In Vitro Effect of Putty Calcium Silicate Materials on Human Periodontal Ligament Stem Cells
Abstract
1. Introduction
2. Material and Methods
2.1. Isolation of Human Periodontal Ligament Stem Cells (hPDLSCs)
2.2. Flow Cytometric Characterization
2.3. Sample Extracts
2.4. Cytotoxicity Evaluation
2.5. Scratch Migration Assay
2.6. Scanning Electronic Microscopy
2.7. RT-qPCR Gene Expression Analysis
2.8. Alizarin Red Assay
2.9. Statistical Analysis
3. Results
3.1. Characterization of hPDLSCs Immunophenotype
3.2. Cytotoxicity Evaluation
3.3. Scratch Migration Assay
3.4. Scanning Electronic Microscopy
3.5. qPCR Analysis
3.6. Mineralization Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Estrela, C.; Decurcio, D.A.; Rossi-Fedele, G.; Silva, J.A.; Guedes, O.A.; Borges, A.H. Root perforations: A review of diagnosis, prognosis and materials. Braz. Oral Res. 2018, 32, e73. [Google Scholar] [CrossRef] [PubMed]
- Abusrewil, S.M.; McLean, W.; Scott, J.A. The use of bioceramics as root-end filling materials in periradicular surgery: A literature review. Saudi Dent. J. 2018, 30, 273–282. [Google Scholar] [CrossRef] [PubMed]
- Khayat, A. Histological observations of periradicular healing following root canal treatment. Aust. Endod. J. 2005, 31, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.J.; Shen, Z.S.; Qin, W.; Lin, Z. A comparison of the sealing abilities between biodentine and mta as root-end filling materials and their effects on bone healing in dogs after periradicular surgery. J. Appl. Oral Sci. 2019, 27, e20180693. [Google Scholar] [CrossRef] [PubMed]
- von Arx, T.; Jensen, S.S.; Janner, S.F.M.; Hanni, S.; Bornstein, M.M. A 10-year Follow-up Study of 119 Teeth Treated With Apical Surgery and Root-end Filling with Mineral Trioxide Aggregate. J. Endod. 2019, 45, 394–401. [Google Scholar] [CrossRef]
- Rodríguez-Lozano, F.J.; Bueno, C.; Insausti, C.L.; Meseguer, L.; Ramírez, M.C.; Blanquer, M.; Marin, N.; Martínez, S.; Moraleda, J.M. Mesenchymal stem cells derived from dental tissues. Int. Endod. J. 2011, 44, 800–806. [Google Scholar] [CrossRef]
- Spagnuolo, G.; Codispoti, B.; Marrelli, M.; Rengo, C.; Rengo, S.; Tatullo, M. Commitment of Oral-Derived Stem Cells in Dental and Maxillofacial Applications. Dent. J. 2018, 6, 72. [Google Scholar] [CrossRef]
- Vidovic Zdrilic, I.; de Azevedo Queiroz, I.O.; Matthews, B.G.; Gomes-Filho, J.E.; Mina, M.; Kalajzic, I. Mineral trioxide aggregate improves healing response of periodontal tissue to injury in mice. J. Periodontal Res. 2017, 52, 1058–1067. [Google Scholar] [CrossRef]
- Leprince, J.G.; Zeitlin, B.D.; Tolar, M.; Peters, O.A. Interactions between immune system and mesenchymal stem cells in dental pulp and periapical tissues. Int. Endod. J. 2012, 45, 689–701. [Google Scholar] [CrossRef]
- Yoshino, P.; Nishiyama, C.K.; Modena, K.C.; Santos, C.F.; Sipert, C.R. In vitro cytotoxicity of white MTA, MTA Fillapex® and Portland cement on human periodontal ligament fibroblasts. Braz. Dent. J. 2013, 24, 111–116. [Google Scholar] [CrossRef]
- Gandolfi, M.G.; Spagnuolo, G.; Siboni, F.; Procino, A.; Rivieccio, V.; Pelliccioni, G.A.; Prati, C.; Rengo, S. Calcium silicate/calcium phosphate biphasic cements for vital pulp therapy: Chemical-physical properties and human pulp cells response. Clin. Oral Investig. 2015, 19, 2075–2089. [Google Scholar] [CrossRef] [PubMed]
