Development and Evaluation of the Cotton Leaf Curl Kokhran Virus-Burewala Bidirectional Promoter for Enhanced Cry1Ac Endotoxin Expression in Bt Transgenic Cotton
Abstract
:1. Introduction
2. Materials and Methods
2.1. Biological Materials
2.2. Isolation and DNA Sequence Analysis of CLCuKoV-Bu LIR Region
2.3. Construction of Agrobacterium Expression Vectors
2.4. Transient Expression of Cry1Ac
2.5. Agrobacterium-Mediated Transformation in Cotton
2.6. Molecular Analysis of Transgenic Cotton Plants
2.7. Statistical Analysis
3. Results
3.1. Construction of Plasmids Containing Single (Cry1Ac) Gene Constructs
3.2. Transient Expression of Cry1Ac Gene
3.3. Transformation of Single Gene Construct in G. hirsutum
3.4. Molecular Analysis of Putative Cotton Plants
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Razzaq, A.; Zafar, M.M.; Ali, A.; Hafeez, A.; Batool, W.; Shi, Y.; Gong, W.; Yuan, Y. Cotton germplasm improvement and progress in Pakistan. J. Cotton Res. 2021, 4, 1–14. [Google Scholar] [CrossRef]
- Babar, U.; Nawaz, M.A.; Arshad, U.; Azhar, M.T.; Atif, R.M.; Golokhvast, K.S.; Tsatsakis, A.M.; Shcerbakova, K.; Chung, G.; Rana, I.A. Transgenic crops for the agricultural improvement in Pakistan: A perspective of environmental stresses and the current status of genetically modified crops. GM Crops Food 2020, 11, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Tarazi, R.; Jimenez, J.L.S.; Vaslin, M.F. Biotechnological solutions for major cotton (Gossypium hirsutum) pathogens and pests. Biotechnol. Res. Innov. 2019, 3, 19–26. [Google Scholar] [CrossRef]
- Bravo, A.; Likitvivatanavong, S.; Gill, S.S.; Soberón, M. Bacillus thuringiensis: A story of a successful bioinsecticide. Insect Biochem. Mol. Biol. 2011, 41, 423–431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pigott, C.R.; Ellar, D.J. Role of receptors in Bacillus thuringiensis crystal toxin activity. Microbiol. Mol. Biol. Rev. 2007, 71, 255–281. [Google Scholar] [CrossRef] [Green Version]
- Rahman, M.; Zaman, M.; Shaheen, T.; Irem, S.; Zafar, Y. Safe use of Cry genes in genetically modified crops. Environ. Chem. Lett. 2015, 13, 239–249. [Google Scholar] [CrossRef]
- Sanchis, V.; Bourguet, D. Bacillus thuringiensis: Applications in agriculture and insect resistance management. A review. Agron. Sustain. Dev. 2008, 28, 11–20. [Google Scholar] [CrossRef] [Green Version]
- Jamil, S.; Shahzad, R.; Rahman, S.U.; Iqbal, M.Z.; Yaseen, M.; Ahmad, S.; Fatima, R. The level of Cry1Ac endotoxin and its efficacy against H. armigera in Bt cotton at large scale in Pakistan. GM Crops Food 2021, 12, 1–17. [Google Scholar] [CrossRef]
- Adamczyk, J.J.; Perera, O.; Meredith, W.R. Production of mRNA from the Cry1Ac transgene differs among Bollgard® lines which correlates to the level of subsequent protein. Transgenic Res. 2009, 18, 143–149. [Google Scholar] [CrossRef]
- Bakhsh, A.; Siddique, S.; Husnain, T. A molecular approach to combat spatio-temporal variation in insecticidal gene (Cry1Ac) expression in cotton. Euphytica 2012, 183, 65–74. [Google Scholar] [CrossRef]
- Borah, B.; Zarreen, F.; Baruah, G.; Dasgupta, I. Insights into the control of geminiviral promoters. Virology 2016, 495, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Khan, Z.A.; Khan, J.A. Geminivirus promoters: A breakthrough in transgenic research. In Geminivirus: Detection, Diagnosis and Management; Elsevier: Amsterdam, The Netherlands, 2022; pp. 357–366. [Google Scholar]
