Influence of Non-Thermal Atmospheric Pressure Plasma Jet on Extracellular Activity of α-Amylase in Aspergillus oryzae
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Strain and Culture Conditions Used in this Study
2.2. Plasma Device and Treatment of Fungal Spores
2.3. Fungal Germination and Growth Measurement
2.4. Measurement of the Total Protein Level and α-Amylase Activity in the Media
2.5. Measurement of H2O2, NOX, NO2−, and NO3− Levels, Oxidation Reduction Potential, and pH in PDB Media
2.6. Quantitative Polymerase Chain Reaction of Secretion-Related Genes
2.7. Genomic DNA Analysis
2.8. Statistical Analysis
3. Results
3.1. Plasma Jet Enhances Spore Germination in A. oryzae
3.2. Plasma Jet Increases α-Amylase Secretion in A. oryzae
3.3. Level of NOX Species and Oxidation Reduction Potential in PDB Increases after Plasma Treatment
3.4. Plasma Increases the mRNA Levels of Genes Involved in Vesicle Trafficking
3.5. The Effect of Plasma on the Genomic DNA of A. oryzae
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sundarram, A.; Murthy, T.P.K. α-Amylase Production and Applications: A Review. Appl. Environ. Microbiol. 2014, 2, 166–175. [Google Scholar] [CrossRef]
- Abdullah, R.; Haq, I.; Iftikhar, T.; Khattak, Z. Random mutagenesis for enhanced production of alpha amylase by Aspergillus Oryzae IIB-30. Pak. J. Bot. 2013, 45, 269–274. [Google Scholar]
- Raveendran, S.; Parameswaran, B.; Ummalyma, S.B.; Abraham, A.; Mathew, A.K.; Madhavan, A.; Rebello, S.; Pandey, A. Applications of Microbial Enzymes in Food Industry. Food Technol. Biotechnol. 2018, 56, 16–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deckers, M.; Deforce, D.; Fraiture, M.-A.; Roosens, N.H.C. Genetically Modified Micro-Organisms for Industrial Food Enzyme Production: An Overview. Foods 2020, 9, 326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mizuno, A. Industrial applications of atmospheric non-thermal plasma in environmental remediation. Plasma Phys. Control. Fusion 2007, 49, A1. [Google Scholar] [CrossRef] [Scilit]
- Weltmann, K.D.; Von Woedtke, T. Plasma medicine—Current state of research and medical application. Plasma Phys. Control. Fusion 2016, 59, 014031. [Google Scholar] [CrossRef] [Scilit]
- Hati, S.; Patel, M.; Yadav, D. Food bioprocessing by non-thermal plasma technology. Curr. Opin. Food Sci. 2018, 19, 85–91. [Google Scholar] [CrossRef] [Scilit]
- Mandal, R.; Singh, A.; Pratap Singh, A. Recent developments in cold plasma decontamination technology in the food industry. Trends Food Sci. Technol. 2018, 80, 93–103. [Google Scholar] [CrossRef] [Scilit]
- Bernhardt, T.; Semmler, M.L.; Schäfer, M.; Bekeschus, S.; Emmert, S.; Boeckmann, L. Plasma Medicine: Applications of Cold Atmospheric Pressure Plasma in Dermatology. Oxid. Med. Cell. Longev. 2019, 2019, 3873928. [Google Scholar] [CrossRef] [Scilit]
- Sakudo, A.; Yagyu, Y.; Onodera, T. Disinfection and Sterilization Using Plasma Technology: Fundamentals and Future Perspectives for Biological Applications. Int. J. Mol. Sci. 2019, 20, 5216. [Google Scholar] [CrossRef] [Scilit]
