Dietary Dihydroartemisinin Supplementation Attenuates Hepatic Oxidative Damage of Weaned Piglets with Intrauterine Growth Retardation through the Nrf2/ARE Signaling Pathway
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Animals and Diet Design
2.3. Sample Collection
2.4. Assay of Serum Antioxidant Enzyme Activities
2.5. Determination of Hepatic Concentration of MDA, PC, and 8-OHdG
2.6. Determination of Hepatic Antioxidant Enzyme Activities
2.7. Assay of Gene Expression
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Antioxidant Enzyme Activities
3.3. Hepatic Antioxidant Enzyme Activities
3.4. Hepatic Concentrations of MDA, PC and 8-OHdG
3.5. Hepatic Antioxidant-Related Gene Expression
3.6. Hepatic Protein Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Wu, G.; Bazer, F.W.; Wallace, J.M.; Spencer, T.E. BOARD-INVITED REVIEW: Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci. 2006, 84, 2316. [Google Scholar] [CrossRef] [PubMed]
- Longo, S.; Borghesi, A.; Tzialla, C.; Stronati, M. IUGR and infections. Early Hum. Dev. 2014, 90, S42–S44. [Google Scholar] [CrossRef]
- Haram, K.; Søfteland, E.; Bukowski, R. Intrauterine growth restriction. Int. J. Gynecol. Obstet. 2006, 93, 5–12. [Google Scholar] [CrossRef] [PubMed]
- McMillen, I.C.; Robinson, J.S. Developmental origins of the metabolic syndrome: Prediction, plasticity, and programming. Physiol. Rev. 2005, 85, 571–633. [Google Scholar] [CrossRef]
- Wu, G.; Bazer, F.W.; Datta, S.; Johnson, G.A.; Li, P.; Satterfield, M.C.; Spencer, T.E. Proline metabolism in the conceptus: Implications for fetal growth and development. Amino Acids 2008, 35, 691–702. [Google Scholar] [CrossRef]
- Wang, J.; Chen, L.; Li, D.; Yin, Y.; Wang, X.; Li, P.; Dangott, L.J.; Hu, W.; Wu, G. Intrauterine growth restriction affects the proteomes of the small intestine, liver, and skeletal muscle in newborn pigs. J. Nutr. 2008, 138, 60–66. [Google Scholar] [CrossRef] [Green Version]
- Che, L.; Xuan, Y.; Hu, L.; Liu, Y.; Xu, Q.; Fang, Z.; Lin, Y.; Xu, S.; Wu, D.; Zhang, K.; et al. Effect of postnatal nutrition restriction on the oxidative status of neonates with intrauterine growth restriction in a pig model. Neonatology 2015, 107, 93–99. [Google Scholar] [CrossRef]
- Feng, C.; Bai, K.; Wang, A.; Ge, X.; Zhao, Y.; Zhang, L.; Wang, T. Effects of dimethylglycine sodium salt supplementation on growth performance, hepatic antioxidant capacity, and mitochondria-related gene expression in weanling piglets born with low birth weight1. J. Anim. Sci. 2018, 96, 3791–3803. [Google Scholar] [CrossRef]
- Zhang, H.; Li, Y.; Wang, T. Antioxidant capacity and concentration of redox-active trace mineral in fully weaned intra-uterine growth retardation piglets. J. Anim. Sci. Biotechnol. 2015, 6, 48. [Google Scholar] [CrossRef] [Green Version]
- Aydan, B.; Nuray, B.; Ahmet, T.; Mustafa, K.; Ozdemir, H.; Ilker, D. Role of oxidative stress in intrauterine growth restriction. Gynecol. Obstet. Investig. 2007, 64, 187–192. [Google Scholar]
- Hozumi, M.; Fumiki, K.; James Douglas, E.; Masayuki, Y. Small Maf proteins serve as transcriptional cofactors for keratinocyte differentiation in the Keap1-Nrf2 regulatory pathway. Proc. Natl. Acad. Sci. USA 2004, 101, 6379–6384. [Google Scholar]
- Tsou, Y.H.; Shih, C.T.; Ching, C.H.; Huang, J.Y.; Jen, C.J.; Yu, L.; Kuo, Y.M.; Wu, F.S.; Chuang, J.I. Treadmill exercise activates Nrf2 antioxidant system to protect the nigrostriatal dopaminergic neurons from MPP+ toxicity. Exp. Neurol. 2015, 263, 50–62. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.M.; Johnson, J.A. An important role of Nrf2-ARE pathway in the cellular defense mechanism. J. Biochem. Mol. Biol. 2004, 37, 139–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, J.; Ren, W.; Liu, G.; Duan, J.; Yang, G.; Wu, L.; Li, T.; Yin, Y. Birth oxidative stress and the development of an antioxidant system in newborn piglets. Free Radic. Res. 2013, 47, 1027–1035. [Google Scholar] [CrossRef]