- Baltes, N.J.; Gil-Humanes, J.; Cermak, T.; Atkins, P.A.; Voytas, D.F. DNA replicons for plant genome engineering. Plant Cell 2014, 26, 151–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lozano Durán, R. Geminiviruses for biotechnology: The art of parasite taming. New Phytol. 2016, 210, 58–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Butler, N.M.; Baltes, N.J.; Voytas, D.F.; Douches, D.S. Geminivirus-mediated genome editing in potato (Solanum tuberosum L.) using sequence-specific nucleases. Front. Plant Sci. 2016, 7, 1045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, M.; Lu, Y.; Botella, J.R.; Mao, Y.; Hua, K.; Zhu, J.-K. Gene targeting by homology-directed repair in rice using a geminivirus-based CRISPR/Cas9 system. Mol. Plant 2017, 10, 1007–1010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vu, T.V.; Sivankalyani, V.; Kim, E.J.; Doan, D.T.H.; Tran, M.T.; Kim, J.; Sung, Y.W.; Park, M.; Kang, Y.J.; Kim, J.Y. Highly efficient homology-directed repair using CRISPR/Cpf1-geminiviral replicon in tomato. Plant Biotechnol. J. 2020, 18, 2133–2143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Pater, S.; Klemann, B.J.; Hooykaas, P.J. True gene-targeting events by CRISPR/Cas-induced DSB repair of the PPO locus with an ectopically integrated repair template. Sci. Rep. 2018, 8, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashraf, M.A.; Shahid, A.A.; Rao, A.Q.; Bajwa, K.S.; Husnain, T. Functional characterization of a bidirectional plant promoter from cotton leaf curl Burewala virus using an Agrobacterium-mediated transient assay. Viruses 2014, 6, 223–242. [Google Scholar] [CrossRef]
- Khan, Z.A.; Abdin, M.Z.; Khan, J.A. Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus. PLoS ONE 2015, 10, E0121656. [Google Scholar] [CrossRef]
- Chakraborty, J.; Sen, S.; Ghosh, P.; Sengupta, A.; Basu, D.; Das, S. Homologous promoter derived constitutive and chloroplast targeted expression of synthetic cry1Ac in transgenic chickpea confers resistance against Helicoverpa armigera. Plant Cell Tissue Organ Cult. 2016, 125, 521–535. [Google Scholar] [CrossRef]
- Bakhsh, A.; Anayol, E.; Khabbazi, S.D.; Karakoç, Ö.C.; Sancak, C.; Özcan, S. Development of insect-resistant cotton lines with targeted expression of insecticidal gene. Arch. Biol. Sci. 2016, 68, 773–780. [Google Scholar] [CrossRef] [Green Version]
- Khabbazi, S.D.; Khabbazi, A.D.; Özcan, S.F.; Bakhsh, A.; Başalma, D.; Özcan, S. Expression of GNA and biting site-restricted cry1Ac in cotton; an efficient attribution to insect pest management strategies. Plant Biotechnol. Rep. 2018, 12, 273–282. [Google Scholar] [CrossRef]
- Hazarika, N.; Acharjee, S.; Boruah, R.R.; Babar, K.; Parimi, S.; Char, B.; Armstrong, J.; Moore, A.; Higgins, T.J.; Sarmah, B.K. Enhanced expression of Arabidopsis rubisco small subunit gene promoter regulated Cry1Ac gene in chickpea conferred complete resistance to Helicoverpa armigera. J. Plant Biochem. Biotechnol. 2021, 30, 243–253. [Google Scholar] [CrossRef]
- Ganguly, S.; Purohit, A.; Ghosh, S.; Chaudhuri, R.K.; Das, S.; Chakraborti, D. Clean gene technology to develop selectable marker-free pod borer-resistant transgenic pigeon pea events involving the constitutive expression of Cry1Ac. Appl. Microbiol. Biotechnol. 2022, 106, 3051–3067. [Google Scholar] [CrossRef]
