses or environments [12,13]. In addition, cattle are the main reservoir of STEC strains, and foodstuffs of beef origin are the main sources of human infection [10,14].
To date, there are few data on STEC contamination of beef products in Italy [15,16,17], as the surveillance of E. coli O157 and non-O157 in meat or other products is not included in European or national legislation [18,19].
The clinical and economic consequences of the spread of STEC have prompted the development of various methods for detecting STEC strains, which are alternatives to the gold standard (bacteriological method) consisting of the use of selective media or chromogenic agar. Its limits are: the time required for the response (several days), the difficulty of interpreting the final results, due to the abundant background flora [20,21,22], or when the STEC are below the detectable limits of the test [23], the high labor commitment required for processing large numbers of samples [24] and the presence of commonly used antimicrobials, such as cefixime or tellurite, which may inhibit some STEC bacteria [23].
Given the above limitations, new approaches, such as those based on PCR [25,26,27], microarray [27,28,29], or whole genomic sequencing [27,30,31], have been proposed. Of these molecular methods, Real-time PCR, which enables one or more “target” genes to be identified either from one template [21] or multiple templates [26], is frequently used, owing to its differentiation potential and reliability [32,33]. This method is carried out according to UNI CEN ISO/TS 13136: 2012 [34], which describes the identification of STEC through the detection of its main virulence genes.
Specifically, the above ISO envisions the use of Real-time PCR as a tool for screening specific genetic markers, such as “eae” and “stx” genes. If the sample is positive, the ISO involves the use of selective-differential agar to determine whether the virulence factors are contained within a single STEC cell; otherwise, the sample is labeled as “presumptive positive” (i.e., samples with a mix of bacteria, each harboring only one of the targets). The main drawbacks of quantitative PCR (qPCR) are: the additional time of analysis required in the case of positive samples, the high limit of sample quantification (103–104 CFU/g) in comparison with the culture-dependent techniques [35,36,37,38], and the total dependence on the accuracy of standard curve construction [39].
During the last decade, a “third-generation PCR”, or digital PCR (dPCR), has been developed as a technique for the sequence-specific detection and direct quantification of nucleic acids [40,41]. This could replace qPCR in several applications, since it has some advantages, such as high precision [42], and reduced interference of PCR inhibitors [43] and does not require a calibration curve in order to estimate the copy number concentration of the target sequence [44].
Among the various digital PCRs, the droplet digital PCR (ddPCR) from Bio-Rad (Bio-Rad Laboratory, Hercules, California, USA) has been used in several applications. This technique utilizes the phase separation of a water-in-oil emulsion in order to distribute the sample into thousands of small-volume reaction chambers (partitions), thus enabling the positive and negative droplets within each partition to be counted. Specifically, the fluorescence signal of each droplet is individually counted. Through the application of the Poisson distribution, the fraction of positive droplets can be used to calculate the number of copies of the target gene without elaborating a standard curve [45,46,47].
The data yielded by the ddPCR droplet reader can be investigated according to four experimental types: absolute quantification (ABS), copy number variation (CNV), rare event detection (RED), and gene expression (GEX). The above different approaches make the ddPCR a valid instrument for several applications.
Absolute quantification (ABS) allows the quantification of nucleic acids in copies per microliter of the sample, without requiring a standard curve. It has been used to detect several bacteria, parasites, and viruses [47,48,49,50].
Copy number variation (CNV) shows the copy number variations of a “target” locus by comparing it with that of an invariant reference locus [51]. Recently, ddPCR has been used to determine CNV in pathogens and food [52,53].
Gene expression studies (GEX) are carried out to provide information on the function of a gene. In this case, ddPCR is able to detect low levels of DNA gene expression even in the presence of inhibitors [54,55].
Rare event detection (RED) can be grouped into two sub-applications: rare mutation detection (RMD) and rare sequence detection (RSD). Like ABS, these techniques are forms of direct quantification of nucleic acid target sequences in cancer research or virus studies [48].
The present study aimed to develop a new approach to the quantification of the main virulence genes of STEC in less time than that required by UNI CEN ISO/TS 13136: 2012. Hence, the proposed method of analysis could constitute an alternative to the conventional Real-time PCR and could act as a support for the above ISO.

