The Morphology of Cross-Beaks and BMP4 Gene Expression in Huiyang Bearded Chickens
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Design
Classification of a Cross-Beak
2.3. Samplings
2.3.1. Morphology
2.3.2. Gene Expressions
2.4. Statistical Analyses
3. Results
3.1. Morphological Observations and Descriptions of the Five Subtypes of Cross-Beaks
3.2. The Effect of Cross-Beaks on Chicken Faces
3.3. The Relative Expression of BMP4 in Craniofacial Bone
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bai, H.; Zhu, J.; Sun, Y.; Liu, R.; Liu, N.; Li, D.; Wen, J.; Chen, J. Identification of genes related to beak deformity of chickens using digital gene expression profiling. PLoS ONE 2014, 9, e107050. [Google Scholar] [CrossRef] [PubMed]
- Bai, H.; Sun, Y.; Zhu, J.; Liu, N.; Li, D.; Xue, F.; Li, Y.; Chen, J. Study on LOC426217 as a candidate gene for beak deformity in chicken. BMC Genet. 2016, 17, 44. [Google Scholar] [CrossRef] [PubMed]
- Joller, S.; Bertschinger, F.; Kump, E.; Spiri, A.; von Rotz, A.; Schweizer-Gorgas, D.; Drogemuller, C.; Flury, C. Crossed beaks in a local Swiss chicken breed. BMC Vet. Res. 2018, 14, 68. [Google Scholar] [CrossRef] [PubMed]
- Landauer, W. Notes on cross-beak in fowl. J. GENET. 1938, 37, 51–68. [Google Scholar] [CrossRef]
- Landauer, W. Hereditary and induced cross-beak of fowl. Experiments with ethyl carbamate. J. EXP. ZOOL. 1956, 132, 25–38. [Google Scholar] [CrossRef]
- Blankenship, A.L.; Hilscherova, K.; Nie, M.; Coady, K.K.; Villalobos, S.A.; Kannan, K.; Powell, D.C.; Bursian, S.J.; Giesy, J.P. Mechanisms of TCDD-induced abnormalities and embryo lethality in white leghorn chickens. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2003, 136, 47–62. [Google Scholar] [CrossRef]
- Cooper, R.G.; Horbańczuk, J.O. Crooked beak in a 14-month-old ostrich (Struthio camelus) hen. J. S. Afr. Vet. Assoc. 2006, 77, 170. [Google Scholar] [CrossRef][Green Version]
- Smith, F.; Hu, D.; Young, N.M.; Lainoff, A.J.; Jamniczky, H.A.; Maltepe, E.; Hallgrimsson, B.; Marcucio, R.S. The effect of hypoxia on facial shape variation and disease phenotypes in chicken embryos. Dis. Model Mech. 2013, 6, 915–924. [Google Scholar] [CrossRef]
- Bai, H.; Sun, Y.; Liu, N.; Xue, F.; Li, Y.; Xu, S.; Ye, J.; Zhang, L.; Chen, Y.; Chen, J. Single SNP- and pathway-based genome-wide association studies for beak deformity in chickens using high-density 600K SNP arrays. BMC Genomics. 2018, 19, 501. [Google Scholar] [CrossRef]
- Bai, H.; Sun, Y.; Liu, N.; Liu, Y.; Xue, F.; Li, Y.; Xu, S.; Ni, A.; Ye, J.; Chen, Y.; et al. Genome-wide detection of CNVs associated with beak deformity in chickens using high-density 600K SNP arrays. Anim. Genet. 2018, 49, 226–236. [Google Scholar] [CrossRef]
- Barlow, A.J.; Francis-West, P.H. Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia. Development. 1997, 124, 391–398. [Google Scholar] [CrossRef] [PubMed]
- Wan, M.; Cao, X. BMP signaling in skeletal development. Biochem. Biophys. Res. Commun. 2005, 328, 651–657. [Google Scholar] [CrossRef] [PubMed]
- Abzhanov, A.; Protas, M.; Grant, B.R.; Grant, P.R.; Tabin, C.J. Bmp4 and morphological variation of beaks in Darwin’s finches. Science. 2004, 305, 1462–1465. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Jiang, T.X.; Suksaweang, S.; Widelitz, R.B.; Chuong, C.M. Molecular shaping of the beak. Science. 2004, 305, 1465–1466. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Selever, J.; Murali, D.; Sun, X.; Brugger, S.M.; Ma, L.; Schwartz, R.J.; Maxson, R.; Furuta, Y.; Martin, J.F. Threshold-specific requirements for Bmp4 in mandibular development. Dev. Biol. 2005, 283, 282–293. [Google Scholar] [CrossRef]
- Albertson, R.C.; Streelman, J.T.; Kocher, T.D.; Yelick, P.C. Integration and evolution of the cichlid mandible: The molecular basis of alternate feeding strategies. Proc. Natl. Acad. Sci. USA 2005, 102, 16287–16292. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Francis-West, P.; Ladher, R.; Barlow, A.; Graveson, A. Signaling interactions during facial development. Mech. Dev. 1998, 75, 3–28. [Google Scholar] [CrossRef]