- Qamar, Z.; Nasir, I.A.; Abouhaidar, M.G.; Hefferon, K.L.; Rao, A.Q.; Latif, A.; Ali, Q.; Anwar, S.; Rashid, B.; Shahid, A.A. Novel approaches to circumvent the devastating effects of pests on sugarcane. Sci. Rep. 2021, 11, 1–25. [Google Scholar]
- Hoekema, A.; Hirsch, P.R.; Hooykaas, P.J.; Schilperoort, R.A. A binary plant vector strategy based on separation of vir-and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 1983, 303, 179–180. [Google Scholar] [CrossRef]
- Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef]
- Ashraf, M.A.; Shahid, A.A.; Mohamed, B.B.; Dahab, A.A.; Bajwa, K.S.; Rao, A.Q.; Khan, M.A.U.; Ilyas, M.; Haider, M.S.; Husnain, T. Molecular characterization and phylogenetic analysis of a variant of highly infectious cotton leaf curl Burewala virus associated with CLCuD from Pakistan. Aust. J. Crop Sci. 2013, 7, 1113–1122. [Google Scholar]
- Maqbool, S.B.; Christou, P. Multiple traits of agronomic importance in transgenic indica rice plants: Analysis of transgene integration patterns, expression levels and stability. Mol. Breed. 1999, 5, 471–480. [Google Scholar] [CrossRef]
- Sardana, R.; Dukiandjiev, S.; Giband, M.; Cheng, X.; Cowan, K.; Sauder, C.; Altosaar, I. Construction and rapid testing of synthetic and modified toxin gene sequences CryIA (b&c) by expression in maize endosperm culture. Plant Cell Rep. 1996, 15, 677–681. [Google Scholar]
- Rashid, B.; Saleem, Z.; Husnain, T.; Riazuddin, S. Transformation and inheritance of Bt genes in Gossypium hirsutum. J. Plant Biol. 2008, 51, 248–254. [Google Scholar] [CrossRef]
- Leckie, B.M.; Neal Stewart, C. Agroinfiltration as a technique for rapid assays for evaluating candidate insect resistance transgenes in plants. Plant Cell Rep. 2011, 30, 325–334. [Google Scholar] [CrossRef] [PubMed]
- Kiani, S.; Ali, A.; Bajwa, K.S.; Muzaffar, A.; Ashraf, M.A.; Samiullah, T.R.; Shahid, A.A.; Husnain, T. Cloning and chloroplast-targeted expression studies of insect-resistant gene with ricin fusion-gene under chloroplast transit peptide in cotton. Electron. J. Biotechnol. 2013, 16, 13. [Google Scholar] [CrossRef]
- Gould, J.H.; Magallanes-Cedeno, M. Adaptation of cotton shoot apex culture to Agrobacterium-mediated transformation. Plant Mol. Biol. Report. 1998, 16, 283. [Google Scholar] [CrossRef] [Green Version]
- Saha, S.; Callahan, F.; Dollar, D.; Creech, J. Lyophilization of cotton tissue on quality of extractable DNA, RNA, and protein. J. Cotton Sci. 1997, 1, 1–14. [Google Scholar]
- Zhang, J.; Stewart, J. Economical and rapid method for extracting cotton genomic DNA. J. Cotton Sci. 2000, 4, 193–201. [Google Scholar]
- Dutt, M.; Dhekney, S.A.; Soriano, L.; Kandel, R.; Grosser, J.W. Temporal and spatial control of gene expression in horticultural crops. Hortic. Res. 2014, 1, 14047. [Google Scholar] [CrossRef] [Green Version]
- Porto, M.S.; Pinheiro, M.P.N.; Batista, V.G.L.; Dos Santos, R.C.; De Albuquerque Melo Filho, P.; De Lima, L.M. Plant promoters: An approach of structure and function. Mol. Biotechnol. 2014, 56, 38–49. [Google Scholar] [CrossRef] [Green Version]
- Bak, A.; Emerson, J.B. Cauliflower mosaic virus (CaMV) biology, management, and relevance to GM plant detection for sustainable organic agriculture. Front. Sustain. Food Syst. 2020, 4, 21. [Google Scholar] [CrossRef]
- Amack, S.C.; Antunes, M.S. CaMV35S promoter–A plant biology and biotechnology workhorse in the era of synthetic biology. Curr. Plant Biol. 2020, 24, 100179. [Google Scholar] [CrossRef]