2. Materials and Methods

2.1. Escherichia coli O157 and Experimental Infection of Sponges

E. coli O157 (code: UERL-VTEC C07; eae+, stx1+, stx2+) was kindly provided by the European Union Reference Laboratory VTEC of the Istituto Superiore di Sanità (Rome, Italy). Four slices of beef (10 cm x 10 cm) were bought at a local retail outlet and tested for the absence of E. coli O157 VTEC, according to UNI CEN ISO/TS 13136: 2012.
Three of the above slices were each experimentally infected with an aliquot of 1 mL of E. coli O157 at the following concentrations: 150 CFU/mL, 15 CFU/mL, 1.50 CFU/mL, according to the reference McFarland Standards; the fourth was not infected and served as a negative control.
In particular, the aliquots of E. coli at different concentrations were spotted and uniformly spread on each slice of beef. After incubation for 30 min at room temperature, each slice of beef was swabbed with a sponge and each sponge was placed in a separate stomacher bag containing 90 mL of Buffered Peptone Water (BPW, Thermo Fisher Scientific, Waltham, MA, USA). The bags were then stomached, and finally incubated at 37 °C for different times (from 0 to 18 h). After swabbing, the microbiological load of each sponge was confirmed by using Tryptone Bile X-Gluc agar (TBX, Thermo Fisher Scientific, Waltham, MA, USA).
Furthermore, to evaluate the specificity and exclusiveness of the proposed approach, 10 slices of beef were infected with different bacteria (Table 1) at the above three concentrations, but were incubated only for selected times (7, 8, and 9 h). These slices of beef were then processed as above.

2.2. In Vivo Analysis

Sponges used for the microbiological control of carcasses (n = 50) of cattle slaughtered in several areas of the Campania region underwent ddPCR for STEC detection. Briefly, after swabbing the carcasses, according to UNI EN ISO 17604:2015, the sponges were placed in separate stomacher bags containing 90 mL of Buffered Peptone Water (BPW, Thermo Fisher Scientific, Waltham, MA, USA), stomached, and incubated at 37 °C for different times (from 0 to 18 h). Subsequently, a DNA extraction process was carried out.

2.3. DNA Extraction

DNA extraction was carried out according to the manufacturer’s protocol of InstaGene Matrix (Bio-rad 7326030; Hercules, CA, USA). Briefly, 1 mL of broth from each stomacher bag was placed in a test tube and then vortexed and centrifuged at 12,000× g rpm for 5 min, and the supernatant was discarded. The pellet obtained was then suspended in 200 μL of InstaGene Matrix, vortexed for 30 s, and finally incubated at 56 °C for 20 min. The sample was then vortexed for 10 s, boiled at 99 °C for 15 min, again vortexed for 10 s, and finally centrifuged at 12,000× g rpm for 5 min. The supernatant containing the DNA was collected in another test tube.

2.4. Droplet Digital PCR

Droplet digital PCR was carried out by means of the Bio-Rad QX200 system (Bio-Rad Laboratory, Hercules, CA, USA). Briefly, the ddPCR reactions were carried out by using a reaction volume (20 μL) consisting of 50 ng of DNA, 10 μL ddPCR Supermix for Probes (No dUTP), 0.5 μM of each primer, 0.2 μM of the probe and nuclease-free water as required to obtain the final volume. Primers and Probes sequences are reported in Table 2.
The reaction mixture was used to produce the droplet mix in a DG8 cartridge (Bio-Rad Laboratory, Hercules, CA, USA) using the QX100 droplet generator (Bio-Rad Laboratory, Hercules, CA, USA). The emulsion (40 μL) of droplet-partitioned samples was then transferred to a 96-well plate and amplified by using a C1000 Touch Thermal Cycler (Bio-Rad Laboratory, Hercules, CA, USA) and adopting the following thermal profile: 95 °C for 10 min, 45 cycles consisting of 95 °C for 15 sec and 58.5 °C for 1 min, and a final step at 98 °C for 10 min. Subsequently, the 96-well plate was read by means of the QX200 Droplet Reader, in terms of the number of positive droplets and according to a Poisson distribution. QuantaSoft software was used to count the PCR-positive and PCR-negative droplets, in order to provide absolute quantification of the target DNA. The quantification measurements of each target were expressed as the number of copies per 1 μL/reaction. In addition, in the case of a saturation condition, several dilutions of the samples were carried out up to 10−9.

2.5. Real-Time PCR

This assay was carried out according to the UNI CEN ISO/TS 13136: 2012. Briefly, Real-time PCR was performed in a reaction volume (20 μL) consisting of 50 ng of DNA, 10 μL TaqMan Universal Master Mix 2x, 0.2 μM of each primer, 0.2 μM of the probe, and nuclease-free water as required to obtain the final volume. Primers and Probes were the same as the ddPCR (Table 2). In addition, the exogenous internal control was used. All the reagents were from Applied Biosystems. The reactions were carried out by using CFX 96 Deepwell (Bio-Rad Laboratory, Hercules, CA USA) and adopting the following thermal profile: 50 °C for 2 min, 95 °C for 10 min, and 44 cycles consisting of 95 °C for 15 s and 60 °C for 1 min.

