Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC)
Abstract
1. Introduction
2. Materials and Methods
2.1. Escherichia coli O157 and Experimental Infection of Sponges
2.2. In Vivo Analysis
2.3. DNA Extraction
2.4. Droplet Digital PCR
2.5. Real-Time PCR
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Duffy, G.; Burgess, C.M.; Bolton, D.J. A review of factors that affect transmission and survival of verocytotoxigenic Escherichia coli in the European farm to fork beef chain. Meat Sci. 2014, 97, 375–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Food, E.; Authority, S. The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, 5926. [Google Scholar] [CrossRef] [Scilit]
- Caprioli, A.; Morabito, S.; Brugère, H.; Oswald, E. Enterohaemorrhagic Escherichia coli: Emerging issues on virulence and modes of transmission. Vet. Res. 2005, 36, 289–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, J.L.; Fratamico, P.M.; Gunther, N.W. Shiga toxin-producing Escherichia coli. Adv. Appl. Microbiol. 2014, 86, 145–197. [Google Scholar] [PubMed]
- Etcheverría, A.I.; Padola, N.L. Shiga toxin-producing Escherichia coli: Factors involved in virulence and cattle colonization. Virulence 2013, 4, 366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaper, J.B. The Locus of Enterocyte Effacement Pathogenicity Island of Shiga Toxin-Producing Escherichia coli O157: H7 and Other Attaching and Effacing E. coli. Jpn. J. Med. Sci. Biol. 1998, 51, S101–S107. [Google Scholar] [CrossRef] [Scilit]
- Bai, X.; Wang, H.; Xin, Y.; Wei, R.; Tang, X.; Zhao, A.; Sun, H.; Zhang, W.; Wang, Y.; Xu, Y.; et al. Prevalence and characteristics of Shiga toxin-producing Escherichia coli isolated from retail raw meats in China. Int. J. Food Microbiol. 2015, 200, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Karmali, M.A.; Mascarenhas, M.; Shen, S.; Ziebell, K.; Johnson, S.; Reid-Smith, R.; Isaac-Renton, J.; Clark, C.; Rahn, K.; Kaper, J.B. Association of Genomic O Island 122 of Escherichia coli EDL 933 with Verocytotoxin-Producing Escherichia coli Seropathotypes That Are Linked to Epidemic and/or Serious Disease. J. Clin. Microbiol. 2003, 41, 4930–4940. [Google Scholar] [CrossRef] [Scilit]
- Amézquita-López, B.A.; Soto-Beltrán, M.; Lee, B.G.; Yambao, J.C.; Quiñones, B. Isolation, genotyping and antimicrobial resistance of Shiga toxin-producing Escherichia coli. J. Microbiol. Immunol. Infect. 2018, 51, 425–434. [Google Scholar] [CrossRef] [Scilit]
- Griffin, P.M.; Tauxe, R.V. The epidemiology of infections caused by Escherichia coli o157: H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 1991, 13, 60–98. [Google Scholar] [CrossRef] [Scilit]
- Mead, P.S.; Griffin, P.M. Escherichia coli O157:H7. Lancet 1998, 352, 1207–1212. [Google Scholar] [CrossRef] [Scilit]
- Elder, R.O. From the Cover: Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proc. Natl. Acad. Sci. USA 2000, 97, 2999–3003. [Google Scholar] [CrossRef] [PubMed]
- Edwards, J.R.; Fung, D.Y.C. Prevention and Decontamination of Escherichia coli O157:H7 on Raw Beef Carcasses in Commercial Beef Abattoirs. J. Rapid Methods Autom. Microbiol. 2006, 14, 1–95. [Google Scholar] [CrossRef] [Scilit]
- Rangel, J.M.; Sparling, P.H.; Crowe, C.; Griffin, P.M.; Swerdlow, D.L. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002. Emerg. Infect. Dis. 2005, 11, 603–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conedera, G.; Dalvit, P.; Martini, M.; Galiero, G.; Gramaglia, M.; Goffredo, E.; Loffredo, G.; Morabito, S.; Ottaviani, D.; Paterlini, F.; et al. Verocytotoxin-producing Escherichia coli O157 in minced beef and dairy products in Italy. Int. J. Food Microbiol. 2004, 96, 67–73. [Google Scholar] [CrossRef]
- Dambrosio, A.; Lorusso, V.; Quaglia, N.C.; Parisi, A.; La Salandra, G.; Virgilio, S.; Mula, G.; Lucifora, G.; Celano, G.V.; Normanno, G. Escherichia coli O26 in minced beef: Prevalence, characterization and antimicrobial resistance pattern. Int. J. Food Microbiol. 2007, 118, 218–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stampi, S.; Caprioli, A.; De Luca, G.; Quaglio, P.; Sacchetti, R.; Zanetti, F. Detection of Escherichia coli O157 in bovine meat products in northern Italy. Int. J. Food Microbiol. 2004, 90, 257–262. [Google Scholar] [CrossRef] [Scilit]
- Commission Regulation (EC). No. 2073/2005 on Microbiological Criteria for Foodstuffs. Available online: https://www.ecolex.org/details/legislation/commission-regulation-ec-no-20732005-on-microbiological-criteria-for-foodstuffs-lex-faoc061603/ (accessed on 20 March 2020).