- Simoncicova, J.; Krystofova, S.; Medvecka, V.; Durisova, K.; Kalinakova, B. Technical applications of plasma treatments: Current state and perspectives. Appl. Microbiol. Biotechnol. 2019, 103, 5117–5129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Y.M.; Patange, A.; Sun, D.W.; Tiwari, B. Plasma-activated water: Physicochemical properties, microbial inactivation mechanisms, factors influencing antimicrobial effectiveness, and applications in the food industry. Compr. Rev. Food Sci. Food Saf. 2020, 19, 3951–3979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez, M.; Calvo, T.; Prieto, M.; Mugica-Vidal, R.; Muro-Fraguas, I.; Alba-Elias, F.; Alvarez-Ordonez, A. A Review on Non-thermal Atmospheric Plasma for Food Preservation: Mode of Action, Determinants of Effectiveness, and Applications. Front. Microbiol. 2019, 10, 622. [Google Scholar] [CrossRef] [Scilit]
- Farasat, M.; Arjmand, S.; Ranaei Siadat, S.O.; Sefidbakht, Y.; Ghomi, H. The effect of non-thermal atmospheric plasma on the production and activity of recombinant phytase enzyme. Sci. Rep. 2018, 8, 16647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veerana, M.; Lim, J.-S.; Choi, E.-H.; Park, G. Aspergillus oryzae spore germination is enhanced by non-thermal atmospheric pressure plasma. Sci. Rep. 2019, 9, 11184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, C.; Qin, J.; Dai, Y.; Mu, W.; Zhang, T. Atmospheric and room temperature plasma (ARTP) mutagenesis enables xylitol over-production with yeast Candida tropicalis. J. Biotechnol. 2019, 296, 7–13. [Google Scholar] [CrossRef] [Scilit]
- Gao, X.; Liu, E.; Yin, Y.; Yang, L.; Huang, Q.; Chen, S.; Ho, C.-T. Enhancing Activities of Salt-Tolerant Proteases Secreted by Aspergillus oryzae Using Atmospheric and Room-Temperature Plasma Mutagenesis. J. Agric. Food Chem. 2020, 68, 2757–2764. [Google Scholar] [CrossRef] [Scilit]
- Veerana, M.; Mitra, S.; Ki, S.-H.; Kim, S.-M.; Choi, E.-H.; Lee, T.; Park, G. Plasma-mediated enhancement of enzyme secretion in Aspergillus oryzae. Microb. Biotechnol. 2020. [Google Scholar] [CrossRef] [Scilit]
- Meneghel, L.; Reis, G.P.; Reginatto, C.; Malvessi, E.; Da Silveira, M.M. Assessment of pectinase production by Aspergillus oryzae in growth-limiting liquid medium under limited and non-limited oxygen supply. Process. Biochem. 2014, 49, 1800–1807. [Google Scholar] [CrossRef] [Scilit]
- Carevic, M.; Velickovic, D.; Stojanovic, M.; Milosavic, N.; Rogniaux, H.; Ropartz, D.; Bezbradica, D. Insight in the regioselective enzymatic transgalactosylation of salicin catalyzed by β-galactosidase from Aspergillus oryzae. Process. Biochem. 2015, 50, 782–788. [Google Scholar] [CrossRef] [Scilit]
- Porfirif, M.C.; Milatich, E.J.; Farruggia, B.M.; Romanini, D. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step. J. Chromatogr. B 2016, 1022, 87–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adhikari, B.; Adhikari, M.; Ghimire, B.; Adhikari, B.C.; Park, G.; Choi, E.H. Cold plasma seed priming modulates growth, redox homeostasis and stress response by inducing reactive species in tomato (Solanum lycopersicum). Free Radic. Biol. Med. 2020, 156, 57–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahnoun, M.; Bejar, S.; Sayari, A.; Triki, M.A.; Kriaa, M.; Kammoun, R. Production, purification and characterization of two α-amylase isoforms from a newly isolated Aspergillus Oryzae strain S2. Process. Biochem. 2012, 47, 18–25. [Google Scholar] [CrossRef] [Scilit]