3. Results

The slices of beef were artificially contaminated with different concentrations of E. coli O157:H7 and these data were confirmed by microbiological analysis (data not shown). The data yielded by the ddPCR analyses allowed us to identify the minimum incubation time for STEC detection. The ddPCR method was able to quantify the number of copies/μL—for all the genes—after an incubation time of 7 h, in the case of slices of beef contaminated artificially with about 150 CFU/mL (Table 3).
However, at lower levels of contamination (15 and 1.5 CFU/mL), STEC detection required 8 and 9 h of incubation at 37 °C, respectively (Table 3). On the basis of these data, we can conclude that a 9 h incubation at 37 °C is needed in order to detect a level of contamination of about 1.5 CFU/mL. After 11 h of incubation, a saturation condition was reached; this condition did not allow the quantification of STEC by ddPCR, but it did confirm the presence of bacteria. All these results revealed that the incubation time varied according to the initial level of contamination, but was less than the 18 h required by UNI CEN ISO/TS 13136: 2012. However, it is important to point out that qPCR was unable to detect STEC at lower concentrations, at the above times of incubation (7 or 11 h; data not shown). Moreover, it should be noted that there was an increase of about 1 log in the number of copies/μL when incubation was prolonged by an hour, for all the concentrations selected (Table 3).
The artificially contaminated slices of beef were also analyzed by means of Real-time PCR according to UNI CEN ISO/TS 13136: 2012. The results showed that STEC bacteria were significantly detected only after 18 h of incubation of the sample at 37 °C. Indeed, the ΔCt values detected in samples incubated for less than 18 h were not statistically significant (p-value > 0.05), thus confirming the need for prolonged incubation (data not shown).
When the same samples were analyzed by means of ddPCR, a saturation condition was observed. To overcome this problem, a second experiment was conducted. The results showed that the samples, independently from the concentration, needed to be diluted up to 10−5 in order to be quantified by ddPCR (Table 4). The same situation was also observed even when the incubation time was 12 h.
Furthermore, the results yielded by the ddPCR of the 10 slices of beef contaminated with different bacteria, listed in Table 1, showed the specificity and exclusiveness of the proposed approach (data not shown).
The last phase was carried out to verify the ability of ddPCR to detect STEC bacteria in sponges used for the control of beef carcasses at the time of slaughter, and to compare this proposed approach with the conventionally applied Real-Time PCR. On the basis of the results yielded by the ddPCR of artificially contaminated sponges, the time of incubation adopted for this analysis was 9 h at 37 °C. All positive sponges are reported in Table 5. The results showed the ability of ddPCR to detect STEC, while Real-Time PCR was not so efficient.

4. Discussion

Contaminated beef is one of the main sources of foodborne STEC infection in humans [56]: about 52% of STEC infections are associated with foodstuffs of bovine origin [57]. The PCR-based methods are widely applied to detect pathogens in food, clinical and environmental samples [58]. The use of PCR and the implementation of surveillance of STEC infections in foodstuffs or animal carcasses could constitute a valid approach to reducing the rate of STEC incidence.
This study was divided into three steps. The first was focused on identifying the minimum incubation time required in order to detect different concentrations of STEC in artificially contaminated sponges. The results revealed the ability of ddPCR to detect STEC already after sample incubation for 7 h.
The second step was directed to overcoming the difficulties caused by the saturation condition of the ddPCR due to the prolonged incubation of samples.
The last phase was, instead, focused on comparing the ability of ddPCR and PCR to detect STEC bacteria in sponges used for inspection.
On the basis of the data obtained, we can hypothesize that ddPCR is a valid and efficient method for detecting STEC contamination. Moreover, it provides results within one working day. As reported by the EFSA [23], there is a pressing need to develop innovative approaches that can provide the same results in less time, with more sensitivity and specificity, than the official method of analysis.
In conclusion, this study revealed the reliability, efficiency, and sensitivity of ddPCR, thus confirming that this technique is useful for the detection of STEC. Future studies will be carried out in order to search for additional genes, thereby providing additional information for the identification of STEC contamination.