- LaBonne, C.; Bronner-Fraser, M. Molecular mechanisms of neural crest formation. Annu Rev Cell Dev Biol. 1999, 15, 81–112. [Google Scholar] [CrossRef]
- Wilkie, A.O.; Morriss-Kay, G.M. Genetics of craniofacial development and malformation. Nat. Rev. Genet. 2001, 2, 458–468. [Google Scholar] [CrossRef]
- Enlow, D.H.; Azuma, M. Functional growth boundaries in the human and mammalian face. Birth Defects Orig. Artic. Ser. 1975, 11, 217–230. [Google Scholar] [PubMed]
- Alarcón, J.A.; Bastir, M.; García-Espona, I.; Menéndez-Núñez, M.; Rosas, A. Morphological integration of mandible and cranium: Orthodontic implications. Arch. Oral. Biol. 2014, 59, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Awad, A.M.; Gaballah, S.M.; Gomaa, N.E. Relationship between cranial base and jaw base in different skeletal patterns. Orthod. Waves. 2018, 77, 125–133. [Google Scholar] [CrossRef]
- Polanski, J.M. Morphological Integration of the Modern Human Mandible during Ontogeny. Int. J. Evol. Biol. 2011, 2011. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Grant, P.R. Patterns of Growth in Darwin’s Finches. Proc. R. Soc. Lond. B. Biol. Sci. 1981, 212, 403–432. [Google Scholar] [CrossRef]
- Stottmann, R.W.; Anderson, R.M.; Klingensmith, J. The BMP antagonists Chordin and Noggin have essential but redundant roles in mouse mandibular outgrowth. Dev. Biol. 2001, 240, 457–473. [Google Scholar] [CrossRef]
- Salazar, V.S.; Gamer, L.W.; Rosen, V. BMP signalling in skeletal development, disease and repair. Nat. Rev. Endocrinol. 2016, 12, 203–221. [Google Scholar] [CrossRef]
- Bandyopadhyay, A.; Yadav, P.S.; Prashar, P. BMP signaling in development and diseases: A pharmacological perspective. Biochem. Pharmacol. 2013, 85, 857–864. [Google Scholar] [CrossRef]
- Behesti, H.; Holt, J.K.; Sowden, J.C. The level of BMP4 signaling is critical for the regulation of distinct T-box gene expression domains and growth along the dorso-ventral axis of the optic cup. BMC Dev. Biol. 2006, 6, 62. [Google Scholar] [CrossRef]
- Gross, J.B.; Stahl, B.A.; Powers, A.K.; Carlson, B.M. Natural bone fragmentation in the blind cave-dwelling fish, Astyanax mexicanus: Candidate gene identification through integrative comparative genomics. Evol. Dev. 2016, 18, 7–18. [Google Scholar] [CrossRef]
- He, F.; Xiong, W.; Wang, Y.; Matsui, M.; Yu, X.; Chai, Y.; Klingensmith, J.; Chen, Y. Modulation of BMP signaling by Noggin is required for the maintenance of palatal epithelial integrity during palatogenesis. Dev. Biol. 2010, 347, 109–121. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Li, L.; Wang, Y.; Lin, M.; Yuan, G.; Yang, G.; Zheng, Y.; Chen, Y. Augmented BMPRIA-mediated BMP signaling in cranial neural crest lineage leads to cleft palate formation and delayed tooth differentiation. PLoS ONE 2013, 8, e66107. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Jia, H.; Bai, Y.; Wang, W. Bone morphogenetic protein 4 expression in the developing lumbosacral spinal cord of rat embryos with anorectal malformations. Int. J. Dev. Neurosci. 2018, 69, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Marazita, M.L.; Murray, J.C.; Lidral, A.C.; Arcos-Burgos, M.; Cooper, M.E.; Goldstein, T.; Maher, B.S.; Daack-Hirsch, S.; Schultz, R.; Mansilla, M.A.; et al. Meta-analysis of 13 genome scans reveals multiple cleft lip/palate genes with novel loci on 9q21 and 2q32-35. Am. J. Hum. Genet. 2004, 75, 161–173. [Google Scholar] [CrossRef] [PubMed]
- Jianyan, L.; Zeqiang, G.; Yongjuan, C.; Kaihong, D.; Bing, D.; Rongsheng, L. Analysis of interactions between genetic variants of BMP4 and environmental factors with nonsyndromic cleft lip with or without cleft palate susceptibility. Int. J. Oral Maxillofac. Surg. 2010, 39, 50–56. [Google Scholar] [CrossRef]
