Improved Post-Thaw Quality of Canine Semen after Treatment with Exosomes from Conditioned Medium of Adipose-Derived Mesenchymal Stem Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals Used and Semen Preparation
2.2. Canine Ad-MSCs Culture and Conditioned Medium Preparation
2.3. Isolation of Exosomes
2.4. Transmission Electron Microscopy
2.5. Determination of Optimal Exosomal Protein Concentration
2.6. Freezing and Thawing of Sperm
2.7. Assessment of Sperm Plasma Membrane Integrity
2.8. Assessment of Acrosome Membrane Integrity
2.9. Mucus Penetration Test
2.10. Protamine Deficiency Test
2.11. Relative Quantitative polymerase chain reaction Analysis
2.12. Experimental Design
2.13. Statistical Analysis
3. Results
3.1. Determination of Optimum Exosomal Protein Concentration
3.2. Effect of Exosomes on Post-Thaw Sperm Motility, Kinematic Parameters, and Viability
3.3. Effect of Exosomes on the Integrity of the Plasma Membrane and Acrosome
3.4. Effect of Exosomes on Mucus Penetration
3.5. Effect of Exosomes on Chromatin Integrity and Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mokarizadeh, A.; Rezvanfar, M.A.; Dorostkar, K.; Abdollahi, M. Mesenchymal stem cell derived microvesicles: Trophic shuttles for enhancement of sperm quality parameters. Reprod. Toxicol. 2013, 42, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Michael, A.; Alexopoulos, C.; Pontiki, E.; Hadjipavlou-Litina, D.; Saratsis, P.; Boscos, C. Effect of antioxidant supplementation on semen quality and reactive oxygen species of frozen-thawed canine spermatozoa. Theriogenology 2007, 68, 204–212. [Google Scholar] [CrossRef] [PubMed]
- Park, B.J.; Lee, H.J.; Lee, S.L.; Rho, G.J.; Kim, S.J.; Lee, W.J. Establishment of normal reference data of analysis in the fresh and cryopreserved canine spermatozoa. J. Anim. Reprod. Biotechnol. 2018, 33, 75–84. [Google Scholar] [CrossRef]
- Esterhuizen, A.D.; Franken, D.R.; Lourens, J.G.; Prinsloo, E.; van Rooyen, L.H. Sperm chromatin packaging as an indicator of in-vitro fertilization rates. Hum. Reprod. 2000, 15, 657–661. [Google Scholar] [CrossRef] [PubMed]
- Holt, W.V.; Head, M.F.; North, R.D. Freeze-induced membrane damage in ram spermatozoa is manifested after thawing: Observations with experimental cryomicroscopy. Biol. Reprod. 1992, 46, 1086–1094. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Jeon, Y.; Yu, I.J. Effects of antioxidants supplementation in porcine sperm freezing on in vitro fertilization and the glutathione and reactive oxygen species level of presumptive zygotes. J. Anim. Reprod. Biotechnol. 2017, 32, 337–342. [Google Scholar]
- Woelders, H.; Matthijs, A.; Engel, B. Effects of trehalose and sucrose, osmolality of the freezing medium, and cooling rate on viability and intactness of bull sperm after freezing and thawing. Cryobiology 1997, 35, 93–105. [Google Scholar] [CrossRef]
