Modulation of Helper T Cytokines in Thymus during Early Pregnancy in Ewes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. RNA Extraction and qRT-PCR Assay
2.3. Western Blot Analysis
2.4. Immunohistochemistry Analysis
2.5. Statistical Analysis
3. Results
3.1. Expression Values of Th1 Cytokines in the Thymuses
3.2. Expression Values of Th2 cytokines in the Thymuses
3.3. The Immunohistochemistry for IFN-γ and IL-6 Proteins in the Thymuses
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Romagnani, S. Biology of human TH1 and TH2 cells. J. Clin. Immunol. 1995, 15, 121–129. [Google Scholar] [CrossRef] [Scilit]
- Murphy, K.M.; Reiner, S.L. The lineage decisions of helper T cells. Nat. Rev. Immunol. 2002, 2, 933–944. [Google Scholar] [CrossRef] [Scilit]
- Ott, T.L.; Gifford, C.A. Effects of early conceptus signals on circulating immune cells: Lessons from domestic ruminants. Am. J. Reprod. Immunol. 2010, 64, 245–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raghupathy, R.; Makhseed, M.; Azizieh, F.; Omu, A.; Gupta, M.; Farhat, R. Cytokine production by maternal lymphocytes during normal human pregnancy and in unexplained recurrent spontaneous abortion. Hum. Reprod. 2000, 15, 713–718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Xia, Y.; Tang, F.; Li, S.J.; Yang, L.; Wang, B. The regulation of intrauterine immune cytokines and chemokines during early pregnancy in the bovine. Large Anim. Rev. 2015, 21, 23–31. [Google Scholar]
- Ng, S.C.; Gilman-Sachs, A.; Thaker, P.; Beaman, K.D.; Beer, A.E.; Kwak-Kim, J. Expression of intracellular Th1 and Th2 cytokines in women with recurrent spontaneous abortion, implantation failures after IVF/ET or normal pregnancy. Am. J. Reprod. Immunol. 2002, 48, 77–86. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Wang, Y.; Ma, X.; Wang, S.; Zhang, L. Changes in expression of Th1 and Th2 cytokines in bovine peripheral blood mononuclear cells during early pregnancy. Indian J. Anim. Res. 2016, 50, 466–470. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Wang, P.; Mi, H.; Lv, W.; Liu, B.; Du, J.; Zhang, L. Comparison of Th1 and Th2 cytokines production in ovine lymph nodes during early pregnancy. Theriogenology 2019, 123, 177–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zoller, A.L.; Schnell, F.J.; Kersh, G.J. Murine pregnancy leads to reduced proliferation of maternal thymocytes and decreased thymic emigration. Immunology 2007, 121, 207–215. [Google Scholar] [CrossRef] [Scilit]
- Swami, S.; Tong, I.; Bilodeau, C.C.; Bourjeily, G. Thymic involution in pregnancy: A universal finding? Obstet. Med. 2012, 5, 130–132. [Google Scholar] [CrossRef] [Scilit]
- Tibbetts, T.A.; DeMayo, F.; Rich, S.; Conneely, O.M.; O’Malley, B.W. Progesterone receptors in the thymus are required for thymic involution during pregnancy and for normal fertility. Proc. Natl. Acad. Sci. USA 1999, 96, 12021–12026. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Xue, J.; Wang, Q.; Lv, W.; Mi, H.; Liu, Y.; Yang, L. Changes in expression of ISG15, progesterone receptor and progesterone-induced blocking factor in ovine thymus during early pregnancy. Theriogenology 2018, 121, 153–159. [Google Scholar] [CrossRef] [Scilit]
- Mcnatty, K.P.; Revefeim, K.J.; Young, A. Peripheral plasma progesterone concentrations in sheep during the oestrous cycle. J. Endocrinol. 1973, 58, 219–225. [Google Scholar] [CrossRef] [Scilit]
- Godkin, J.D.; Bazer, F.W.; Moffatt, J.; Sessions, F.; Roberts, R.M. Purification and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts at day 13–21. J. Reprod. Fertil. 1982, 65, 141–150. [Google Scholar] [CrossRef] [Scilit]