- Shijo, T.; Warita, H.; Suzuki, N.; Ikeda, K.; Mitsuzawa, S.; Akiyama, T.; Ono, H.; Nishiyama, A.; Izumi, R.; Kitajima, Y.; et al. Antagonizing bone morphogenetic protein 4 attenuates disease progression in a rat model of amyotrophic lateral sclerosis. Exp Neurol. 2018, 307, 164–179. [Google Scholar] [CrossRef]
- Shafritz, A.B.; Shore, E.M.; Gannon, F.H.; Zasloff, M.A.; Taub, R.; Muenke, M.; Kaplan, F.S. Overexpression of an osteogenic morphogen in fibrodysplasia ossificans progressiva. N. Engl. J. Med. 1996, 335, 555–561. [Google Scholar] [CrossRef]
- Kan, L.; Hu, M.; Gomes, W.A.; Kessler, J.A. Transgenic mice overexpressing BMP4 develop a fibrodysplasia ossificans progressiva (FOP)-like phenotype. Am. J. Pathol. 2004, 165, 1107–1115. [Google Scholar] [CrossRef]
- Wu, P.; Jiang, T.X.; Shen, J.Y.; Widelitz, R.B.; Chuong, C.M. Morphoregulation of avian beaks: Comparative mapping of growth zone activities and morphological evolution. Dev. Dyn. 2006, 235, 1400–1412. [Google Scholar] [CrossRef]
- Anderson, R.M.; Stottmann, R.W.; Choi, M.; Klingensmith, J. Endogenous bone morphogenetic protein antagonists regulate mammalian neural crest generation and survival. Dev. Dyn. 2006, 235, 2507–2520. [Google Scholar] [CrossRef]
- MacKenzie, B.; Wolff, R.; Lowe, N.; Billington, C.J.; Peterson, A.; Schmidt, B.; Graf, D.; Mina, M.; Gopalakrishnan, R.; Petryk, A. Twisted gastrulation limits apoptosis in the distal region of the mandibular arch in mice. Dev. Biol. 2009, 328, 13–23. [Google Scholar] [CrossRef]
- Chai, Y.; Jiang, X.B.; Ito, Y.; Bringas, P.; Han, J.; Rowitch, D.H.; Soriano, P.; McMahon, A.P.; Sucov, H.M. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development 2000, 127, 1671–1679. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Iseki, S.; Maxson, R.E.; Sucov, H.M.; Morriss-Kay, G.M. Tissue origins and interactions in the mammalian skull vault. Dev. Biol. 2002, 241, 106–116. [Google Scholar] [CrossRef] [PubMed]
- Minoux, M.; Rijli, F.M. Molecular mechanisms of cranial neural crest cell migration and patterning in craniofacial development. Development 2010, 137, 2605–2621. [Google Scholar] [CrossRef]
- Ealba, E.L.; Jheon, A.H.; Hall, J.; Curantz, C.; Butcher, K.D.; Schneider, R.A. Neural crest-mediated bone resorption is a determinant of species-specific jaw length. Dev. Biol. 2015, 408, 151–163. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′→3′) | Temperature (°C) | Product Length (bp) |
---|---|---|---|
BMP4 | F: AGCATCCCCAACATCCAGAA | 59 | 233 |
R: CAGAACTTGGAGGGCTGGTA | |||
GAPDH | F: CCTCTCTGGCAAAGTCCAAG | 57 | 200 |
R: CATCTGCCCATTTGATGTTG |
Type | Subtypes | Mean ± SD, Range (°) | No. 1 | Proportion (%) |
---|---|---|---|---|
Left cross-beak | Upper | 11.00 ± 8.04, (2–31) | 31 | 20.67 |
Lower | 8.59 ± 5.10, (2–20) | 32 | 21.33 | |
Right cross-beak | Upper | 12.23 ± 10.50, (2–45) | 16 | 10.66 |
Lower | 9.00 ± 6.02, (2–25) | 50 | 33.34 | |
Polarization cross-beak | Polarization | 12.24 ± 4.30, (6–26) | 21 | 14 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, Y.; Pang, Y.; Zhao, H.; Chen, S.; Tan, S.; Xiang, H.; Yu, H.; Li, H. The Morphology of Cross-Beaks and BMP4 Gene Expression in Huiyang Bearded Chickens. Animals 2019, 9, 1143. https://doi.org/10.3390/ani9121143
Hong Y, Pang Y, Zhao H, Chen S, Tan S, Xiang H, Yu H, Li H. The Morphology of Cross-Beaks and BMP4 Gene Expression in Huiyang Bearded Chickens. Animals. 2019; 9(12):1143. https://doi.org/10.3390/ani9121143
Chicago/Turabian StyleHong, Yuyu, Yuchang Pang, Haiquan Zhao, Siyu Chen, Shuwen Tan, Hai Xiang, Hui Yu, and Hua Li. 2019. "The Morphology of Cross-Beaks and BMP4 Gene Expression in Huiyang Bearded Chickens" Animals 9, no. 12: 1143. https://doi.org/10.3390/ani9121143
APA StyleHong, Y., Pang, Y., Zhao, H., Chen, S., Tan, S., Xiang, H., Yu, H., & Li, H. (2019). The Morphology of Cross-Beaks and BMP4 Gene Expression in Huiyang Bearded Chickens. Animals, 9(12), 1143. https://doi.org/10.3390/ani9121143