Author Contributions

Conceptualization: A.M., F.C. and Y.T.R.P.; Methodology: A.M. and Y.T.R.P.; Software: A.M., S.G. and F.C.; Validation: A.M., F.C. and Y.T.R.P.; Formal Analysis: A.M., S.G., O.D.M. and D.C.; Investigation: A.M., A.F., F.C. and Y.T.R.P.; Resources: F.C. and Y.T.R.P.; Data Curation: A.M., A.F., S.G. and F.C.; Writing—Original Draft Preparation: A.M., A.F.; Writing—Review & Editing: A.M., A.F., F.C. and Y.T.R.P.; Visualization: A.M., F.C., Y.T.R.P.; Supervision: F.C. and Y.T.R.P.; Project Administration: F.C. and Y.T.R.P.; Funding Acquisition: F.C. and Y.T.R.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors acknowledge the European Union Reference Laboratory VTEC of the Istituto Superiore di Sanità (Rome, Italy) for providing the specimen of E. coli O157 (code: UERL-VTEC C07; eae+, stx1+, stx2+).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Duffy, G.; Burgess, C.M.; Bolton, D.J. A review of factors that affect transmission and survival of verocytotoxigenic Escherichia coli in the European farm to fork beef chain. Meat Sci. 2014, 97, 375–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Food, E.; Authority, S. The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, 5926. [Google Scholar] [CrossRef] [Scilit]
  3. Caprioli, A.; Morabito, S.; Brugère, H.; Oswald, E. Enterohaemorrhagic Escherichia coli: Emerging issues on virulence and modes of transmission. Vet. Res. 2005, 36, 289–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Smith, J.L.; Fratamico, P.M.; Gunther, N.W. Shiga toxin-producing Escherichia coli. Adv. Appl. Microbiol. 2014, 86, 145–197. [Google Scholar] [PubMed]
  5. Etcheverría, A.I.; Padola, N.L. Shiga toxin-producing Escherichia coli: Factors involved in virulence and cattle colonization. Virulence 2013, 4, 366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Kaper, J.B. The Locus of Enterocyte Effacement Pathogenicity Island of Shiga Toxin-Producing Escherichia coli O157: H7 and Other Attaching and Effacing E. coli. Jpn. J. Med. Sci. Biol. 1998, 51, S101–S107. [Google Scholar] [CrossRef] [Scilit]
  7. Bai, X.; Wang, H.; Xin, Y.; Wei, R.; Tang, X.; Zhao, A.; Sun, H.; Zhang, W.; Wang, Y.; Xu, Y.; et al. Prevalence and characteristics of Shiga toxin-producing Escherichia coli isolated from retail raw meats in China. Int. J. Food Microbiol. 2015, 200, 31–38. [Google Scholar] [CrossRef] [Scilit]
  8. Karmali, M.A.; Mascarenhas, M.; Shen, S.; Ziebell, K.; Johnson, S.; Reid-Smith, R.; Isaac-Renton, J.; Clark, C.; Rahn, K.; Kaper, J.B. Association of Genomic O Island 122 of Escherichia coli EDL 933 with Verocytotoxin-Producing Escherichia coli Seropathotypes That Are Linked to Epidemic and/or Serious Disease. J. Clin. Microbiol. 2003, 41, 4930–4940. [Google Scholar] [CrossRef] [Scilit]
  9. Amézquita-López, B.A.; Soto-Beltrán, M.; Lee, B.G.; Yambao, J.C.; Quiñones, B. Isolation, genotyping and antimicrobial resistance of Shiga toxin-producing Escherichia coli. J. Microbiol. Immunol. Infect. 2018, 51, 425–434. [Google Scholar] [CrossRef] [Scilit]
  10. Griffin, P.M.; Tauxe, R.V. The epidemiology of infections caused by Escherichia coli o157: H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 1991, 13, 60–98. [Google Scholar] [CrossRef] [Scilit]
  11. Mead, P.S.; Griffin, P.M. Escherichia coli O157:H7. Lancet 1998, 352, 1207–1212. [Google Scholar] [CrossRef] [Scilit]
  12. Elder, R.O. From the Cover: Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proc. Natl. Acad. Sci. USA 2000, 97, 2999–3003. [Google Scholar] [CrossRef] [PubMed]
  13. Edwards, J.R.; Fung, D.Y.C. Prevention and Decontamination of Escherichia coli O157:H7 on Raw Beef Carcasses in Commercial Beef Abattoirs. J. Rapid Methods Autom. Microbiol. 2006, 14, 1–95. [Google Scholar] [CrossRef] [Scilit]
  14. Rangel, J.M.; Sparling, P.H.; Crowe, C.; Griffin, P.M.; Swerdlow, D.L. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002. Emerg. Infect. Dis. 2005, 11, 603–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Conedera, G.; Dalvit, P.; Martini, M.; Galiero, G.; Gramaglia, M.; Goffredo, E.; Loffredo, G.; Morabito, S.; Ottaviani, D.; Paterlini, F.; et al. Verocytotoxin-producing Escherichia coli O157 in minced beef and dairy products in Italy. Int. J. Food Microbiol. 2004, 96, 67–73. [Google Scholar] [CrossRef]