- Saidi, Y.; Schaefer, D.G.; Goloubinoff, P.; Zrÿd, J.-P.; Finka, A. The CaMV 35S promoter has a weak expression activity in dark grown tissues of moss Physcomitrella patens. Plant Signal. Behav. 2009, 4, 457–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gittins, J.R.; Pellny, T.K.; Hiles, E.R.; Rosa, C.; Biricolti, S.; James, D.J. Transgene expression driven by heterologous ribulose-1, 5-bisphosphate carboxylase/oxygenase small-subunit gene promoters in the vegetative tissues of apple (Malus pumila Mill.). Planta 2000, 210, 232–240. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Li, K.; Guo, Y.; Guo, J.; Miao, K.; Botella, J.R.; Song, C.-P.; Miao, Y. A transient transformation system for gene characterization in upland cotton (Gossypium hirsutum). Plant Methods 2018, 14, 1–11. [Google Scholar] [CrossRef]
- Naqvi, R.Z.; Asif, M.; Saeed, M.; Asad, S.; Khatoon, A.; Amin, I.; Mukhtar, Z.; Bashir, A.; Mansoor, S. Development of a triple gene Cry1Ac-Cry2Ab-EPSPS construct and its expression in Nicotiana benthamiana for insect resistance and herbicide tolerance in plants. Front. Plant Sci. 2017, 8, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaur, M.; Manchanda, P.; Kalia, A.; Ahmed, F.K.; Nepovimova, E.; Kuca, K.; Abd-Elsalam, K.A. Agroinfiltration mediated scalable transient gene expression in genome edited crop plants. Int. J. Mol. Sci. 2021, 22, 10882. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Pan, A.; Zhang, K.; Yin, C.; Qian, B.; Chen, J.; Huang, C.; Zhang, D. Qualitative and quantitative PCR methods for event-specific detection of genetically modified cotton Mon1445 and Mon531. Transgenic Res. 2005, 14, 817–831. [Google Scholar] [CrossRef] [PubMed]
- Asif, M.; Siddiqui, H.A.; Naqvi, R.Z.; Amin, I.; Asad, S.; Mukhtar, Z.; Bashir, A.; Mansoor, S. Development of event-specific detection method for identification of insect resistant NIBGE-1601 cotton harboring double gene Cry1Ac-Cry2Ab construct. Sci. Rep. 2021, 11, 1–9. [Google Scholar] [CrossRef]
- Guttikonda, S.K.; Marri, P.; Mammadov, J.; Ye, L.; Soe, K.; Richey, K.; Cruse, J.; Zhuang, M.; Gao, Z.; Evans, C. Molecular characterization of transgenic events using next generation sequencing approach. PLoS ONE 2016, 11, e0149515. [Google Scholar] [CrossRef]
- Fabrick, J.A.; Ponnuraj, J.; Singh, A.; Tanwar, R.K.; Unnithan, G.C.; Yelich, A.J.; Li, X.; Carrière, Y.; Tabashnik, B.E. Alternative splicing and highly variable cadherin transcripts associated with field-evolved resistance of pink bollworm to Bt cotton in India. PLoS ONE 2014, 9, e97900. [Google Scholar] [CrossRef]
- Wang, Q.; Zhu, Y.; Sun, L.; Li, L.; Jin, S.; Zhang, X. Transgenic Bt cotton driven by the green tissue-specific promoter shows strong toxicity to lepidopteran pests and lower Bt toxin accumulation in seeds. Sci. China Life Sci. 2016, 59, 172–182. [Google Scholar] [CrossRef]
Biological Materials | Relevant Features | Reference or Source |
---|---|---|
Bacterial Strains | ||
LBA4404 and GV1301 | Agrobacterium tumefaciens strain used for plant transformation | [27] |
DH5α | Escherichia coli strain used for cloning | [28] |
TOP10 | Escherichia coli-based cells used for cloning | Invitrogen |
CEMB-Cry1Ac | Bacillus thuringiensis δ-endotoxin gene Cry1Ac | CEMB Patent: (K140649-aroA) |
Viral Species | ||
CLCuKoV-Bu | Circular, single-stranded, DNA-A genome of the cotton leaf curl Kokhran virus-Burewala | [29] |