- Wong, M.L.; Medrano, J.F. Real-time PCR for mRNA quantitation. Biotechniques 2005, 39, 75–85. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.; Jin, G.Z.; Liu, K.; Dong, H.; Yu, H.; Duan, J.C.; Li, Z.; Dong, W.; Cong, W.M.; Yang, J.H. Twist2 is a valuable prognostic biomarker for colorectal cancer. World J. Gastroenterol. 2013, 19, 2404–2411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hansen, P.J. The immunology of early pregnancy in farm animals. Reprod. Domest. Anim. 2011, 46, 18–30. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Zhang, L.Y.; Qiao, H.Y.; Liu, N.; Wang, Y.X.; Li, S.J. Maternal immune regulation by conceptus during early pregnancy in the bovine. Asian J. Anim. Vet. Adv. 2014, 9, 610–620. [Google Scholar] [CrossRef] [Scilit]
- Chambers, S.P.; Clarke, A.G. Measurement of thymus weight, lumbar node weight and progesterone levels in syngeneically pregnant, allogeneically pregnant, and pseudopregnant mice. J. Reprod. Fertil. 1979, 55, 309–315. [Google Scholar] [CrossRef] [Scilit]
- Shinomiya, N.; Tsuru, S.; Tsugita, M.; Katsura, Y.; Takemura, T.; Rokutanda, M.; Nomoto, K. Thymic depletion in pregnancy: Kinetics of thymocytes and immunologic capacities of the hosts. J. Clin. Lab. Immunol. 1991, 34, 11–22. [Google Scholar]
- Gifford, C.A.; Assiri, A.M.; Satterfield, M.C.; Spencer, T.E.; Ott, T.L. Receptor transporter protein 4 (RTP4) in endometrium, ovary, and peripheral blood leukocytes of pregnant and cyclic ewes. Biol. Reprod. 2008, 79, 518–524. [Google Scholar] [CrossRef] [Scilit]
- Romero, J.J.; Antoniazzi, A.Q.; Smirnova, N.P.; Webb, B.T.; Yu, F.; Davis, J.S.; Hansen, T.R. Pregnancy-associated genes contribute to antiluteolytic mechanisms in ovine corpus luteum. Physiol. Genom. 2013, 45, 1095–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.; Banu, S.K.; McCracken, J.A.; Arosh, J.A. Early pregnancy modulates survival and apoptosis pathways in the corpus luteum in sheep. Reproduction 2016, 151, 187–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, L.; Liu, B.; Yan, X.; Zhang, L.; Gao, F.; Liu, Z. Expression of ISG15 in bone marrow during early pregnancy in ewes. Kafkas Univ. Vet. Fak. Derg. 2017, 23, 767–772. [Google Scholar]
- Schoenborn, J.R.; Wilson, C.B. Regulation of interferon-gamma during innate and adaptive immune responses. Adv. Immunol. 2007, 96, 41–101. [Google Scholar]
- Tuo, W.; MacMillan, H.; Günter, N.; Bazer, F.W.; Brown, W.C. Upregulation of interleukin-4 and IFN-gamma expression by IFN-tau, a member of the type I IFN family. J. Interferon. Cytokine Res. 1999, 19, 179–187. [Google Scholar] [CrossRef] [Scilit]
- Porto, W.J.N.; Horcajo, P.; Kim, P.C.P.; Regidor-Cerrillo, J.; Romão, E.A.; Álvarez-García, G.; Mesquita, E.P.; Mota, R.A.; Ortega-Mora, L.M. Peripheral and placental immune responses in goats after primoinfection with Neospora caninum at early, mid and late gestation. Vet. Parasitol. 2017, 242, 38–43. [Google Scholar] [CrossRef] [Scilit]
- Ruddle, N.H. Lymphotoxin and TNF: How it all began-a tribute to the travelers. Cytokine Growth Factor Rev. 2014, 25, 83–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harmon, Q.E.; Engel, S.M.; Wu, M.C.; Moran, T.M.; Luo, J.; Stuebe, A.M.; Avery, C.L.; Olshan, A.F. Polymorphisms in inflammatory genes are associated with term small for gestational age and preeclampsia. Am. J. Reprod. Immunol. 2014, 71, 472–484. [Google Scholar] [CrossRef] [Scilit]