- Jintian, H.; Yu, N.; Fei, W.; Chao, W.; Tao, C.; Kaiwen, B.; Jingfei, Z.; Xiang, Z.; Lili, Z.; Tian, W. Dietary curcumin supplementation attenuates inflammation, hepatic injury and oxidative damage in a rat model of intra-uterine growth retardation. Br. J. Nutr. 2018, 122, 537–548. [Google Scholar]
- Tu, Y. The discovery of artemisinin (qinghaosu) and gifts from Chinese medicine. Nat. Med. 2011, 17, 1217–1220. [Google Scholar] [CrossRef]
- O′Neill, P.M. Medicinal chemistry: A worthy adversary for malaria. Nature 2004, 430, 838–839. [Google Scholar] [CrossRef]
- Xu, H.; He, Y.; Yang, X.; Liang, L.; Zhan, Z.; Ye, Y.; Lian, F.; Sun, L. Anti-malarial agent artesunate inhibits TNF-alpha-induced production of proinflammatory cytokines via inhibition of NF-kappaB and PI3 kinase/Akt signal pathway in human rheumatoid arthritis fibroblast-like synoviocytes. Rheumatology 2007, 46, 920–926. [Google Scholar] [CrossRef] [Green Version]
- Li, W.D.; Dong, Y.J.; Tu, Y.Y.; Lin, Z.B. Dihydroarteannuin ameliorates lupus symptom of BXSB mice by inhibiting production of TNF-alpha and blocking the signaling pathway NF-kappa B translocation. Int. Immunopharmacol. 2006, 6, 1243–1250. [Google Scholar] [CrossRef]
- Posner, G.H.; Ploypradith, P.; Parker, M.H.; O′Dowd, H.; Woo, S.H.; Northrop, J.; Krasavin, M.; Dolan, P.; Kensler, T.W.; Xie, S.; et al. Antimalarial, antiproliferative, and antitumor activities of artemisinin-derived, chemically robust, trioxane dimers. J. Med. Chem. 1999, 42, 4275–4280. [Google Scholar] [CrossRef]
- Yang, D.X.; Qiu, J.; Zhou, H.H.; Yu, Y.; Zhou, D.L.; Xu, Y.; Zhu, M.Z.; Ge, X.P.; Li, J.M.; Lv, C.J.; et al. Dihydroartemisinin alleviates oxidative stress in bleomycin-induced pulmonary fibrosis. Life Sci. 2018, 205, 176–183. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, L.; Zhou, G.; Liao, Z.; Ahmad, H.; Liu, W.; Wang, T. Dietary L-arginine supplementation improves the intestinal development through increasing mucosal Akt and mammalian target of rapamycin signals in intra-uterine growth retarded piglets. Br. J. Nutr. 2012, 108, 1371–1381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Onis, M.; Blossner, M.; Borghi, E.; Frongillo, E.A.; Morris, R. Estimates of global prevalence of childhood underweight in 1990 and 2015. JAMA 2004, 291, 2600–2606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.; Yao, Y.; Yu, B.; Mao, X.; Huang, Z.; Chen, D. Effect of folic acid supplementation on hepatic antioxidant function and mitochondrial-related gene expression in weanling intrauterine growth retarded piglets. Livest. Sci. 2012, 146, 123–132. [Google Scholar] [CrossRef]
- Posner, G.H.; Paik, I.; Sur, S.; McRiner, A.J.; Borstnik, K.; Xie, S.; Shapiro, T.A. Orally active, antimalarial, anticancer, artemisinin-derived trioxane dimers with high stability and efficacy. J. Med. Chem. 2003, 46, 1060–1065. [Google Scholar] [CrossRef] [PubMed]
- Lu, G.X.; Bian, D.F.; Ji, Y.; Guo, J.M.; Wei, Z.F.; Jiang, S.D.; Xia, Y.F.; Dai, Y. Madecassoside ameliorates bleomycin-induced pulmonary fibrosis in mice by downregulating collagen deposition. Phytother. Res. 2014, 28, 1224–1231. [Google Scholar] [CrossRef] [PubMed]
- Centini, G.; Kenanidis, A.; Rosignoli, L.; Scarinci, R.; Petraglia, F. P08.05: Intrauterine oxidative stress and Doppler flussimetry in fetuses with IUGR. Ultrasound Obstet. Gynecol. 2004, 24, 314. [Google Scholar]