  16. Dambrosio, A.; Lorusso, V.; Quaglia, N.C.; Parisi, A.; La Salandra, G.; Virgilio, S.; Mula, G.; Lucifora, G.; Celano, G.V.; Normanno, G. Escherichia coli O26 in minced beef: Prevalence, characterization and antimicrobial resistance pattern. Int. J. Food Microbiol. 2007, 118, 218–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Stampi, S.; Caprioli, A.; De Luca, G.; Quaglio, P.; Sacchetti, R.; Zanetti, F. Detection of Escherichia coli O157 in bovine meat products in northern Italy. Int. J. Food Microbiol. 2004, 90, 257–262. [Google Scholar] [CrossRef] [Scilit]
  18. Commission Regulation (EC). No. 2073/2005 on Microbiological Criteria for Foodstuffs. Available online: https://www.ecolex.org/details/legislation/commission-regulation-ec-no-20732005-on-microbiological-criteria-for-foodstuffs-lex-faoc061603/ (accessed on 20 March 2020).
  19. Commission Regulation (EC). No. 1441/2007 Amending Regulation (EC) No. 2073/2005 on Microbiological Criteria for Foodstuffs. Available online: https://www.ecolex.org/details/legislation/commission-regulation-ec-no-14412007-amending-regulation-ec-no-20732005-on-microbiological-criteria-for-foodstuffs-lex-faoc075857/ (accessed on 12 September 2020).
  20. Parsons, B.D.; Zelyas, N.; Berenger, B.M.; Chui, L. Detection, characterization, and typing of shiga toxin-producing Escherichia coli. Front. Microbiol. 2016, 7, 478. [Google Scholar] [CrossRef] [Scilit]
  21. Deisingh, A.K.; Thompson, M. Strategies for the detection of Escherichia coli O157:H7 in foods. J. Appl. Microbiol. 2004, 96, 419–429. [Google Scholar] [CrossRef] [Scilit]
  22. March, S.B.; Ratnam, S. Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. J. Clin. Microbiol. 1986, 23, 869–872. [Google Scholar] [CrossRef] [Scilit]
  23. Koutsoumanis, K.; Allende, A.; Alvarez-Ordóñez, A.; Bover-Cid, S.; Chemaly, M.; Davies, R.; De Cesare, A.; Herman, L.; Hilbert, F.; Lindqvist, R.; et al. Pathogenicity assessment of Shiga toxin-producing Escherichia coli (STEC) and the public health risk posed by contamination of food with STEC. EFSA J. 2020, 18, 5967. [Google Scholar] [CrossRef] [Scilit]
  24. Verhaegen, B.; De Reu, K.; Heyndrickx, M.; De Zutter, L. Comparison of Six Chromogenic Agar Media for the Isolation of a Broad Variety of Non-O157 Shigatoxin-Producing Escherichia coli (STEC) Serogroups. Int. J. Environ. Res. Public Health 2015, 12, 6965–6978. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Li, B.; Chen, J.Q. Real-time PCR methodology for selective detection of viable Escherichia coli O157: H7CELLS by targeting Z3276 as a genetic marker. Appl. Environ. Microbiol. 2012, 78, 5297–5304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Cebula, T.A.; Payne, W.L.; Feng, P. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 1995, 33, 248–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Fratamico, P.M.; DebRoy, C.; Liu, Y.; Needleman, D.S.; Baranzoni, G.M.; Feng, P. Advances in Molecular Serotyping and Subtyping of Escherichia coli. Front. Microbiol. 2016, 7, 644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Jackson, S.A.; Kotewicz, M.L.; Patel, I.R.; Lacher, D.W.; Gangiredla, J.; Elkins, C.A. Rapid genomic-scale analysis of Escherichia coli O 104: H4 by using high-resolution alternative methods to next-generation sequencing. Appl. Environ. Microbiol. 2012, 78, 1601–1605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Patel, I.R.; Gangiredla, J.; Lacher, D.W.; Mammel, M.K.; Jackson, S.A.; Lampel, K.A.; Elkins, C.A. FDA Escherichia coli Identification (FDA-ECID) microarray: A pangenome molecular toolbox for serotyping, virulence profiling, molecular epidemiology, and phylogeny. Appl. Environ. Microbiol. 2016, 82, 3384–3394. [Google Scholar] [CrossRef] [Scilit]