- Yildiz, C.; Ottaviani, P.; Law, N.; Ayearst, R.; Liu, L.; McKerlie, C. Effects of cryopreservation on sperm quality, nuclear DNA integrity, in vitro fertilization, and in vitro embryo development in the mouse. Reproduction 2007, 133, 585–595. [Google Scholar] [CrossRef]
- Pena, A.I.; Barrio, M.; Becerra, J.J.; Quintela, L.A.; Herradon, P.G. Motile sperm subpopulations in frozen-thawed dog semen: Changes after incubation in capacitating conditions and relationship with sperm survival after osmotic stress. Anim. Reprod. Sci. 2012, 133, 214–223. [Google Scholar] [CrossRef]
- Naresh, S.; Atreja, S.K. The protein tyrosine phosphorylation during in vitro capacitation and cryopreservation of mammalian spermatozoa. Cryobiology 2015, 70, 211–216. [Google Scholar] [CrossRef]
- Hong, H.M.; Sim, G.Y.; Park, S.M.; Lee, E.J.; Kim, D.Y. Ameliorative effect of chitosan complex on miniature pig sperm cryopreservation. J. Anim. Reprod. Biotech. 2018, 33, 337–342. [Google Scholar] [CrossRef]
- Aitken, R.J.; De Iuliis, G.N. On the possible origins of DNA damage in human spermatozoa. Mol. Hum. Reprod. 2010, 16, 3–13. [Google Scholar] [CrossRef] [PubMed]
- Gadea, J.; Gumbao, D.; Canovas, S.; Garcia-Vazquez, F.A.; Grullon, L.A.; Gardon, J.C. Supplementation of the dilution medium after thawing with reduced glutathione improves function and the in vitro fertilizing ability of frozen-thawed bull spermatozoa. Int. J. Androl. 2008, 31, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Uysal, O.; Bucak, M. Effects of oxidized glutathione, bovine serum albumin, cysteine and lycopene on the quality of frozen-thawed ram semen. Acta Vet. Brno 2007, 76, 383–390. [Google Scholar] [CrossRef]
- Raposo, G.; Stoorvogel, W. Extracellular vesicles: Exosomes, microvesicles, and friends. J. Cell Biol. 2013, 200, 373–383. [Google Scholar] [CrossRef] [Green Version]
- D’Souza-Schorey, C.; Clancy, J.W. Tumor-derived microvesicles: Shedding light on novel microenvironment modulators and prospective cancer biomarkers. Genes Dev. 2012, 26, 1287–1299. [Google Scholar] [CrossRef]
- Simons, M.; Raposo, G. Exosomes-vesicular carriers for intercellular communication. Curr. Opin. Cell Biol. 2009, 21, 575–581. [Google Scholar] [CrossRef]
- Fujita, Y.; Yoshioka, Y.; Ochiya, T. Extracellular vesicle transfer of cancer pathogenic components. Cancer Sci. 2016, 107, 385–390. [Google Scholar] [CrossRef] [Green Version]
- Kim, W.S.; Park, B.S.; Sung, J.H.; Yang, J.M.; Park, S.B.; Kwak, S.J.; Park, J.S. Wound healing effect of adipose-derived stem cells: A critical role of secretory factors on human dermal fibroblasts. J. Dermatol. Sci. 2007, 48, 15–24. [Google Scholar] [CrossRef]
- Siciliano, L.; Marcianò, V.; Carpino, A. Prostasomes-like vesicles stimulates acrosome reaction of pig spermatozoa. Reprod. Biol. Endocrinol. 2008, 6. [Google Scholar] [CrossRef]