- Commission Regulation (EC). No. 1441/2007 Amending Regulation (EC) No. 2073/2005 on Microbiological Criteria for Foodstuffs. Available online: https://www.ecolex.org/details/legislation/commission-regulation-ec-no-14412007-amending-regulation-ec-no-20732005-on-microbiological-criteria-for-foodstuffs-lex-faoc075857/ (accessed on 12 September 2020).
- Parsons, B.D.; Zelyas, N.; Berenger, B.M.; Chui, L. Detection, characterization, and typing of shiga toxin-producing Escherichia coli. Front. Microbiol. 2016, 7, 478. [Google Scholar] [CrossRef] [Scilit]
- Deisingh, A.K.; Thompson, M. Strategies for the detection of Escherichia coli O157:H7 in foods. J. Appl. Microbiol. 2004, 96, 419–429. [Google Scholar] [CrossRef] [Scilit]
- March, S.B.; Ratnam, S. Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. J. Clin. Microbiol. 1986, 23, 869–872. [Google Scholar] [CrossRef] [Scilit]
- Koutsoumanis, K.; Allende, A.; Alvarez-Ordóñez, A.; Bover-Cid, S.; Chemaly, M.; Davies, R.; De Cesare, A.; Herman, L.; Hilbert, F.; Lindqvist, R.; et al. Pathogenicity assessment of Shiga toxin-producing Escherichia coli (STEC) and the public health risk posed by contamination of food with STEC. EFSA J. 2020, 18, 5967. [Google Scholar] [CrossRef] [Scilit]
- Verhaegen, B.; De Reu, K.; Heyndrickx, M.; De Zutter, L. Comparison of Six Chromogenic Agar Media for the Isolation of a Broad Variety of Non-O157 Shigatoxin-Producing Escherichia coli (STEC) Serogroups. Int. J. Environ. Res. Public Health 2015, 12, 6965–6978. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, B.; Chen, J.Q. Real-time PCR methodology for selective detection of viable Escherichia coli O157: H7CELLS by targeting Z3276 as a genetic marker. Appl. Environ. Microbiol. 2012, 78, 5297–5304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cebula, T.A.; Payne, W.L.; Feng, P. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 1995, 33, 248–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fratamico, P.M.; DebRoy, C.; Liu, Y.; Needleman, D.S.; Baranzoni, G.M.; Feng, P. Advances in Molecular Serotyping and Subtyping of Escherichia coli. Front. Microbiol. 2016, 7, 644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jackson, S.A.; Kotewicz, M.L.; Patel, I.R.; Lacher, D.W.; Gangiredla, J.; Elkins, C.A. Rapid genomic-scale analysis of Escherichia coli O 104: H4 by using high-resolution alternative methods to next-generation sequencing. Appl. Environ. Microbiol. 2012, 78, 1601–1605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, I.R.; Gangiredla, J.; Lacher, D.W.; Mammel, M.K.; Jackson, S.A.; Lampel, K.A.; Elkins, C.A. FDA Escherichia coli Identification (FDA-ECID) microarray: A pangenome molecular toolbox for serotyping, virulence profiling, molecular epidemiology, and phylogeny. Appl. Environ. Microbiol. 2016, 82, 3384–3394. [Google Scholar] [CrossRef] [Scilit]
- Lindsey, R.L.; Pouseele, H.; Chen, J.C.; Strockbine, N.A.; Carleton, H.A. Implementation of Whole Genome Sequencing (WGS) for Identification and Characterization of Shiga Toxin-Producing Escherichia coli (STEC) in the United States. Front. Microbiol. 2016, 7, 766. [Google Scholar] [CrossRef] [Scilit]
- Leonard, S.R.; Mammel, M.K.; Lacher, D.W.; Elkins, C.A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS ONE 2016, 11, e0167870. [Google Scholar] [CrossRef] [Scilit]
- Jinneman, K.C.; Yoshitomi, K.J.; Weagant, S.D. Multiplex Real-Time PCR Method To Identify Shiga Toxin Genes stx1 and stx2 and Escherichia coli O157:H7/H- Serotype. Appl. Environ. Microbiol. 2003, 69, 6327–6333. [Google Scholar] [CrossRef] [Scilit]
- Elizaquível, P.; Aznar, R. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables. Food Microbiol. 2008, 25, 705–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CEN ISO/TS 13136:2012. Microbiology of Food and Animal Feed—Real-Time Polymerase Chain Reaction (PCR)-Based Method for the Detection of Food-Borne Pathogens—Horizontal Method for the Detection of Shiga Toxin-Producing Escherichia coli (STEC) and the Determination of O157, O111, O26, O103 and O145 Serogroups (ISO/TS 13136:2012). Available online: https://standards.iteh.ai/catalog/standards/cen/151dca9a-959e-4f23-b903-2735bc217e2f/cen-iso-ts-13136-2012 (accessed on 12 September 2020).