LIR | Large intergenic region of the CLCuKoV-genome possesses bidirectional promoter | This study |
CLCuKoV-BuC1 | C1 gene promoter of CLCuKoV-Bu genome | This study |
CLCuKoV-BuV1 | V1 gene promoter of CLCuKoV-Bu genome | This study |
Plasmids | ||
PIA2 | Source plasmid vector containing CaMV35S promoter and Cry1Ac-NOS expression cassette | [30,31] |
pCAMBIA1301 | binary vector used for cloning of gene expression cassettes (promoter +Cry1Ac-NOS) | This study |
PK2-Ac | Positive control plant expression vector containing CaMV35S promoter and Cry1Ac-NOS cassette | [32] |
CLCuKoVC1-Ac | 5′- CLCuKoVC1-Cry1Ac-NOS-3′ plasmid | This study |
CLCuKoVV1-Ac | 5′- CLCuKoVV1-Cry1Ac-NOS-3′ plasmid | This study |
pBluescript II KS/SK (+) | Cloning vector harboring CLCuKoV-Bu genome | [29] |
Plant Materials | ||
Nicotiana tabacum | Tobacco model plant used for agroinfiltration | This study |
Gossypium hirsutum | Cotton cultivar MNH-786 used for transformation | This study |
Genes/Constructs | Primer Name | Sequence (5′-----3′) | Product Size (bp) | Restriction Site |
---|---|---|---|---|
Cry1Ac-NOS | Cry-NOSF | CGGGTACCATGGACAACAACCCAAACATCAA | 2160 | KpnI |
Cry-NOSR | CGGGATCCGAATTCCCGATCTAGTAACATAG | BamHI | ||
CLCuKoV-Bu-C1 | CLCuVC1-F | GCGGTACCTGACTTTGGTCAATTAGAGACAAC | 455 | KpnI |
CLCuVC1-R | GCGGTACCTAATTCCTAGCCCTTATTACCAG | KpnI | ||
CLCuKoV-Bu-V1 | CLCuVV1-F | GCGGTACCTGACTTTGGTCAATTAGAGACAAC | 455 | KpnI |
CLCuVV1-R | GCGGTACCTAATTCCTAGCCCTTATTACCAG | KpnI | ||
LIR | IR-F | TGACTTTGGTCAATTAGAGACAAC | 455 | -- |
IR-R | TAATTCCTAGCCCTTATTACCAG | -- | ||
Cry1Acinternal | Cry-F | TCCTCTCTTGTCCGTGTA | 565 | -- |
Cry-R | CGTTTCCCATAGTTCCATA | --- | ||
CLCuKoV-BuC1-Cry1Ac-NOSorientation | C1Cry-F | GGATCGGGAATAATGGTCCT | 724 | --- |
CryC1-R | CGAACTCTTCGATCCTCTGG | --- | ||
CLCuKoV-V1-Cry1Ac-NOSorientation | V1Cry-F | CCGTTCACGGTTTTAGGTGTAT | 228 | --- |
CryV1-R | GTGTAACCGGTTTCAATGCGTT | --- |
Constructs | No. of Embryos | Survival % (3–4 Week) | Survival % (7–8 Week) | Plants in Soil | Transformation Efficiency (%) |
---|---|---|---|---|---|
CLCuV-Ac | 3000 | 375 | 190 | 14 | 0.46 |
PK2-Ac | 2000 | 125 | 70 | 7 | 0.35 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ashraf, M.A.; Shahid, A.A.; Rao, A.Q.; Brown, J.K.; Husnain, T. Development and Evaluation of the Cotton Leaf Curl Kokhran Virus-Burewala Bidirectional Promoter for Enhanced Cry1Ac Endotoxin Expression in Bt Transgenic Cotton. Appl. Sci. 2022, 12, 11275. https://doi.org/10.3390/app122111275
Ashraf MA, Shahid AA, Rao AQ, Brown JK, Husnain T. Development and Evaluation of the Cotton Leaf Curl Kokhran Virus-Burewala Bidirectional Promoter for Enhanced Cry1Ac Endotoxin Expression in Bt Transgenic Cotton. Applied Sciences. 2022; 12(21):11275. https://doi.org/10.3390/app122111275
Chicago/Turabian StyleAshraf, Muhammad Aleem, Ahmad Ali Shahid, Abdul Qayyum Rao, Judith K. Brown, and Tayyab Husnain. 2022. "Development and Evaluation of the Cotton Leaf Curl Kokhran Virus-Burewala Bidirectional Promoter for Enhanced Cry1Ac Endotoxin Expression in Bt Transgenic Cotton" Applied Sciences 12, no. 21: 11275. https://doi.org/10.3390/app122111275
APA StyleAshraf, M. A., Shahid, A. A., Rao, A. Q., Brown, J. K., & Husnain, T. (2022). Development and Evaluation of the Cotton Leaf Curl Kokhran Virus-Burewala Bidirectional Promoter for Enhanced Cry1Ac Endotoxin Expression in Bt Transgenic Cotton. Applied Sciences, 12(21), 11275. https://doi.org/10.3390/app122111275