- Overath, J.M.; Gauer, S.; Obermuller, N.; Schubert, R.; Schafer, R.; Geiger, H.; Baer, P.C. Short-term preconditioning enhances the therapeutic potential of adipose-derived stromal/stem cell-conditioned medium in cisplatin-induced acute kidney injury. Exp. Cell Res. 2016, 342, 175–183. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Oh, H.J.; Kim, M.J.; Lee, B.C. Exosomes derived from oviduct cells mediate the EGFR/MAPK signaling pathway in cumulus cells. J.Cell. Physiol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Khan, J.; Tahir, M.; Khalid, A.; Sattar, A.; Ahmad, N. Effect of cholesterol-loaded cyclodextrins on cryosurvival of dog spermatozoa. Reprod. Domest. Anim. 2017, 52, 265–268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petrunkina, A.M.; Gropper, B.; Gunzel-Apel, A.R.; Topfer-Petersen, E. Functional significance of the cell volume for detecting sperm membrane changes and predicting freezability in dog semen. Reproduction 2004, 128, 829–842. [Google Scholar] [CrossRef] [PubMed]
- Bianchi, P.G.; Manicardi, G.C.; Urner, F.; Campana, A.; Sakkas, D. Chromatin packaging and morphology in ejaculated human spermatozoa: Evidence of hidden anomalies in normal spermatozoa. Mol. Hum. Reprod. 1996, 2, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Iranpour, F.G.; Nasr-Esfahani, M.H.; Valojerdi, M.R.; al-Taraihi, T.M. Chromomycin A3 staining as a useful tool for evaluation of male fertility. J. Assist. Reprod. Genet. 2000, 17, 60–66. [Google Scholar] [CrossRef] [PubMed]
- Caplan, A.I. What’s in a name? Tissue Eng. Part A 2010, 16, 2415–2417. [Google Scholar] [CrossRef]
- Caplan, A.I.; Correa, D. The MSC: An injury drugstore. Cell Stem Cell 2011, 9, 11–15. [Google Scholar] [CrossRef]
- Du, J.; Shen, J.; Wang, Y.; Pan, C.; Pang, W.; Diao, H.; Dong, W. Boar seminal plasma exosomes maintain sperm function by infiltrating into the sperm membrane. Oncotarget 2016, 7, 58832–58847. [Google Scholar] [CrossRef] [Green Version]
- Ferraz, M.; Carothers, A.; Dahal, R.; Noonan, M.J.; Songsasen, N. Oviductal extracellular vesicles interact with the spermatozoon’s head and mid-piece and improves its motility and fertilizing ability in the domestic cat. Sci. Rep. 2019, 9, 9484. [Google Scholar] [CrossRef]
- Nishigaki, T.; Jose, O.; Gonzalez-Cota, A.L.; Romero, F.; Trevino, C.L.; Darszon, A. Intracellular pH in sperm physiology. Biochem. Biophys. Res. Commun. 2014, 450, 1149–1158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnston, R.C.; Mbizvo, M.T.; Summerbell, D.; Kovacs, G.T.; Baker, H.W. Relationship between stimulated hyperactivated motility of human spermatozoa and pregnancy rate in donor insemination: A preliminary report. Hum. Reprod. 1994, 9, 1684–1687. [Google Scholar] [CrossRef] [PubMed]
- Aitken, R.J. Sperm function tests and fertility. Int. J. Androl. 2006, 29, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Muino-Blanco, T.; Perez-Pe, R.; Cebrian-Perez, J.A. Seminal plasma proteins and sperm resistance to stress. Reprod. Domest. Anim. 2008, 43 (Suppl. 4), 18–31. [Google Scholar] [CrossRef] [PubMed]
- Hammerstedt, R.H.; Graham, J.K.; Nolan, J.P. Cryopreservation of mammalian sperm: What we ask them to survive. J. Androl. 1990, 11, 73–88. [Google Scholar] [PubMed]