- Lawal, D.; Burgess, C.; McCabe, E.; Whyte, P.; Duffy, G. Development of a quantitative real time PCR assay to detect and enumerate Escherichia coli O157 and O26 serogroups in bovine recto-anal swabs. J. Microbiol. Methods 2015, 114, 9–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luedtke, B.E.; Bono, J.L.; Bosilevac, J.M. Evaluation of real time PCR assays for the detection and enumeration of enterohemorrhagic Escherichia coli directly from cattle feces. J. Microbiol. Methods 2014, 105, 72–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noll, L.W.; Shridhar, P.B.; Shi, X.; An, B.; Cernicchiaro, N.; Renter, D.G.; Nagaraja, T.G.; Bai, J. A Four-Plex Real-Time PCR Assay, Based on rfbE, stx1, stx2, and eae Genes, for the Detection and Quantification of Shiga Toxin-Producing Escherichia coli O157 in Cattle Feces. Foodborne Pathog. Dis. 2015, 12, 787–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, W.; Gyawali, P.; Toze, S. Quantitative PCR measurements of Escherichia coli including shiga toxin-producing E. coli (STEC) in animal feces and environmental waters. Environ. Sci. Technol. 2015, 49, 3084–3090. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Nolan, T. Pitfalls of quantitative real- time reverse-transcription polymerase chain reaction. J. Biomol. Tech. 2004, 15, 155–166. [Google Scholar]
- Day, E.; Dear, P.H.; McCaughan, F. Digital PCR strategies in the development and analysis of molecular biomarkers for personalized medicine. Methods 2013, 59, 101–107. [Google Scholar] [CrossRef] [Scilit]
- Hall Sedlak, R.; Jerome, K.R. The potential advantages of digital PCR for clinical virology diagnostics. Expert Rev. Mol. Diagn. 2014, 14, 501–507. [Google Scholar] [CrossRef] [Scilit]
- Hindson, C.M.; Chevillet, J.R.; Briggs, H.A.; Gallichotte, E.N.; Ruf, I.K.; Hindson, B.J.; Vessella, R.L.; Tewari, M. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat. Methods 2013, 10, 1003–1005. [Google Scholar] [CrossRef] [Scilit]
- Dingle, T.C.; Sedlak, R.H.; Cook, L.; Jerome, K.R. Tolerance of Droplet-Digital PCR vs. Real-Time Quantitative PCR to Inhibitory Substances. Clin. Chem. 2013, 59, 1670–1672. [Google Scholar] [CrossRef] [Scilit]
- Bhat, S.; Curach, N.; Mostyn, T.; Bains, G.S.; Griffiths, K.R.; Emslie, K.R. Comparison of methods for accurate quantification of DNA mass concentration with traceability to the international system of units. Anal. Chem. 2010, 82, 7185–7192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Capobianco, J.A.; Clark, M.; Cariou, A.; Leveau, A.; Pierre, S.; Fratamico, P.; Strobaugh, T.P.; Armstrong, C.M. Detection of Shiga toxin-producing Escherichia coli (STEC) in beef products using droplet digital PCR. Int. J. Food Microbiol. 2020, 319, 108499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pinheiro, L.B.; Coleman, V.A.; Hindson, C.M.; Herrmann, J.; Hindson, B.J.; Bhat, S.; Emslie, K.R. Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification. Anal. Chem. 2012, 84, 1003–1011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Bai, R.; Zhao, Z.; Tao, L.; Ma, M.; Ji, Z.; Jian, M.; Ding, Z.; Dai, X.; Bao, F.; et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. Biosci. Rep. 2018, 38, 20181170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nyaruaba, R.; Mwaliko, C.; Kering, K.K.; Wei, H. Droplet digital PCR applications in the tuberculosis world. Tuberculosis 2019, 117, 85–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gutiérrez-Aguirre, I.; Rački, N.; Dreo, T.; Ravnikar, M. Droplet digital PCR for absolute quantification of pathogens. Methods Mol. Biol. 2015, 1302, 331–347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Devonshire, A.S.; Honeyborne, I.; Gutteridge, A.; Whale, A.S.; Nixon, G.; Wilson, P.; Jones, G.; McHugh, T.D.; Foy, C.A.; Huggett, J.F. Highly Reproducible Absolute Quantification of Mycobacterium tuberculosis Complex by Digital PCR. Anal. Chem. 2015, 87, 3706–3713. [Google Scholar] [CrossRef] [Scilit]
- McCord, P.H. Using droplet digital PCR (ddPCR) to detect copy number variation in sugarcane, a high-level polyploid. Euphytica 2016, 209, 439–448. [Google Scholar] [CrossRef] [Scilit]
- Härmälä, S.K.; Butcher, R.; Roberts, C.H. Copy number variation analysis by droplet digital PCR. In Functional Genomics; Humana Press Inc.: New York, NY, USA, 2017; Volume 1654, pp. 135–149. [Google Scholar]
- Mazaika, E.; Homsy, J. Digital Droplet PCR: CNV Analysis and Other Applications. Curr. Protoc. Hum. Genet. 2014, 82, 7.24.1–7.24.13. [Google Scholar] [CrossRef] [Scilit]
- Taylor, S.C.; Laperriere, G.; Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: From variable nonsense to publication quality data. Sci. Rep. 2017, 7, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Zmienko, A.; Samelak-Czajka, A.; Goralski, M.; Sobieszczuk-Nowicka, E.; Kozlowski, P.; Figlerowicz, M. Selection of Reference Genes for qPCR- and ddPCR-Based Analyses of Gene Expression in Senescing Barley Leaves. PLoS ONE 2015, 10, e0118226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farrokh, C.; Jordan, K.; Auvray, F.; Glass, K.; Oppegaard, H.; Raynaud, S.; Thevenot, D.; Condron, R.; De Reu, K.; Govaris, A.; et al. Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. Int. J. Food Microbiol. 2013, 162, 190–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brusa, V.; Aliverti, V.; Aliverti, F.; Ortega, E.E.; de la Torre, J.H.; Linares, L.H.; Sanz, M.E.; Etcheverría, A.I.; Padola, N.L.; Galli, L.; et al. Shiga toxin-producing Escherichia coli in beef retail markets from Argentina. Front. Cell. Infect. Microbiol. 2013, 2, 171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valones, M.A.A.; Guimarães, R.L.; Brandão, L.A.C.; De Souza, P.R.E.; De Albuquerque Tavares Carvalho, A.; Crovela, S. Principles and applications of polymerase chain reaction in medical diagnostic fields: A review. Braz. J. Microbiol. 2009, 40, 1–11. [Google Scholar] [CrossRef] [Scilit]
| Bacteria | Code (ATCC) * |
|---|---|
| Salmonella enterica Enteritidis | 13076 |
| Salmonella enterica Typhimurium | 14028 |
| Campylobacter coli | 43478 |
| Campylobacter jejuni | 33291 |
| Escherichia coli | 25922 |
| Bacillus cereus | 11778 |
| Pseudomonas aeruginosa | 27853 |
| Shigella sonnei | 25931 |
| Staphylococcus aureus | 25923 |
| Yersinia enterocolitica | 9610 |
| Primer Name | Sequence |
|---|---|
| STX1 (Fw) | TTTGTYACTGTSACAGCWGAAGCYTTACG |
| STX1 (Rev) | CCCCAGTTCARWGTRAGRTCMACRTC |
| STX1 (Probe) | FAM 1—CTGGATGATCTCAGTGGGCGTTCTTATGTAA—TAMRA 2 |
| STX2 (Fw) | TTTGTYACTGTSACAGCWGAAGCYTTACG |
| STX2 (Rev) | CCCCAGTTCARWGTRAGRTCMACRTC |
| STX2 (Probe) | FAM—TCGTCAGGCACTGTCTGAAACTGCTCC—BHQ 3 |