  30. Lindsey, R.L.; Pouseele, H.; Chen, J.C.; Strockbine, N.A.; Carleton, H.A. Implementation of Whole Genome Sequencing (WGS) for Identification and Characterization of Shiga Toxin-Producing Escherichia coli (STEC) in the United States. Front. Microbiol. 2016, 7, 766. [Google Scholar] [CrossRef] [Scilit]
  31. Leonard, S.R.; Mammel, M.K.; Lacher, D.W.; Elkins, C.A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS ONE 2016, 11, e0167870. [Google Scholar] [CrossRef] [Scilit]
  32. Jinneman, K.C.; Yoshitomi, K.J.; Weagant, S.D. Multiplex Real-Time PCR Method To Identify Shiga Toxin Genes stx1 and stx2 and Escherichia coli O157:H7/H- Serotype. Appl. Environ. Microbiol. 2003, 69, 6327–6333. [Google Scholar] [CrossRef] [Scilit]
  33. Elizaquível, P.; Aznar, R. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables. Food Microbiol. 2008, 25, 705–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. CEN ISO/TS 13136:2012. Microbiology of Food and Animal Feed—Real-Time Polymerase Chain Reaction (PCR)-Based Method for the Detection of Food-Borne Pathogens—Horizontal Method for the Detection of Shiga Toxin-Producing Escherichia coli (STEC) and the Determination of O157, O111, O26, O103 and O145 Serogroups (ISO/TS 13136:2012). Available online: https://standards.iteh.ai/catalog/standards/cen/151dca9a-959e-4f23-b903-2735bc217e2f/cen-iso-ts-13136-2012 (accessed on 12 September 2020).
  35. Lawal, D.; Burgess, C.; McCabe, E.; Whyte, P.; Duffy, G. Development of a quantitative real time PCR assay to detect and enumerate Escherichia coli O157 and O26 serogroups in bovine recto-anal swabs. J. Microbiol. Methods 2015, 114, 9–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Luedtke, B.E.; Bono, J.L.; Bosilevac, J.M. Evaluation of real time PCR assays for the detection and enumeration of enterohemorrhagic Escherichia coli directly from cattle feces. J. Microbiol. Methods 2014, 105, 72–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Noll, L.W.; Shridhar, P.B.; Shi, X.; An, B.; Cernicchiaro, N.; Renter, D.G.; Nagaraja, T.G.; Bai, J. A Four-Plex Real-Time PCR Assay, Based on rfbE, stx1, stx2, and eae Genes, for the Detection and Quantification of Shiga Toxin-Producing Escherichia coli O157 in Cattle Feces. Foodborne Pathog. Dis. 2015, 12, 787–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Ahmed, W.; Gyawali, P.; Toze, S. Quantitative PCR measurements of Escherichia coli including shiga toxin-producing E. coli (STEC) in animal feces and environmental waters. Environ. Sci. Technol. 2015, 49, 3084–3090. [Google Scholar] [CrossRef] [Scilit]
  39. Bustin, S.A.; Nolan, T. Pitfalls of quantitative real- time reverse-transcription polymerase chain reaction. J. Biomol. Tech. 2004, 15, 155–166. [Google Scholar]
  40. Day, E.; Dear, P.H.; McCaughan, F. Digital PCR strategies in the development and analysis of molecular biomarkers for personalized medicine. Methods 2013, 59, 101–107. [Google Scholar] [CrossRef] [Scilit]
  41. Hall Sedlak, R.; Jerome, K.R. The potential advantages of digital PCR for clinical virology diagnostics. Expert Rev. Mol. Diagn. 2014, 14, 501–507. [Google Scholar] [CrossRef] [Scilit]
  42. Hindson, C.M.; Chevillet, J.R.; Briggs, H.A.; Gallichotte, E.N.; Ruf, I.K.; Hindson, B.J.; Vessella, R.L.; Tewari, M. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat. Methods 2013, 10, 1003–1005. [Google Scholar] [CrossRef] [Scilit]
  43. Dingle, T.C.; Sedlak, R.H.; Cook, L.; Jerome, K.R. Tolerance of Droplet-Digital PCR vs. Real-Time Quantitative PCR to Inhibitory Substances. Clin. Chem. 2013, 59, 1670–1672. [Google Scholar] [CrossRef] [Scilit]