- Pirinccioglu, A.G.; Pirinccioglu, M.; Gökalp, D.; Kizil, M.; Kizil, G. Malondialdehyde (MDA) and protein carbonyl (PCO) levels as biomarkers of oxidative stress in subjects with familial hypercholesterolemia. Clin. Biochem. 2010, 43, 1220–1224. [Google Scholar] [CrossRef]
- Fang, Y.; Yang, S.; Wu, G. Free radicals, antioxidants, and nutrition. Nutrition 2002, 18, 872–879. [Google Scholar] [CrossRef]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharm. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
Items | Content (%) |
---|---|
Ingredients (%) | |
Corn | 65.00 |
Soybean meal | 10.00 |
Fish meal | 4.00 |
Extruded soybean | 8.00 |
Whey power | 5.00 |
Fermented soybean meal | 4.00 |
Premix 1 | 4.00 |
Total | 100.00 |
Nutrient Level | |
Crude protein (%) | 18.15 |
Gross energy (MJ/kg) | 9.00 |
Digestible energy (MJ/kg) | 14.58 |
Metabolisable energy (MJ/kg) | 11.41 |
Lysine (%) | 1.30 |
Methionine (%) | 0.32 |
Methionine + Cystine (%) | 0.60 |
Threonine (%) | 0.83 |
Ca (%) | 0.71 |
Total phosphorus (%) | 0.72 |
Available phosphorus (%) | 0.27 |
Gene 1 | Accession Number | Sequences (5’–3’) | Product Length (bp) |
---|---|---|---|
GAPDH | NM_001206359.1 | F:TCGGAGTGAACGGATTTGGC | 189 |
R: TGACAAGCTTCCCGTTCTCC | |||
Nrf2 | XM_005671981.3 | F:GACTCAAGGGGTTGCGAAGG | 80 |
R: CCCAAACCCCAATCCCGTAG | |||
CAT | NM_214301.2 | F: CCTGCAACGTTCTGTAAGGC | 109 |
R: ATATCAGGTTTCTGCGCGGC | |||
SOD1 | NM_001190422.1 | F:TGAAGGGAGAGAAGACAGTGTTA | 130 |
R: GGATTGAAGTGAGGACCTGC | |||
GPx1 | NM_214201.1 | F: CTCATGACCGACCCCAAGTT | 128 |
R: GTCAGAAAGCGACGGCTGTA | |||
HO-1 | NM_001004027.1 | F: TGTACCGCTCCCGAATGAAC | 142 |
R: TGGTCCTTAGTGTCCTGGGT |
Item 1 | Experiment Groups | ||
---|---|---|---|
NBW | IUGR | ID | |
T-AOC (U/mL) | 1.316 ± 0.076 a,b | 1.233 ± 0.090 b | 1.604 ± 0.123 a |
T-SOD (U/mL) | 220.235 ± 11.695 a | 176.722 ± 7.423 b | 211.167 ± 4.501 a |
GSH-Px (U/mL) | 294.339 ± 3.551 a | 252.579 ± 3.345 b | 287.799 ± 5.507 a |
GSH (mg/L) | 8.725 ± 1.143 | 6.363 ± 1.028 | 5.838 ± 0.834 |
CAT (U/mL) | 6.835 ± 0.592 a | 3.674 ± 0.367 b | 6.248 ± 0.445 a |
MDA (nmol/mL) | 8.101 ± 0.578 b | 13.445 ± 0.832 a | 7.952 ± 0.463 b |
Item 1 | Experiment Groups | ||
---|---|---|---|
NBW | IUGR | ID | |
CAT (U/mg protein) | 12.856 ± 0.623 | 11.481 ± 0.196 | 12.091 ± 0.422 |
T-AOC (U/mg protein) | 1.207 ± 0.110 a | 0.800 ± 0.046 b | 1.009 ± 0.076 a,b |
T-SOD (U/mg protein) | 200.104 ± 8.91 a | 154.893 ± 4.273 b | 202.152 ± 7.650 a |
GSH-Px (U/mg protein) | 154.469 ± 7.100 a | 125.428 ± 3.605 b | 133.493 ± 5.228 b |
GSH (µmol/g protein) | 24.945 ± 1.669 a | 17.152 ± 0.817 c | 20.880 ± 0.706 b |
GSSG (µmol/g protein) | 31.26 ± 0.371 b | 39.755 ± 0.404 a | 31.998 ± 0.406 b |
GSSG:GSH | 1.355 ± 0.147 b | 2.191 ± 0.144 a | 1.658 ± 0.101 b |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Y.; Niu, Y.; He, J.; Zhang, L.; Wang, C.; Wang, T. Dietary Dihydroartemisinin Supplementation Attenuates Hepatic Oxidative Damage of Weaned Piglets with Intrauterine Growth Retardation through the Nrf2/ARE Signaling Pathway. Animals 2019, 9, 1144. https://doi.org/10.3390/ani9121144
Zhao Y, Niu Y, He J, Zhang L, Wang C, Wang T. Dietary Dihydroartemisinin Supplementation Attenuates Hepatic Oxidative Damage of Weaned Piglets with Intrauterine Growth Retardation through the Nrf2/ARE Signaling Pathway. Animals. 2019; 9(12):1144. https://doi.org/10.3390/ani9121144
Chicago/Turabian StyleZhao, Yongwei, Yu Niu, Jintian He, Lili Zhang, Chao Wang, and Tian Wang. 2019. "Dietary Dihydroartemisinin Supplementation Attenuates Hepatic Oxidative Damage of Weaned Piglets with Intrauterine Growth Retardation through the Nrf2/ARE Signaling Pathway" Animals 9, no. 12: 1144. https://doi.org/10.3390/ani9121144