- De-Deus, G.; Canabarro, A.; Alves, G.; Linhares, A.; Senne, M.I.; Granjeiro, J.M. Optimal cytocompatibility of a bioceramic nanoparticulate cement in primary human mesenchymal cells. J. Endod. 2009, 35, 1387–1390. [Google Scholar] [CrossRef] [PubMed]
- Torabinejad, M.; Parirokh, M.; Dummer, P.M.H. Mineral trioxide aggregate and other bioactive endodontic cements: An updated overview—Part II: Other clinical applications and complications. Int. Endod. J. 2018, 51, 284–317. [Google Scholar] [CrossRef] [PubMed]
- Parirokh, M.; Torabinejad, M. Mineral trioxide aggregate: A comprehensive literature review—Part III: Clinical applications, drawbacks, and mechanism of action. J. Endod. 2010, 36, 400–413. [Google Scholar] [CrossRef] [PubMed]
- Torabinejad, M.; Parirokh, M. Mineral trioxide aggregate: A comprehensive literature review—Part II: Leakage and biocompatibility investigations. J. Endod. 2010, 36, 190–202. [Google Scholar] [CrossRef] [PubMed]
- Parirokh, M.; Torabinejad, M. Mineral trioxide aggregate: A comprehensive literature review—Part I: Chemical, physical, and antibacterial properties. J. Endod. 2010, 36, 16–27. [Google Scholar] [CrossRef]
- Da Silva, E.J.; Zaia, A.A.; Peters, O.A. Cytocompatibility of calcium silicate-based sealers in a three-dimensional cell culture model. Clin. Oral Investig. 2017, 21, 1531–1536. [Google Scholar] [CrossRef]
- International Organization for Standardization. Biological Evaluation of Medical Devices—Part 5: Tests for In Vitro Cytotoxicity, ISO 10993-5; ISO: Geneva, Switzerland, 2009. [Google Scholar]
- Tomas-Catala, C.J.; Collado-Gonzalez, M.; Garcia-Bernal, D.; Onate-Sanchez, R.E.; Forner, L.; Llena, C.; Lozano, A.; Moraleda, J.M.; Rodríguez-Lozano, F.J. Biocompatibility of New Pulp-capping Materials NeoMTA plus, MTA Repair HP, and Biodentine on Human Dental Pulp Stem Cells. J. Endod. 2018, 44, 126–132. [Google Scholar] [CrossRef]
- Prati, C.; Gandolfi, M.G. Calcium silicate bioactive cements: Biological perspectives and clinical applications. Dent. Mater. 2015, 31, 351–370. [Google Scholar] [CrossRef]
- Michel, A.; Erber, R.; Frese, C.; Gehrig, H.; Saure, D.; Mente, J. In vitro evaluation of different dental materials used for the treatment of extensive cervical root defects using human periodontal cells. Clin. Oral Investig. 2017, 21, 753–761. [Google Scholar] [CrossRef]
- Wu, T.; Xu, C.; Du, R.; Wen, Y.; Chang, J.; Huan, Z.; Zhu, Y. Effects of silicate-based composite material on the proliferation and mineralization behaviors of human dental pulp cells: An in vitro assessment. Dent. Mater. J. 2018, 37, 889–896. [Google Scholar] [CrossRef] [PubMed]
- Gomes-Cornelio, A.L.; Rodrigues, E.M.; Salles, L.P.; Mestieri, L.B.; Faria, G.; Guerreiro-Tanomaru, J.M.; Tanomaru-Filho, M. Bioactivity of MTA Plus, Biodentine and an experimental calcium silicate-based cement on human osteoblast-like cells. Int. Endod. J. 2017, 50, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.N.; Hong, J.U.; Kim, S.M.; Jang, J.H.; Chang, H.S.; Hwang, Y.C.; Hwang, I.N.; Oh, W.M. Anti-inflammatory and Osteogenic Effects of Calcium Silicate-based Root Canal Sealers. J. Endod. 2019, 45, 73–78. [Google Scholar] [CrossRef] [PubMed]
- Zordan-Bronzel, C.L.; Tanomaru-Filho, M.; Rodrigues, E.M.; Chavez-Andrade, G.M.; Faria, G.; Guerreiro-Tanomaru, J.M. Cytocompatibility, bioactive potential and antimicrobial activity of an experimental calcium silicate-based endodontic sealer. Int. Endod. J. 2019, 52, 979–986. [Google Scholar] [CrossRef] [PubMed]
- Colombo, M.; Poggio, C.; Dagna, A.; Meravini, M.V.; Riva, P.; Trovati, F.; Pietrocola, G. Biological and physico-chemical properties of new root canal sealers. J. Clin. Exp. Dent. 2018, 10, e120–e126. [Google Scholar] [CrossRef] [PubMed]
- Benetti, F.; Queiroz, I.O.A.; Cosme-Silva, L.; Conti, L.C.; Oliveira, S.H.P.; Cintra, L.T.A. Cytotoxicity, Biocompatibility and Biomineralization of a New Ready-for-use Bioceramic Repair Material. Braz. Dent. J. 2019, 30, 325–332. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, X.M.; Bi, J.; Yu, S.; Yang, N.; Song, B.; Chen, X. Cell migration and osteo/odontogenesis stimulation of iRoot FS as a potential apical barrier material in apexification. Int. Endod. J. 2019. [Google Scholar] [CrossRef]
- Chen, L.; Zheng, L.; Jiang, J.; Gui, J.; Zhang, L.; Huang, Y.; Chen, X.; Ji, J.; Fan, Y. Calcium Hydroxide-induced Proliferation, Migration, Osteogenic Differentiation, and Mineralization via the Mitogen-activated Protein Kinase Pathway in Human Dental Pulp Stem Cells. J. Endod. 2016, 42, 1355–1361. [Google Scholar] [CrossRef]
- Quintana, R.M.; Jardine, A.P.; Grechi, T.R.; Grazziotin-Soares, R.; Ardenghi, D.M.; Scarparo, R.K.; Grecca, F.S.; Kopper, P.M.P. Bone tissue reaction, setting time, solubility, and pH of root repair materials. Clin. Oral Investig. 2019, 23, 1359–1366. [Google Scholar] [CrossRef]
- Giraud, T.; Jeanneau, C.; Bergmann, M.; Laurent, P.; About, I. Tricalcium Silicate Capping Materials Modulate Pulp Healing and Inflammatory Activity In Vitro. J. Endod. 2018, 44, 1686–1691. [Google Scholar] [CrossRef]
- Lv, F.; Zhu, L.; Zhang, J.; Yu, J.; Cheng, X.; Peng, B. Evaluation of the in vitro biocompatibility of a new fast-setting ready-to-use root filling and repair material. Int. Endod. J. 2017, 50, 540–548. [Google Scholar] [CrossRef]
- Lo Giudice, R.; Puleio, F.; Rizzo, D.; Alibrandi, A.; Lo Giudice, G.; Centofanti, A.; Fiorillo, L.; Di Mauro, D.; Nicita, F. Comparative Investigation of Cutting Devices on Bone Blocks: An SEM Morphological Analysis. Appl. Sci. 2019, 9, 351. [Google Scholar] [CrossRef]
- Luo, T.; Liu, J.; Sun, Y.; Shen, Y.; Zou, L. Cytocompatibility of biodentine and iRoot FS with human periodontal ligament cells: An in vitro study. Int. Endod. J. 2018, 51, 779–788. [Google Scholar] [CrossRef] [PubMed]
- Vallittu, P.K.; Boccaccini, A.R.; Hupa, L.; Watts, D.C. Bioactive dental materials-Do they exist and what does bioactivity mean? Dent. Mater. 2018, 34, 693–694. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhou, Y.; Jin, L.; Pang, X.; Lu, Y.; Wang, Z.; Yu, Y.; Yu, J. Mineral trioxide aggregate enhances the osteogenic capacity of periodontal ligament stem cells via NF-kb and MAPK signaling pathways. J. Cell Physiol. 2018, 233, 2386–2397. [Google Scholar] [CrossRef]
- Lopez-Garcia, S.; Myong-Hyun, B.; Lozano, A.; Garcia-Bernal, D.; Forner, L.; Llena, C.; Guerrero-Girones, J.; Murcia, L.; Rodriguez-Lozano, F.J. Cytocompatibility, bioactivity potential, and ion release of three premixed calcium silicate-based sealers. Clin. Oral Investig. 2019. [Google Scholar] [CrossRef]
- Tatullo, M.; Spagnuolo, G.; Codispoti, B.; Zamparini, F.; Zhang, A.; Esposti, M.D.; Aparicio, C.; Rengo, C.; Nuzzolese, M.; Manzoli, L.; et al. Pla-Based Mineral-Doped Scaffolds Seeded with Human Periapical Cyst-Derived MSCs: A Promising Tool for Regenerative Healing in Dentistry. Materials 2019, 12, 597. [Google Scholar] [CrossRef]
- Lee, B.N.; Lee, K.N.; Koh, J.T.; Min, K.S.; Chang, H.S.; Hwang, I.N.; Hwang, Y.C.; Oh, W.M. Effects of 3 endodontic bioactive cements on osteogenic differentiation in mesenchymal stem cells. J. Endod. 2014, 40, 1217–1222. [Google Scholar] [CrossRef]
- Rodriguez-Lozano, F.J.; Collado-Gonzalez, M.; Tomas-Catala, C.J.; Garcia-Bernal, D.; Lopez, S.; Onate-Sanchez, R.E.; Moraleda, J.M.; Murcia, L. GuttaFlow Bioseal promotes spontaneous differentiation of human periodontal ligament stem cells into cementoblast-like cells. Dent. Mater. 2019, 35, 114–124. [Google Scholar] [CrossRef]







| Materials | Manufacturer | Composition |
|---|---|---|
| BIO-C Repair | Angelus, Londrina, Brasil. | Powder: Calcium Silicate (Ca2SiO4), Calcium Oxide(CaO), Zirconium Oxide(ZrO2), Iron Oxide (Fe2O3), Silicon Dioxide (SiO2) and Dispersing Agent |
| TOTALFILL BC RRM Putty | Innovative BioCeramix Inc. Burnaby, Canada | Powder: Tricalcium Silicate(Ca3SIO4), Dicalcium Silicate (Ca2SiO4), Zirconium Oxide (ZrO2), Tantalum Pentoxide (Ta2O5), Calcium Sulfate (CaSO4). |
| GADPH | Forward 5′ TCAGCAATGCCTCCTGCAC 3′ Reverse 5′ TCTGGGTGGCAGTGATGGC 3′ |
| CEMP1 | Forward 5′ GGGCACATCAAGCACTGACAG 3′ Reverse 5′ CCCTTAGGAAGTGGCTGTCCAG 3′ |
| CAP | Forward 5′ TTTTTCTGGTCGCGTGGACT 3′ Reverse 5′ TCACCAGCAACTCCAACAGG 3′ |
| ALP | Forward 5′ TCAGAAGCTCAACACCAACG 3′ Reverse 5′ TTGTACGTCTTGGAGAGGGC 3′ |
| RUNX2 | Forward 5′ TCCACACCATTAGGGACCATC 3′ Reverse 5′ TGCTAATGCTTCGTGTTTCCA 3′ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodríguez-Lozano, F.J.; López-García, S.; García-Bernal, D.; Pecci-Lloret, M.R.; Guerrero-Gironés, J.; Pecci-Lloret, M.P.; Lozano, A.; Llena, C.; Spagnuolo, G.; Forner, L. In Vitro Effect of Putty Calcium Silicate Materials on Human Periodontal Ligament Stem Cells. Appl. Sci. 2020, 10, 325. https://doi.org/10.3390/app10010325
Rodríguez-Lozano FJ, López-García S, García-Bernal D, Pecci-Lloret MR, Guerrero-Gironés J, Pecci-Lloret MP, Lozano A, Llena C, Spagnuolo G, Forner L. In Vitro Effect of Putty Calcium Silicate Materials on Human Periodontal Ligament Stem Cells. Applied Sciences. 2020; 10(1):325. https://doi.org/10.3390/app10010325
Chicago/Turabian StyleRodríguez-Lozano, Francisco Javier, Sergio López-García, David García-Bernal, Miguel R. Pecci-Lloret, Julia Guerrero-Gironés, María P. Pecci-Lloret, Adrián Lozano, Carmen Llena, Gianrico Spagnuolo, and Leopoldo Forner. 2020. "In Vitro Effect of Putty Calcium Silicate Materials on Human Periodontal Ligament Stem Cells" Applied Sciences 10, no. 1: 325. https://doi.org/10.3390/app10010325
APA StyleRodríguez-Lozano, F. J., López-García, S., García-Bernal, D., Pecci-Lloret, M. R., Guerrero-Gironés, J., Pecci-Lloret, M. P., Lozano, A., Llena, C., Spagnuolo, G., & Forner, L. (2020). In Vitro Effect of Putty Calcium Silicate Materials on Human Periodontal Ligament Stem Cells. Applied Sciences, 10(1), 325. https://doi.org/10.3390/app10010325