  44. Bhat, S.; Curach, N.; Mostyn, T.; Bains, G.S.; Griffiths, K.R.; Emslie, K.R. Comparison of methods for accurate quantification of DNA mass concentration with traceability to the international system of units. Anal. Chem. 2010, 82, 7185–7192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Capobianco, J.A.; Clark, M.; Cariou, A.; Leveau, A.; Pierre, S.; Fratamico, P.; Strobaugh, T.P.; Armstrong, C.M. Detection of Shiga toxin-producing Escherichia coli (STEC) in beef products using droplet digital PCR. Int. J. Food Microbiol. 2020, 319, 108499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Pinheiro, L.B.; Coleman, V.A.; Hindson, C.M.; Herrmann, J.; Hindson, B.J.; Bhat, S.; Emslie, K.R. Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification. Anal. Chem. 2012, 84, 1003–1011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Li, H.; Bai, R.; Zhao, Z.; Tao, L.; Ma, M.; Ji, Z.; Jian, M.; Ding, Z.; Dai, X.; Bao, F.; et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. Biosci. Rep. 2018, 38, 20181170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Nyaruaba, R.; Mwaliko, C.; Kering, K.K.; Wei, H. Droplet digital PCR applications in the tuberculosis world. Tuberculosis 2019, 117, 85–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Gutiérrez-Aguirre, I.; Rački, N.; Dreo, T.; Ravnikar, M. Droplet digital PCR for absolute quantification of pathogens. Methods Mol. Biol. 2015, 1302, 331–347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Devonshire, A.S.; Honeyborne, I.; Gutteridge, A.; Whale, A.S.; Nixon, G.; Wilson, P.; Jones, G.; McHugh, T.D.; Foy, C.A.; Huggett, J.F. Highly Reproducible Absolute Quantification of Mycobacterium tuberculosis Complex by Digital PCR. Anal. Chem. 2015, 87, 3706–3713. [Google Scholar] [CrossRef] [Scilit]
  51. McCord, P.H. Using droplet digital PCR (ddPCR) to detect copy number variation in sugarcane, a high-level polyploid. Euphytica 2016, 209, 439–448. [Google Scholar] [CrossRef] [Scilit]
  52. Härmälä, S.K.; Butcher, R.; Roberts, C.H. Copy number variation analysis by droplet digital PCR. In Functional Genomics; Humana Press Inc.: New York, NY, USA, 2017; Volume 1654, pp. 135–149. [Google Scholar]
  53. Mazaika, E.; Homsy, J. Digital Droplet PCR: CNV Analysis and Other Applications. Curr. Protoc. Hum. Genet. 2014, 82, 7.24.1–7.24.13. [Google Scholar] [CrossRef] [Scilit]
  54. Taylor, S.C.; Laperriere, G.; Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: From variable nonsense to publication quality data. Sci. Rep. 2017, 7, 1–8. [Google Scholar] [CrossRef] [Scilit]
  55. Zmienko, A.; Samelak-Czajka, A.; Goralski, M.; Sobieszczuk-Nowicka, E.; Kozlowski, P.; Figlerowicz, M. Selection of Reference Genes for qPCR- and ddPCR-Based Analyses of Gene Expression in Senescing Barley Leaves. PLoS ONE 2015, 10, e0118226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Farrokh, C.; Jordan, K.; Auvray, F.; Glass, K.; Oppegaard, H.; Raynaud, S.; Thevenot, D.; Condron, R.; De Reu, K.; Govaris, A.; et al. Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. Int. J. Food Microbiol. 2013, 162, 190–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Brusa, V.; Aliverti, V.; Aliverti, F.; Ortega, E.E.; de la Torre, J.H.; Linares, L.H.; Sanz, M.E.; Etcheverría, A.I.; Padola, N.L.; Galli, L.; et al. Shiga toxin-producing Escherichia coli in beef retail markets from Argentina. Front. Cell. Infect. Microbiol. 2013, 2, 171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Valones, M.A.A.; Guimarães, R.L.; Brandão, L.A.C.; De Souza, P.R.E.; De Albuquerque Tavares Carvalho, A.; Crovela, S. Principles and applications of polymerase chain reaction in medical diagnostic fields: A review. Braz. J. Microbiol. 2009, 40, 1–11. [Google Scholar] [CrossRef] [Scilit]
Table 1. List of bacteria selected for the analyses of specificity and exclusiveness.
Table 1. List of bacteria selected for the analyses of specificity and exclusiveness.
BacteriaCode (ATCC) *
Salmonella enterica Enteritidis13076
Salmonella enterica Typhimurium14028
Campylobacter coli43478
Campylobacter jejuni33291
Escherichia coli25922
Bacillus cereus11778
Pseudomonas aeruginosa27853
Shigella sonnei25931
Staphylococcus aureus25923
Yersinia enterocolitica9610
* American Type Culture Collection. After incubation at 37 °C for different times, all the samples were subjected to a DNA extraction process.
Table 2. Sequences of primers and probes used in Real-Time PCR and digital droplet PCR.
Table 2. Sequences of primers and probes used in Real-Time PCR and digital droplet PCR.
Primer NameSequence
STX1 (Fw)TTTGTYACTGTSACAGCWGAAGCYTTACG
STX1 (Rev)CCCCAGTTCARWGTRAGRTCMACRTC