- Bernfeld, P. Amylases, α and β. Meth. Enzymol. 1955, 1, 149–158. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Inglis, P.W.; Pappas, M.d.C.R.; Resende, L.V.; Grattapaglia, D. Fast and inexpensive protocols for consistent extraction of high quality DNA and RNA from challenging plant and fungal samples for high-throughput SNP genotyping and sequencing applications. PLoS ONE 2018, 13, e0206085. [Google Scholar] [CrossRef] [Scilit]
- Machida, M.; Asai, K.; Sano, M.; Tanaka, T.; Kumagai, T.; Terai, G.; Kusumoto, K.-I.; Arima, T.; Akita, O.; Kashiwagi, Y.; et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 2005, 438, 1157–1161. [Google Scholar] [CrossRef] [Scilit]
- Kitamoto, K. Cell biology of the Koji mold Aspergillus oryzae. Biosci. Biotechnol. Biochem. 2015, 79, 863–869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalghatgi, S.; Kelly, C.M.; Cerchar, E.; Torabi, B.; Alekseev, O.; Fridman, A.; Friedman, G.; Azizkhan-Clifford, J. Effects of Non-Thermal Plasma on Mammalian Cells. PLoS ONE 2011, 6, e16270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lukes, P.; Locke, B.; Brisset, J.-L. Aqueous-Phase Chemistry of Electrical Discharge Plasma in Water and in Gas-Liquid Environments. In Plasma Chemistry and Catalysis in Gases and Liquids; Parvulescu, V.I., Magureanu, M., Lukes, P., Eds.; Wiley-VCH: Weinheim, Germany, 2012; pp. 243–308. [Google Scholar]
- Tian, Y.; Ma, R.; Zhang, Q.; Feng, H.; Liang, Y.; Zhang, J.; Fang, J. Assessment of the Physicochemical Properties and Biological Effects of Water Activated by Non-thermal Plasma Above and Beneath the Water Surface. Plasma Processes Polym. 2015, 12, 439–449. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Ma, R.; Tian, Y.; Su, B.; Wang, K.; Yu, S.; Zhang, J.; Fang, J. Sterilization Efficiency of a Novel Electrochemical Disinfectant against Staphylococcus aureus. Environ. Sci. Technol. 2016, 50, 3184–3192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Tian, Y.; Ma, R.; Liu, Q.; Zhang, J. Effect of plasma activated water on the postharvest quality of button mushrooms, Agaricus bisporus. Food Chem. 2016, 197, 436–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thirumdas, R.; Kothakota, A.; Annapure, U.; Siliveru, K.; Blundell, R.; Gatt, R.; Valdramidis, V.P. Plasma activated water (PAW): Chemistry, physico-chemical properties, applications in food and agriculture. Trends Food Sci. Technol. 2018, 77, 21–31. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhang, X.-F.; Li, H.-P.; Wang, L.-Y.; Zhang, C.; Xing, X.-H.; Bao, C.-Y. Atmospheric and room temperature plasma (ARTP) as a new powerful mutagenesis tool. Appl. Microbiol. Biotechnol. 2014, 98, 5387–5396. [Google Scholar] [CrossRef] [Scilit]