- Franki, A.S.; Van Beneden, K.; Dewint, P.; Hammond, K.J.; Lambrecht, S.; Leclercq, G.; Kronenberg, M.; Deforce, D.; Elewaut, D. A unique lymphotoxin αβ-dependent pathway regulates thymic emigration of Vα14 invariant natural killer T cells. Proc. Natl. Acad. Sci. USA 2006, 103, 9160–9165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, W.; Lin, J.X.; Leonard, W.J. IL-2 family cytokines: New insights into the complex roles of IL-2 as a broad regulator of T helper cell differentiation. Curr. Opin. Immunol. 2011, 23, 598–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, W.; Lin, J.X.; Leonard, W.J. Interleukin-2 at the crossroads of effector responses, tolerance, and immunotherapy. Immunity 2013, 38, 13–25. [Google Scholar] [CrossRef] [Scilit]
- Zicari, A.; Ticconi, C.; Pasetto, N.; Losardo, A.; Salerno, A.; Pontieri, G.; Piccone, E. Interleukin-2 in human amniotic fluid during pregnancy and parturition: Implications for prostaglandin E2 release by fetal membranes. J. Reprod. Immunol. 1995, 29, 197–208. [Google Scholar] [CrossRef] [Scilit]
- Bonney, E.A. Maternal tolerance is not critically dependent on interleukin-4. Immunology 2001, 103, 382–389. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, P.; Chiasson, V.L.; Bounds, K.R.; Mitchell, B.M. Regulation of the Anti-Inflammatory Cytokines Interleukin-4 and Interleukin-10 during Pregnancy. Front. Immunol. 2014, 5, 253. [Google Scholar] [CrossRef] [Scilit]
- Svensson, L.; Arvola, M.; Sällström, M.A.; Holmdahl, R.; Mattsson, R. The Th2 cytokines IL-4 and IL-10 are not crucial for the completion of allogeneic pregnancy in mice. J. Reprod. Immunol. 2001, 51, 3–7. [Google Scholar] [CrossRef] [Scilit]
- Szekeres-Bartho, J.; Polgar, B.; Kozma, N.; Miko, E.; Par, G.; Szereday, L.; Barakonyi, A.; Palkovics, T.; Papp, O.; Varga, P. Progesterone-dependent immunomodulation. Chem. Immunol. Allergy 2005, 89, 118–125. [Google Scholar]
- Jonsson, Y.; Matthiesen, L.; Berg, G.; Ernerudh, J.; Nieminen, K.; Ekerfelt, C. Indications of an altered immune balance in preeclampsia: A decrease in in vitro secretion of IL-5 and IL-10 from blood mononuclear cells and in blood basophil counts compared with normal pregnancy. J. Reprod. Immunol. 2005, 66, 69–84. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.L.; Liang, Y.C.; Chiang, B.L. Placental growth factor downregulates type 1 T helper immune response by modulating the function of dendritic cells. J. Leukoc. Biol. 2007, 82, 1473–1480. [Google Scholar] [CrossRef] [Scilit]
- Martínez, F.F.; Knubel, C.P.; Sánchez, M.C.; Cervi, L.; Motrán, C.C. Pregnancy-specific glycoprotein 1a activates dendritic cells to provide signals for Th17-, Th2-, and Treg-cell polarization. Eur. J. Immunol. 2012, 42, 1573–1584. [Google Scholar] [CrossRef] [Scilit]
- Blitek, A.; Morawska, E.; Ziecik, A.J. Regulation of expression and role of leukemia inhibitory factor and interleukin-6 in the uterus of early pregnant pigs. Theriogenology 2012, 78, 951–964. [Google Scholar] [CrossRef] [Scilit]
- Goyal, P.; Brünnert, D.; Ehrhardt, J.; Bredow, M.; Piccenini, S.; Zygmunt, M. Cytokine IL-6 secretion by trophoblasts regulated via sphingosine-1-phosphate receptor 2 involving Rho/Rho-kinase and Rac1 signaling pathways. Mol. Hum. Reprod. 2013, 19, 528–538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, X.Y.; Lu, T.M.; Shu, W.H.; Zhou, H.Y. Correlation between IL-6 and invasiveness of ectoderm cells of embryo in early pregnancy. J. Biol. Regul. Homeost. Agents 2016, 30, 559–563. [Google Scholar] [PubMed]