- Shin, J.A.; Chung, J.S.; Cho, S.-H.; Kim, H.J.; Do Yoo, Y. Romo1 expression contributes to oxidative stress-induced death of lung epithelial cells. Biochem. Biophys. Res. Commun. 2013, 439, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Draeger, A.; Monastyrskaya, K.; Babiychuk, E.B. Plasma membrane repair and cellular damage control: The annexin survival kit. Biochem. Pharm. 2011, 81, 703–712. [Google Scholar] [CrossRef]
- To, W.S.; Midwood, K.S. Plasma and cellular fibronectin: Distinct and independent functions during tissue repair. Fibrogen Tissue Rep. 2011, 4, 21. [Google Scholar] [CrossRef]
- Diaz, E.S.; Kong, M.; Morales, P. Effect of fibronectin on proteasome activity, acrosome reaction, tyrosine phosphorylation and intracellular calcium concentrations of human sperm. Hum. Reprod. 2007, 22, 1420–1430. [Google Scholar] [CrossRef] [Green Version]
- Martinez-Leon, E.; Osycka-Salut, C.; Signorelli, J.; Pozo, P.; Perez, B.; Kong, M.; Morales, P.; Perez-Martinez, S.; Diaz, E.S. Fibronectin stimulates human sperm capacitation through the cyclic AMP/protein kinase A pathway. Hum. Reprod. 2015, 30, 2138–2151. [Google Scholar] [CrossRef] [Green Version]
- Thys, M.; Nauwynck, H.; Maes, D.; Hoogewijs, M.; Vercauteren, D.; Rijsselaere, T.; Favoreel, H.; Van Soom, A. Expression and putative function of fibronectin and its receptor (integrin alpha(5)beta(1)) in male and female gametes during bovine fertilization in vitro. Reproduction 2009, 138, 471–482. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Wang, X.; Liang, D.; Gordon, J.; Mittal, A.; Manley, N.; Degenhardt, K.; Astrof, S. Fibronectin signals through integrin alpha5beta1 to regulate cardiovascular development in a cell type-specific manner. Dev. Biol. 2015, 407, 195–210. [Google Scholar] [CrossRef] [PubMed]
- Simon, L.; Murphy, K.; Shamsi, M.B.; Liu, L.; Emery, B.; Aston, K.I.; Hotaling, J.; Carrell, D.T. Paternal influence of sperm DNA integrity on early embryonic development. Hum. Reprod. 2014, 29, 2402–2412. [Google Scholar] [CrossRef] [PubMed]
- Aitken, R.J.; Baker, M.A.; Sawyer, D. Oxidative stress in the male germ line and its role in the aetiology of male infertility and genetic disease. Reprod. Biomed. Online 2003, 7, 65–70. [Google Scholar] [CrossRef]
- Fraga, C.G.; Motchnik, P.A.; Wyrobek, A.J.; Rempel, D.M.; Ames, B.N. Smoking and low antioxidant levels increase oxidative damage to sperm DNA. Mutat. Res. 1996, 351, 199–203. [Google Scholar] [CrossRef]
- Carrell, D.T.; Liu, L.; Peterson, C.M.; Jones, K.P.; Hatasaka, H.H.; Erickson, L.; Campbell, B. Sperm DNA fragmentation is increased in couples with unexplained recurrent pregnancy loss. Arch. Androl. 2003, 49, 49–55. [Google Scholar] [CrossRef]
- Nagai, A.; Sato, T.; Akimoto, N.; Ito, A.; Sumida, M. Isolation and identification of histone H3 protein enriched in microvesicles secreted from cultured sebocytes. Endocrinology 2005, 146, 2593–2601. [Google Scholar] [CrossRef]