STX1 (Probe)FAM 1—CTGGATGATCTCAGTGGGCGTTCTTATGTAA—TAMRA 2
STX2 (Fw)TTTGTYACTGTSACAGCWGAAGCYTTACG
STX2 (Rev)CCCCAGTTCARWGTRAGRTCMACRTC
STX2 (Probe)FAM—TCGTCAGGCACTGTCTGAAACTGCTCC—BHQ 3
eae (Fw)CATTGATCAGGATTTTTCTGGTGATA
eae (Rev)CTCATGCGGAAATAGCCGTTA
eae (Probe)FAM—ATAGTCTCGCCAGTATTCGCCACCAATACC—TAMRA
Notes: 1 FAM: 6-Carboxyfluorescein; 2 TAMRA: 5-Carboxytetramethylrhodamine; 3 BBQ: black hole quencher.
Table 3. Number of copies/μL detected by droplet digital PCR in sponges artificially contaminated with different concentrations of E. coli O157:H7 (150, 15, and 1.5 CFU/mL) and incubated at 37 °C for different times.
Table 3. Number of copies/μL detected by droplet digital PCR in sponges artificially contaminated with different concentrations of E. coli O157:H7 (150, 15, and 1.5 CFU/mL) and incubated at 37 °C for different times.
150 CFU 15 CFU1.5 CFU
Incubation Time (h)stx1stx2eaestx1stx2eaestx1stx2eae
T6000000000
T71.134.100.230.12000
T894862481713.4252.33.68
T91159898238014719945539.732.652.9
T10no call 1no callno call1382155340503923921180
T11no callno callno callno callno callno call391026405900
T12no callno callno callno callno callno callno callno callno call
Notes: 1 no call: saturation condition.
Table 4. Number of copies/μL detected by droplet digital PCR in different dilutions prepared from sponges artificially contaminated with different concentrations of E. coli O157:H7 (150, 15, and 1.5 CFU/mL) and incubated at 37 °C for 24 h.
Table 4. Number of copies/μL detected by droplet digital PCR in different dilutions prepared from sponges artificially contaminated with different concentrations of E. coli O157:H7 (150, 15, and 1.5 CFU/mL) and incubated at 37 °C for 24 h.
150 CFU15 CFU1.5 CFU
Incubation Time (h)—(Dilution)stx1stx2eaestx1stx2eaestx1stx2eae
24—(-1)no call 1no callno callno callno callno callno callno callno call
24—(-2)248024052580225019981789360036104005
24—(-3)250239250220198185358364392
24—(-4)26.424.22721.820.319.736.33738.3
24—(-5)2.22.52.37.35.16.510.49.89.2
24—(-6)0.70.91.20001.20.70.9
24—(-7)000000000
24—(-8)000000000
24—(-9)000000000
Notes: 1 no call: saturation condition.
Table 5. Number of copies/μL detected by droplet digital PCR in sponges used for the microbiological control of carcasses of cattle slaughtered in various areas of the Campania region. All sponges were incubated at 37 °C for 9 h.
Table 5. Number of copies/μL detected by droplet digital PCR in sponges used for the microbiological control of carcasses of cattle slaughtered in various areas of the Campania region. All sponges were incubated at 37 °C for 9 h.
Samplesstx1stx2eae
Sponge 47803.4
Sponge 5313.26.3
Sponge 60380.37
Sponge 808.8139
Sponge 120.2609
Sponge 130.4600.12
Sponge 24091.258.9
Sponge 271509.7
Sponge 297908.3
Sponge 30305.9
Sponge 310.230.9812.9
Sponge 32014.24.7
Sponge 35019.833.2
Sponge 3671.4035
Sponge 4025.5085.4
Sponge 4145.9043.1
Sponge 42048.867.2
Sponge 43065.998.1
Sponge 44075.158.1
Sponge 45054.165.3
Sponge 490.500.53
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mancusi, A.; Fulgione, A.; Girardi, S.; Di Maro, O.; Capuano, F.; Proroga, Y.T.R.; Cristiano, D. Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC). Appl. Sci. 2022, 12, 3654. https://doi.org/10.3390/app12073654

AMA Style

Mancusi A, Fulgione A, Girardi S, Di Maro O, Capuano F, Proroga YTR, Cristiano D. Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC). Applied Sciences. 2022; 12(7):3654. https://doi.org/10.3390/app12073654

Chicago/Turabian Style

Mancusi, Andrea, Andrea Fulgione, Santa Girardi, Orlandina Di Maro, Federico Capuano, Yolande T. R. Proroga, and Daniela Cristiano. 2022. "Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC)" Applied Sciences 12, no. 7: 3654. https://doi.org/10.3390/app12073654

APA Style

Mancusi, A., Fulgione, A., Girardi, S., Di Maro, O., Capuano, F., Proroga, Y. T. R., & Cristiano, D. (2022). Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC). Applied Sciences, 12(7), 3654. https://doi.org/10.3390/app12073654

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop