Dietary Chitooligosaccharide Inclusion as an Alternative to Antibiotics Improves Intestinal Morphology, Barrier Function, Antioxidant Capacity, and Immunity of Broilers at Early Age
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Diets, and Experimental Design
2.2. Sample Collection
2.3. Intestinal Morphological Examination
2.4. Evaluation of Serum Biomarkers of Intestinal Permeability
2.5. Determination of Intestinal Antioxidant Capacity and Mucosal Immunity
2.6. Messenger RNA Quantification
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Relative Immune Organ Weights
3.3. Intestinal Morphology
3.4. Serum Biomarkers of Intestinal Permeability
3.5. Intestinal Antioxidant Capacity
3.6. Immunoglobulin Concentration in the Intestine
3.7. Gene Expressions Related to Intestinal Barrier Function
4. Discussion
4.1. Growth Performance
4.2. Relative Immune Organ Weights and Intestinal Immunoglobulin Levels
4.3. Intestinal Morphology and Barrier Function
4.4. Intestinal Antioxidant Capacity
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Tablante, N.L.; Brunet, P.Y.; Odor, E.M.; Salem, S.; Harter-Dennis, J.M.; Hueston, W.D. Risk factors associated with early respiratory disease complex in broiler chickens. Avian. Dis. 1999, 43, 424–428. [Google Scholar] [CrossRef] [PubMed]
- Dibner, J.J.; Richards, J.D. Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci. 2005, 84, 634–643. [Google Scholar] [CrossRef] [PubMed]
- Huyghebaert, G.; Ducatelle, R.; Van, I.F. An update on alternatives to antimicrobial growth promoters for broilers. Vet. J. 2011, 187, 182–188. [Google Scholar] [CrossRef] [PubMed]
- EU Commission. Regulation (Ec) No. 1831/2003 of the European Parliament and of the Council of 23 September 2003 on additives for use in animal nutrition. Off. J. Eur. Union. 2003, L268, 29–43. [Google Scholar]
- Zhou, T.X.; Cho, J.H.; Kim, I.H. Effects of supplementation of chito-oligosaccharide on the growth performance, nutrient digestibility, blood characteristics and appearance of diarrhea in weanling pigs. Livest. Sci. 2012, 144, 263–268. [Google Scholar] [CrossRef]
- Attia, Y.A.; Bakhashwain, A.A.; Bertu, N.K. Utilisation of thyme powder (Thyme vulgaris L.) as a growth promoter alternative to antibiotics for broiler chickens raised in a hot climate. Europ. Poult. Sci. 2018, 82, 15. [Google Scholar]
- Knaul, J.Z.; Hudson, S.M.; Creber, K.A.M. Crosslinking of chitosan fibers with dialdehydes: Proposal of a new reaction mechanism. J. Polym. Sci. Pol. Phys. 1999, 37, 1079–1094. [Google Scholar] [CrossRef]
- Chae, S.Y.; Jang, M.K.; Nah, J.W. Influence of molecular weight on oral absorption of water soluble chitosans. J. Control. Release. 2005, 102, 383–394. [Google Scholar] [CrossRef]
- Zaharoff, D.A.; Rogers, C.J.; Hance, K.W.; Schlom, J.; Greiner, J.W. Chitosan solution enhances both humoral and cell-mediated immune responses to subcutaneous vaccination. Vaccine 2007, 25, 2085–2094. [Google Scholar] [CrossRef]
- Mengíbar, M.; Mateos-Aparicio, I.; Miralles, B.; Heras, Á. Influence of the physico-chemical characteristics of chito-oligosaccharides (COS) on antioxidant activity. Carbohydr. Polym. 2013, 97, 776–782. [Google Scholar] [CrossRef]
- Cao, P.; Huang, G.; Yang, Q.; Guo, J.; Su, Z. The effect of chitooligosaccharides on oleic acid-induced lipid accumulation in HepG2 cells. Saudi. Pharm. J. 2016, 24, 292–298. [Google Scholar] [CrossRef] [PubMed]
- Han, K.N.; Kwon, I.K.; Lohakare, J.D.; Heo, S.; Chae, B.J. Chito-oligosaccharides as an alternative to antimicrobials in improving performance, digestibility and microbial ecology of the gut in weanling pigs. Asian-Australas. J. Anim. Sci. 2007, 20, 556–562. [Google Scholar] [CrossRef]
- Suthongsa, S.; Pichyangkura, R.; Kalandakanond-Thongsong, S.; Thongsong, B. Effects of dietary levels of chito-oligosaccharide on ileal digestibility of nutrients, small intestinal morphology and crypt cell proliferation in weaned pigs. Livest. Sci. 2017, 198, 37–44. [Google Scholar] [CrossRef]
- Liu, P.; Piao, X.S.; Kim, S.W.; Wang, L.; Shen, Y.B.; Lee, H.S.; Li, S.Y. Effects of chito-oligosaccharide supplementation on the growth performance, nutrient digestibility, intestinal morphology, and fecal shedding of Escherichia coli and Lactobacillus in weaning pigs. J. Anim. Sci. 2008, 86, 2609–2618. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.M.; Ferket, P.R.; Hong, Q.H.; Zhou, J.; Cao, G.T.; Zhou, L.; Chen, A.G. Effect of chito-oligosaccharide on growth performance, intestinal barrier function, intestinal morphology and cecal microflora in weaned Pigs. J. Anim. Sci. 2012, 90, 2671–2676. [Google Scholar] [CrossRef] [PubMed]
- Zhao, P.; Piao, X.; Zeng, Z.; Li, P.; Xu, X.; Wang, H. Effect of Forsythia suspensa extract and chito-oligosaccharide alone or in combination on performance, intestinal barrier function, antioxidant capacity and immune characteristics of weaned piglets. Anim. Sci. J. 2017, 88, 854–862. [Google Scholar] [CrossRef] [PubMed]
- Thongsong, B.; Suthongsa, S.; Pichyangkura, R.; Kalandakanond-Thongsong, S. Effects of chito-oligosaccharide upplemsentation with low or medium molecular weight and high degree of deacetylation on growth performance, nutrient digestibility and small intestinal morphology in weaned Pigs. Livest. Sci. 2018, 209, 60–66. [Google Scholar] [CrossRef]
- Xiao, D.; Wang, Y.; Liu, G.; He, J.; Qiu, W.; Hu, X.; Feng, Z.; Ran, M.; Nyachoti, C.M.; Kim, S.W.; et al. Effects of chitosan on intestinal inflammation in weaned pigs challenged by enterotoxigenic Escherichia coli. PLoS ONE 2014, 9, e104192. [Google Scholar] [CrossRef]
- Huang, R.L.; Deng, Z.Y.; Yang, C.B.; Yin, Y.L.; Xie, M.Y.; Wu, G.Y.; Li, T.J.; Li, L.L.; Tang, Z.R.; Kang, P.; et al. Dietary oligochitosan supplementation enhances immune status of broilers. J. Sci. Food. Agric. 2007, 87, 153–159. [Google Scholar] [CrossRef]
- Deng, X.; Li, X.; Liu, P.; Yuan, S.; Zang, J.; Li, S.; Piao, X. Effect of chito-oligosaccharide supplementation on immunity in broiler chickens. Asian-Australas. J. Anim. Sci. 2008, 21, 1651–1658. [Google Scholar] [CrossRef]
- Huang, R.L.; Yin, Y.L.; Wu, G.Y.; Zhang, Y.G.; Li, T.J.; Li, L.L.; Li, M.X.; Tang, Z.R.; Zhang, J.; Wang, B.; et al. Effect of dietary oligochitosan supplementation on ileal digestibility of nutrients and performance in broilers. Poult. Sci. 2005, 84, 1383–1388. [Google Scholar] [CrossRef] [PubMed]
- Baurhoo, B.; Phillip, L.; Ruiz-Feria, C.A. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci. 2007, 86, 1070–1078. [Google Scholar] [CrossRef] [PubMed]
- Shang, Y.; Regassa, A.; Kim, J.H.; Kim, W.K. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci. 2015, 94, 2887–2897. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Chen, Y.; Chen, R.; Su, Y.; Zhang, R.; He, Q.; Wang, K.; Wen, C.; Zhou, Y. Dietary mannan oligosaccharide ameliorates cyclic heat stress-induced damages on intestinal oxidative status and barrier integrity of broilers. Poult. Sci. 2019, 0, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Vila, A.; Sánchez, A.; Janes, K.; Behrens, I.; Kissel, T.; Jato, J.L.V.; Alonso, M.J. Low molecular weight chitosan nanoparticles as new carriers for nasal vaccine delivery in mice. Eur. J. Pharm. Biopharm. 2004, 57, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Hirano, S.; Itakura, C.; Seino, H.; Akiyama, Y.; Nonaka, I.; Kanbara, N.; Kawakami, T. Chitosan as an ingredient for domestic animal feeds. J. Agric. Food. Chem. 1990, 38, 1214–1217. [Google Scholar] [CrossRef]
- Li, X.J.; Piao, X.S.; Kim, S.W.; Liu, P.; Wang, L.; Shen, Y.B.; Jung, S.C.; Lee, H.S. Effects of chito-oligosaccharide supplementation on performance, nutrient digestibility, and serum composition in broiler chickens. Poult. Sci. 2007, 86, 1107–1114. [Google Scholar] [CrossRef]
- Yin, Y.L.; Tang, Z.R.; Sun, Z.H.; Liu, Z.Q.; Li, T.J.; Huang, R.L.; Ruan, Z.; Deng, Z.Y.; Gao, B.; Chen, L.X.; et al. Effect of galacto-mannan-oligosaccharides or chitosan supplementation on cytoimmunity and humoral immunity in early-weaned piglets. Asian-Australas J. Anim. Sci. 2008, 21, 723–731. [Google Scholar] [CrossRef]
- Tang, Z.R.; Yin, Y.L.; Nyachoti, C.M.; Huang, R.L.; Li, T.J.; Yang, C.; Yang, X.J.; Gong, J.; Peng, J.; Qi, D.S.; et al. Effect of dietary supplementation of chitosan and galacto-mannan-oligosaccharide on serum parameters and the insulin-like growth factor-I mRNA expression in early-weaned piglets. Domest. Anim. Endocrinol. 2005, 28, 430–441. [Google Scholar] [CrossRef]
- Cheng, Y.; Xu, Q.; Chen, Y.; Su, Y.; Wen, C.; Zhou, Y. Modified palygorskite improves immunity, antioxidant ability, intestinal morphology, and barrier function in broiler chickens fed naturally contaminated diet with permitted feed concentrations of Fusarium mycotoxins. Toxins. 2018, 10, 482. [Google Scholar] [CrossRef] [PubMed]
- Li, S.H.; Jin, E.H.; Qiao, E.M.; Wu, G.Z.; Li, K. Chitooligosaccharide promotes immune organ development in broiler chickens and reduces serum lipid levels. Histol. Histopathol. 2017, 32, 951–961. [Google Scholar]
- Zhou, T.X.; Chen, Y.J.; Yoo, J.S.; Huang, Y.; Lee, J.H.; Jang, H.D.; Shin, S.O.; Kim, H.J.; Cho, J.H.; Kim, I.H. Effects of chitooligosaccharide supplementation on performance, blood characteristics, relative organ weight, and meat quality in broiler chickens. Poult. Sci. 2009, 88, 593–600. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.J.; Tsai, G.J. Cellulase degradation of shrimp chitosan for the preparation of a water-soluble hydrolysate with immunoactivity. Fisheries. Sci. 2004, 70, 1113–1120. [Google Scholar] [CrossRef]
- Schley, P.D.; Field, C.J. The immune-enhancing effects of dietary fibres and prebiotics. Br. J. Nutr. 2002, 87, S221–S230. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, X.A.; Wang, M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef] [PubMed]
- Yason, C.V.; Schat, K.A. Pathogenesis of rotavirus infection in various age groups of chickens and turkeys: Clinical signs and virology. Am. J. Vet. Res. 1987, 48, 977–983. [Google Scholar] [PubMed]
- Montagne, L.; Pluske, J.R.; Hampson, D.J. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive health in young non-ruminant animals. Anim. Feed. Sci. Technol. 2003, 108, 95–117. [Google Scholar] [CrossRef]
- Liu, P.; Piao, X.S.; Thacker, P.A.; Zeng, Z.K.; Li, P.F.; Wang, D.; Kim, S.W. Chito-oligosaccharide reduces diarrhea incidence and attenuates the immune response of weaned pigs challenged with Escherichia coli K88. J. Anim. Sci. 2010, 88, 3871–3879. [Google Scholar] [CrossRef]
- Podolsky, D.K. Oligosaccharide structures of human colonic mucin. J. Biol. Chem. 1985, 260, 8262–8271. [Google Scholar]
- Ofek, I.; Hasty, D.L.; Sharon, N. Anti-adhesion therapy of bacterial diseases: prospects and problems. FEMS. Immunol. Med. Microbiol. 2003, 1, 89–94. [Google Scholar] [CrossRef]
- Kim, S.K.; Rajapakse, N. Enzymatic production and biological activities of chitosan oligosaccharides (COS): A review. Carbohydr. Polym. 2005, 62, 357–368. [Google Scholar] [CrossRef]
- Mourão, J.L.; Pinheiro, V.; Alves, A.; Guedes, C.M.; Pinto, L.; Saavedra, M.J.; Spring, P.; Kocher, A. Effect of mannan oligosaccharides on the performance, intestinal morphology and cecal fermentation of fattening rabbits. Anim. Feed. Sci. Technol. 2006, 126, 107–120. [Google Scholar] [CrossRef]
- Vella, A.; Farrugia, G. D-lactic acidosis: pathologic consequence of saprophytism. Mayo. Clin. Proc. 1998, 73, 451–456. [Google Scholar] [CrossRef]
- Wu, M.; Xiao, H.; Ren, W.; Yin, J.; Tan, B.; Liu, G.; Li, L.; Nyachoti, C.M.; Xiong, X.; Wu, G. Therapeutic effects of glutamic acid in piglets challenged with deoxynivalenol. PLoS ONE 2014, 9, e100591. [Google Scholar] [CrossRef]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.; Weber, C.R.; Raleigh, D.R.; Yu, D.; Turner, J.R. Tight junction pore and leak pathways: A dynamic duo. Annu. Rev. Physiol. 2011, 73, 283–309. [Google Scholar] [CrossRef]
- Alizadeh, A.; Akbari, P.; Difilippo, E.; Schols, H.A. The piglet as a model for studying dietary components in infant diets: Effects of galacto-oligosaccharides on intestinal functions. Br. J. Nutr. 2015, 115, 605–618. [Google Scholar] [CrossRef]
- Xiong, X.; Yang, H.S.; Wang, X.C.; Hu, Q.; Liu, C.X.; Wu, X.; Deng, D.; Hou, Y.Q.; Nyachoti, C.M.; Xiao, D.F.; et al. Effect of low dosage of chito-oligosaccharide supplementation on intestinal morphology, immune response, antioxidant capacity, and barrier function in weaned Piglets. J. Anim. Sci. 2015, 93, 1089–1097. [Google Scholar] [CrossRef]
- Limón-Pacheco, J.; Gonsebatt, M.E. The role of antioxidants and antioxidant-related enzymes in protective responses to environmentally induced oxidative stress. Mutat. Res. 2009, 674, 137–147. [Google Scholar] [CrossRef]
- McCord, J.M. Superoxide, superoxide dismutase and oxygen toxicity. Rev. Biochem. Toxicol. 1979, 1, 109–124. [Google Scholar]
- Placer, Z.A.; Cushman, L.L.; Johnson, B.C. Estimation of product of lipid peroxidation (malonyl dialdehyde) in biochemical systems. Anal. Biochem. 1966, 16, 359–364. [Google Scholar] [CrossRef]
- Li, X.; Ding, X.; Peng, X.; Chi, X.; Cui, H.; Zuo, Z.; Fang, J. Effect of chitosan oligosaccharides on antioxidant function, lymphocyte cycle and apoptosis in ileum mucosa of broiler. Kafkas. Univ. Vet. Fak. Derg. 2017, 23, 571–577. [Google Scholar]
- Yang, Y.; Shu, R.; Shao, R.; Xu, G.; Gu, X. Radical scavenging activity of chitooligosaccharide with different molecular weights. Eur. Food. Res. Technol. 2006, 222, 36–40. [Google Scholar] [CrossRef]
| Ingredients | 1–21 Days |
|---|---|
| Ingredients | |
| Corn | 576.1 |
| Soybean meal | 310 |
| Corn gluten meal | 32.9 |
| Soybean oil | 31.1 |
| Limestone | 12 |
| Dicalcium phosphate | 20 |
| L-Lysine | 3.4 |
| DL-Methionine | 1.5 |
| Sodium chloride | 3 |
| Premix 1 | 10 |
| Calculated nutrient levels | |
| Apparent metabolizable energy (MJ/kg) | 12.56 |
| Crude protein | 211 |
| Calcium | 10.00 |
| Available phosphorus | 4.60 |
| Lysine | 12.00 |
| Methionine | 5.00 |
| Methionine + cystine | 8.50 |
| Genes 1 | Gene Bank ID | Primer Sequence | Product Size (bp) |
|---|---|---|---|
| OCLN | NM 205128.1 | F: CCGTAACCCCGAGTTGGAT | 214 |
| R: ATTGAGGCGGTCGTTGATG | |||
| CLDN2 | NM 001277622.1 | F: CCTGCTCACCCTCATTGGAG | 145 |
| R: GCTGAACTCACTCTTGGGCT | |||
| CLDN3 | NM 204202.1 | F: CCCGTCCCGTTGTTGTTTTG | 126 |
| R: CCCCTTCAACCTTCCCGAAA | |||
| ZO-1 | XM 413773.4 | F: TGTAGCCACAGCAAGAGGTG | 159 |
| R: CTGGAATGGCTCCTTGTGGT | |||
| β-actin | NM 205518.1 | F: TTGGTTTGTCAAGCAAGCGG | 100 |
| R: CCCCCACATACTGGCACTTT |
| Growth Parameter 1, 2 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| ADG (g/day) | 29.1 | 30.7 | 30.4 | 0.5 | 0.343 |
| ADFI (g/day) | 46.3 | 47.5 | 46.4 | 0.7 | 0.764 |
| F/G (g/g) | 1.60 a | 1.53 b | 1.52 b | 0.01 | 0.030 |
| Organ 1 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| Thymus | 3.46 | 4.40 | 4.37 | 0.20 | 0.095 |
| Spleen | 0.86 | 0.93 | 0.91 | 0.04 | 0.762 |
| Bursa of Fabricius | 1.81 | 2.32 | 1.94 | 0.14 | 0.333 |
| Intestinal Parameter 1 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| Villus height (μm) | |||||
| Duodenum | 1513b | 1729 a | 1723 a | 35 | 0.006 |
| Jejunum | 1183 | 1198 | 1164 | 41 | 0.498 |
| Ileum | 835 | 739 | 866 | 44 | 0.492 |
| Crypt depth (μm) | |||||
| Duodenum | 212 | 177 | 195 | 7 | 0.084 |
| Jejunum | 289 a | 209 b | 210 b | 13 | 0.004 |
| Ileum | 188 a | 125 b | 191 a | 11 | 0.015 |
| Villus height: crypt depth ratio | |||||
| Duodenum | 7.24 b | 9.80 a | 8.63 a | 0.31 | <0.001 |
| Jejunum | 4.51 b | 5.75 a | 5.59 a | 0.20 | 0.014 |
| Ileum | 4.54 | 6.31 | 4.66 | 0.35 | 0.064 |
| Serum Biomarker 1, 2 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| DAO (U/L) | 21.0 a | 16.7 b | 15.9 b | 0.8 | 0.004 |
| D-lactate (nmol/μL) | 2.40 | 1.72 | 1.79 | 0.14 | 0.061 |
| endotoxin (EU/mL) | 0.0600 a | 0.0358 b | 0.0453 b | 0.0032 | 0.001 |
| Parameter 1, 2 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| Duodenum | |||||
| T-AOC (U/mg protein) | 0.475 | 0.550 | 0.725 | 0.049 | 0.095 |
| SOD (U/mg protein) | 181 b | 195 b | 248 a | 11 | 0.026 |
| MDA (nmol/mg protein) | 0.850 | 0.498 | 0.652 | 0.116 | 0.472 |
| Jejunum | |||||
| T-AOC (U/mg protein) | 0.550 | 0.629 | 0.633 | 0.026 | 0.350 |
| SOD (U/mg protein) | 181 | 190 | 188 | 3 | 0.518 |
| MDA (nmol/mg protein) | 1.10 a | 0.54 b | 0.48 b | 0.09 | 0.001 |
| Ileum | |||||
| T-AOC (U/mg protein) | 0.99 | 1.17 | 1.01 | 0.07 | 0.614 |
| SOD (U/mg protein) | 165 | 183 | 186 | 7 | 0.522 |
| MDA (nmol/mg protein) | 1.65 a | 1.30 ab | 1.03 b | 0.11 | 0.05 |
| Immunoglobulin 1, 2 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| Duodenum | |||||
| IgG | 126 b | 134 a | 134 a | 1 | 0.019 |
| IgM | 7.38 b | 7.85 b | 8.12 a | 0.12 | 0.029 |
| sIgA | 9.03 | 9.42 | 9.36 | 0.15 | 0.533 |
| Jejunum | |||||
| IgG | 132 b | 145 a | 144 a | 2 | 0.023 |
| IgM | 7.92 b | 9.04 a | 9.02 a | 0.20 | 0.021 |
| sIgA | 9.79 | 9.94 | 10.68 | 0.23 | 0.240 |
| Ileum | |||||
| IgG | 150 b | 165 a | 163 a | 3 | 0.040 |
| IgM | 10.0 | 11.3 | 11.1 | 0.3 | 0.186 |
| sIgA | 12.0 | 11.6 | 11.6 | 0.3 | 0.858 |
| Intestinal Gene 1, 2 | Control Group | Antibiotic Group | COS Group | SEM | p-Value |
|---|---|---|---|---|---|
| Duodenum | |||||
| OCLN | 1.00 | 1.10 | 1.00 | 0.07 | 0.822 |
| CLDN2 | 1.00 | 1.09 | 1.22 | 0.10 | 0.703 |
| CLDN3 | 1.00 | 1.22 | 1.25 | 0.16 | 0.823 |
| ZO-1 | 1.00 | 1.04 | 1.01 | 0.06 | 0.965 |
| Jejunum | |||||
| OCLN | 1.00 | 1.09 | 1.08 | 0.07 | 0.863 |
| CLDN2 | 1.00 | 1.06 | 1.16 | 0.06 | 0.605 |
| CLDN3 | 1.00 b | 1.08 b | 1.51 a | 0.09 | 0.050 |
| ZO-1 | 1.00 | 1.11 | 1.11 | 0.05 | 0.655 |
| Ileum | |||||
| OCLN | 1.00 | 1.26 | 1.14 | 0.08 | 0.43 |
| CLDN2 | 1.00 | 1.10 | 1.09 | 0.09 | 0.899 |
| CLDN3 | 1.00 b | 1.12 b | 1.64 a | 0.11 | 0.020 |
| ZO-1 | 1.00 | 1.23 | 1.10 | 0.07 | 0.400 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Cheng, Y.; Chen, Y.; Qu, H.; Zhao, Y.; Wen, C.; Zhou, Y. Dietary Chitooligosaccharide Inclusion as an Alternative to Antibiotics Improves Intestinal Morphology, Barrier Function, Antioxidant Capacity, and Immunity of Broilers at Early Age. Animals 2019, 9, 493. https://doi.org/10.3390/ani9080493
Li J, Cheng Y, Chen Y, Qu H, Zhao Y, Wen C, Zhou Y. Dietary Chitooligosaccharide Inclusion as an Alternative to Antibiotics Improves Intestinal Morphology, Barrier Function, Antioxidant Capacity, and Immunity of Broilers at Early Age. Animals. 2019; 9(8):493. https://doi.org/10.3390/ani9080493
Chicago/Turabian StyleLi, Jun, Yefei Cheng, Yueping Chen, Hengman Qu, Yurui Zhao, Chao Wen, and Yanmin Zhou. 2019. "Dietary Chitooligosaccharide Inclusion as an Alternative to Antibiotics Improves Intestinal Morphology, Barrier Function, Antioxidant Capacity, and Immunity of Broilers at Early Age" Animals 9, no. 8: 493. https://doi.org/10.3390/ani9080493
APA StyleLi, J., Cheng, Y., Chen, Y., Qu, H., Zhao, Y., Wen, C., & Zhou, Y. (2019). Dietary Chitooligosaccharide Inclusion as an Alternative to Antibiotics Improves Intestinal Morphology, Barrier Function, Antioxidant Capacity, and Immunity of Broilers at Early Age. Animals, 9(8), 493. https://doi.org/10.3390/ani9080493