- Ma, C.; Chen, H.; Zhang, S.; Yan, Y.; Wu, R.; Wang, Y.; Liu, Y.; Yang, L.; Liu, M. Exosomal and extracellular HMGB1 have opposite effects on SASH1 expression in rat astrocytes and glioma C6 cells. Biochem. Biophys. Res. Commun. 2019, 518, 325–330. [Google Scholar] [CrossRef]
- Malik, H.S.; Henikoff, S. Phylogenomics of the nucleosome. Nat. Struct. Biol. 2003, 10, 882–891. [Google Scholar] [CrossRef]
- Lange, S.S.; Vasquez, K.M. HMGB1: The jack-of-all-trades protein is a master DNA repair mechanic. Mol. Carcinog. 2009, 48, 571–580. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence (5′-3′) | Product Size (bp) | NCBI Accession No. |
---|---|---|---|
BACT | F: GAGGCATCCTGACTCTGA | 87 | XM_544346.3 |
R: TCTGGCACCACACTTTCT | |||
ANX1 | F: GAAGCTCTGAAGAAAGCCC | 128 | NM_001286970.1 |
R: GTGTCTTCATCAGTTCCAAGG | |||
DYSF | F: TGGATCAGAGTGGCGTCC | 127 | XM_003432223.4 |
R: GACAGCAGCTTTCTGGCT | |||
FN1 | F: ATAGCTGGCTGTTACGAC | 74 | XM_022415242.1 |
R: GCATTTCCCAGGTAGGTG | |||
H3 | F: CGGTGACTGACACGCGAC | 136 | XM_022404950.1 |
R: GGTTCAAGGCCTGCTCCAAC | |||
HMGB | F: ATATTGCTGCGTACCGAG | 64 | XM_022409535.1 |
R: TCAGCCTTGACAACTCCC | |||
ROMO1 | F: CTACGTGCTCCCGGAAGT | 100 | XM_534406.6 |
R: TCGCTCAGTTCTACGTCTCAC |
Groups | Motility (%) | Linearity (%) | Straightness (%) | ALH (µm) | Live sperm (%) |
---|---|---|---|---|---|
Control | 75.1 ± 0.6 b | 26.4 ± 1.0 | 47.1 ± 0.7 | 4.4 ± 0.3 | 67.9 ± 0.3 a |
25 µg/ mL | 73.8 ± 0.3 b | 24.5 ± 0.6 | 45.9 ± 0.7 | 4.7 ± 0.1 | 64.8 ± 3.5 b |
50 µg/ mL | 77.8 ± 0.2 a | 26.3 ± 0.3 | 47.5 ± 1.1 | 5.0 ± 0.1 | 68.6 ± 0.1 a |
100 µg/ mL | 73.9 ± 0.5 b | 26.6 ± 0.9 | 46.2 ± 1.6 | 4.7 ± 0.1 | 64.9 ± 0.3 b |
Group | Motility (%) | Linearity (%) | Straightness (%) | ALH (µm) | Live Sperm (%) | Membrane Integrity (%) |
---|---|---|---|---|---|---|
Control | 47.2 ± 0.3 b | 26.8 ± 1.0 | 51.6 ± 0.5 | 2.5 ± 0.0 b | 45.4 ± 0.4 b | 47.8 ± 0.3 b |
Treatment (50 µg/mL) | 56.8 ± 0.3 a | 28.8 ± 1.3 | 50.5 ± 0.6 | 3.2 ± 0.0 a | 55.9 ± 0.4 a | 55.6 ± 0.5 a |
Groups | Integrity of Acrosome (%) | Number of Sperm Penetrating Mucus | |
---|---|---|---|
1 cm | 3 cm | ||
Control | 48.6 ± 0.4 b | 136.5 ± 0.6 b | 47.7 ± 0.4 b |
Treatment (50 µg/mL) | 60.4 ± 1.1 a | 151.0 ± 0.6 a | 59.2 ± 0.3 a |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qamar, A.Y.; Fang, X.; Kim, M.J.; Cho, J. Improved Post-Thaw Quality of Canine Semen after Treatment with Exosomes from Conditioned Medium of Adipose-Derived Mesenchymal Stem Cells. Animals 2019, 9, 865. https://doi.org/10.3390/ani9110865
Qamar AY, Fang X, Kim MJ, Cho J. Improved Post-Thaw Quality of Canine Semen after Treatment with Exosomes from Conditioned Medium of Adipose-Derived Mesenchymal Stem Cells. Animals. 2019; 9(11):865. https://doi.org/10.3390/ani9110865
Chicago/Turabian StyleQamar, Ahmad Yar, Xun Fang, Min Jung Kim, and Jongki Cho. 2019. "Improved Post-Thaw Quality of Canine Semen after Treatment with Exosomes from Conditioned Medium of Adipose-Derived Mesenchymal Stem Cells" Animals 9, no. 11: 865. https://doi.org/10.3390/ani9110865