| eae (Fw) | CATTGATCAGGATTTTTCTGGTGATA |
| eae (Rev) | CTCATGCGGAAATAGCCGTTA |
| eae (Probe) | FAM—ATAGTCTCGCCAGTATTCGCCACCAATACC—TAMRA |
| 150 CFU | 15 CFU | 1.5 CFU | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Incubation Time (h) | stx1 | stx2 | eae | stx1 | stx2 | eae | stx1 | stx2 | eae |
| T6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| T7 | 1.1 | 3 | 4.1 | 0 | 0.23 | 0.12 | 0 | 0 | 0 |
| T8 | 94 | 86 | 248 | 17 | 13.4 | 25 | 2.3 | 3.6 | 8 |
| T9 | 1159 | 898 | 2380 | 147 | 199 | 455 | 39.7 | 32.6 | 52.9 |
| T10 | no call 1 | no call | no call | 1382 | 1553 | 4050 | 392 | 392 | 1180 |
| T11 | no call | no call | no call | no call | no call | no call | 3910 | 2640 | 5900 |
| T12 | no call | no call | no call | no call | no call | no call | no call | no call | no call |
| 150 CFU | 15 CFU | 1.5 CFU | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Incubation Time (h)—(Dilution) | stx1 | stx2 | eae | stx1 | stx2 | eae | stx1 | stx2 | eae |
| 24—(-1) | no call 1 | no call | no call | no call | no call | no call | no call | no call | no call |
| 24—(-2) | 2480 | 2405 | 2580 | 2250 | 1998 | 1789 | 3600 | 3610 | 4005 |
| 24—(-3) | 250 | 239 | 250 | 220 | 198 | 185 | 358 | 364 | 392 |
| 24—(-4) | 26.4 | 24.2 | 27 | 21.8 | 20.3 | 19.7 | 36.3 | 37 | 38.3 |
| 24—(-5) | 2.2 | 2.5 | 2.3 | 7.3 | 5.1 | 6.5 | 10.4 | 9.8 | 9.2 |
| 24—(-6) | 0.7 | 0.9 | 1.2 | 0 | 0 | 0 | 1.2 | 0.7 | 0.9 |
| 24—(-7) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 24—(-8) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 24—(-9) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Samples | stx1 | stx2 | eae |
|---|---|---|---|
| Sponge 4 | 78 | 0 | 3.4 |
| Sponge 5 | 3 | 13.2 | 6.3 |
| Sponge 6 | 0 | 38 | 0.37 |
| Sponge 8 | 0 | 8.8 | 139 |
| Sponge 12 | 0.26 | 0 | 9 |
| Sponge 13 | 0.46 | 0 | 0.12 |
| Sponge 24 | 0 | 91.2 | 58.9 |
| Sponge 27 | 15 | 0 | 9.7 |
| Sponge 29 | 79 | 0 | 8.3 |
| Sponge 30 | 3 | 0 | 5.9 |
| Sponge 31 | 0.23 | 0.98 | 12.9 |
| Sponge 32 | 0 | 14.2 | 4.7 |
| Sponge 35 | 0 | 19.8 | 33.2 |
| Sponge 36 | 71.4 | 0 | 35 |
| Sponge 40 | 25.5 | 0 | 85.4 |
| Sponge 41 | 45.9 | 0 | 43.1 |
| Sponge 42 | 0 | 48.8 | 67.2 |
| Sponge 43 | 0 | 65.9 | 98.1 |
| Sponge 44 | 0 | 75.1 | 58.1 |
| Sponge 45 | 0 | 54.1 | 65.3 |
| Sponge 49 | 0.5 | 0 | 0.53 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mancusi, A.; Fulgione, A.; Girardi, S.; Di Maro, O.; Capuano, F.; Proroga, Y.T.R.; Cristiano, D. Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC). Appl. Sci. 2022, 12, 3654. https://doi.org/10.3390/app12073654
Mancusi A, Fulgione A, Girardi S, Di Maro O, Capuano F, Proroga YTR, Cristiano D. Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC). Applied Sciences. 2022; 12(7):3654. https://doi.org/10.3390/app12073654
Chicago/Turabian StyleMancusi, Andrea, Andrea Fulgione, Santa Girardi, Orlandina Di Maro, Federico Capuano, Yolande T. R. Proroga, and Daniela Cristiano. 2022. "Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC)" Applied Sciences 12, no. 7: 3654. https://doi.org/10.3390/app12073654
APA StyleMancusi, A., Fulgione, A., Girardi, S., Di Maro, O., Capuano, F., Proroga, Y. T. R., & Cristiano, D. (2022). Droplet Digital PCR (ddPCR) Analysis for Detecting Shiga-Toxin-Producing Escherichia coli (STEC). Applied Sciences, 12(7), 3654. https://doi.org/10.3390/app12073654