- Zhang, N.; Jiang, J.-C.; Yang, J.; Wei, M.; Zhao, J.; Xu, H.; Xie, J.-C.; Tong, Y.-J.; Yu, L. Citric Acid Production from Acorn Starch by Tannin Tolerance Mutant Aspergillus niger AA120. Appl. Biochem. Biotechnol. 2019, 188, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Suh, D.; Tang, T.; Lee, H.J.; Roe, J.-S.; Kim, G.C.; Han, S.; Song, K. Non-thermal atmospheric pressure plasma induces epigenetic modifications that activate the expression of various cytokines and growth factors in human mesoderm-derived stem cells. Free Radic. Biol. Med. 2020, 148, 108–122. [Google Scholar] [CrossRef] [Scilit]







| Genes | Primer sequences |
|---|---|
| Vesicle trafficking and transport | |
| GTPase (ER to Golgi), SAR1 homolog | Forward-5′CGAAGTGAGCGGTATCGTTT3′ Reverse-5′CCCTTTCCTGTGGTCTGGTA3′ |
| GTPase (cis to medial Golgi), YPT1 homolog | Forward-5′TGATGGCAAGACAGTGAAGC3′ Reverse-5′TTGACACCCTCAGTGGCATA3′ |
| Reference gene | |
| 18S ribosomal RNA | Forward-5′GGAAACTCACCAGGTCCAGA3′ Reverse-5′AGCCGATAGTCCCCCTAAGA3′ |
| Treatment Time (min) | Mutation Position Number | Mutation (%) | |
|---|---|---|---|
| Total mutations | 5 | 655 | 0.0017 |
| 20 | 596 | 0.0016 | |
| Total mutations in exons | 5 | 62 | 0.0002 |
| 20 | 25 | 0.0001 | |
| Total mutations in introns | 5 | 593 | 0.0016 |
| 20 | 571 | 0.0015 | |
| Total missense mutations | 5 | 35 (17 a) | 0.0001 (0.1377 b) |
| 20 | 17 (10 a) | 0.00004 (0.0810 b) |
| Mutations (%) | Mutations in Exons (%) | Missense Mutations (%) | Missense Mutationsin Genes (%) | |||||
|---|---|---|---|---|---|---|---|---|
| Treatment Time (min) | 5 | 20 | 5 | 20 | 5 | 20 | 5 | 20 |
| Chromosome 1 | 0.00186 | 0.00160 | 0.00005 | 0.00000 | 0.00002 | 0.00000 | 0.04808 | 0.00000 |
| Chromosome 2 | 0.00168 | 0.00115 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 |
| Chromosome 3 | 0.00125 | 0.00142 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 |
| Chromosome 4 | 0.00262 | 0.00309 | 0.00027 | 0.00012 | 0.00016 | 0.00010 | 0.19280 | 0.25707 |
| Chromosome 5 | 0.00126 | 0.00128 | 0.00007 | 0.00013 | 0.00007 | 0.00011 | 0.13193 | 0.19789 |
| Chromosome 6 | 0.00131 | 0.00138 | 0.00017 | 0.00007 | 0.00010 | 0.00002 | 0.22539 | 0.07513 |
| Chromosome 7 | 0.00150 | 0.00112 | 0.00051 | 0.00024 | 0.00027 | 0.00014 | 0.31847 | 0.10616 |
| Mitochondria | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 | 0.00000 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Veerana, M.; Choi, E.H.; Park, G. Influence of Non-Thermal Atmospheric Pressure Plasma Jet on Extracellular Activity of α-Amylase in Aspergillus oryzae. Appl. Sci. 2021, 11, 691. https://doi.org/10.3390/app11020691
Veerana M, Choi EH, Park G. Influence of Non-Thermal Atmospheric Pressure Plasma Jet on Extracellular Activity of α-Amylase in Aspergillus oryzae. Applied Sciences. 2021; 11(2):691. https://doi.org/10.3390/app11020691
Chicago/Turabian StyleVeerana, Mayura, Eun Ha Choi, and Gyungsoon Park. 2021. "Influence of Non-Thermal Atmospheric Pressure Plasma Jet on Extracellular Activity of α-Amylase in Aspergillus oryzae" Applied Sciences 11, no. 2: 691. https://doi.org/10.3390/app11020691
APA StyleVeerana, M., Choi, E. H., & Park, G. (2021). Influence of Non-Thermal Atmospheric Pressure Plasma Jet on Extracellular Activity of α-Amylase in Aspergillus oryzae. Applied Sciences, 11(2), 691. https://doi.org/10.3390/app11020691