- Dibble, S.; Andersen, A.; Lassen, M.R.; Cunanan, J.; Hoppensteadt, D.; Fareed, J. Inflammatory and procoagulant cytokine levels during pregnancy as predictors of adverse obstetrical complications. Clin. Appl. Thromb. Hemost. 2014, 20, 152–158. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wang, Y.; Ding, X.; Duan, B.; Li, L.; Wangm, X. Serum Levels of TNF-α and IL-6 Are Associated With Pregnancy-Induced Hypertension. Reprod. Sci. 2016, 23, 1402–1408. [Google Scholar] [CrossRef] [Scilit]
- Blois, S.M.; Freitag, N.; Tirado-González, I.; Cheng, S.B.; Heimesaat, M.M.; Bereswill, S.; Rose, M.; Conrad, M.L.; Barrientos, G.; Sharma, S. NK cell-derived IL-10 is critical for DC-NK cell dialogue at the maternal-fetal interface. Sci. Rep. 2017, 7, 2189. [Google Scholar] [CrossRef] [Scilit]
- Cheng, S.B.; Sharma, S. Interleukin-10: A pleiotropic regulator in pregnancy. Am. J. Reprod. Immunol. 2015, 73, 487–500. [Google Scholar] [CrossRef] [Scilit]
- Chatterjee, P.; Chiasson, V.L.; Seerangan, G.; Tobin, R.P.; Kopriva, S.E.; Newell-Rogers, M.K.; Mitchell, B.M. Cotreatment with interleukin 4 and interleukin 10 modulates immune cells and prevents hypertension in pregnant mice. Am. J. Hypertens. 2015, 28, 135–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calder, A.E.; Hince, M.N.; Dudakov, J.A.; Chidgey, A.P.; Boyd, R.L. Thymic involution: Where endocrinology meets immunology. Neuroimmunomodulation 2011, 18, 281–289. [Google Scholar] [CrossRef] [Scilit]
- Cahill, R.N.; Kimpton, W.G.; Washington, E.A.; Walker, I.D. Origin and development of the gamma delta T-cell system in sheep: A critical role for the thymus in the generation of TcR diversity and tissue tropism. Semin. Immunol. 1996, 8, 351–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chapman, J.C.; Chapman, F.M.; Michael, S.D. The production of alpha/beta and gamma/delta double negative (DN) T-cells and their role in the maintenance of pregnancy. Reprod. Biol. Endocrinol. 2015, 13, 73. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Gene | Primer | Sequence | Size (bp) |
|---|---|---|---|
| IL-2 | Forward | AAACCTGAACACCAGAGAGAT | 117 |
| Reverse | GCCTTTACTGTCGCATCA | ||
| IFN-γ | Forward | TTGAACGGCAGCTCTGAGAA | 124 |
| Reverse | TTGGCGACAGGTCATTCATC | ||
| TNF-β | Forward | CCACTGACGGGCTTTACCT | 141 |
| Reverse | TGATGGCAGAGAGGATGTTG | ||
| IL-4 | Forward | CCAAAGAACGCAACTGAGAA | 120 |
| Reverse | GCTGCTGAGATTCCTGTCAA | ||
| IL-5 | Forward | CATCTGCGTTTGACCTTGG | 139 |
| Reverse | AGTTCCCATCACCTATCAGCA | ||
| IL-6 | Forward | CGAGTTTGAGGGAAATCAGG | 118 |
| Reverse | GTCAGTGTGTGTGGCTGGAG | ||
| IL-10 | Forward | CTCTGTTGCCTGGTCTTCCT | 169 |
| Reverse | TGTTCAGTTGGTCCTTCATTTG | ||
| GAPDH | Forward | GGGTCATCATCTCTGCACCT | 176 |
| Reverse | GGTCATAAGTCCCTCCACGA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Zhao, Z.; Mi, H.; Liu, B.; Wang, B.; Yang, L. Modulation of Helper T Cytokines in Thymus during Early Pregnancy in Ewes. Animals 2019, 9, 245. https://doi.org/10.3390/ani9050245
Zhang L, Zhao Z, Mi H, Liu B, Wang B, Yang L. Modulation of Helper T Cytokines in Thymus during Early Pregnancy in Ewes. Animals. 2019; 9(5):245. https://doi.org/10.3390/ani9050245
Chicago/Turabian StyleZhang, Leying, Zimo Zhao, Hao Mi, Baoliang Liu, Bin Wang, and Ling Yang. 2019. "Modulation of Helper T Cytokines in Thymus during Early Pregnancy in Ewes" Animals 9, no. 5: 245. https://doi.org/10.3390/ani9050245
APA StyleZhang, L., Zhao, Z., Mi, H., Liu, B., Wang, B., & Yang, L. (2019). Modulation of Helper T Cytokines in Thymus during Early Pregnancy in Ewes. Animals, 9(5), 245. https://doi.org/10.3390/ani9050245

