Growth Performance, Antioxidant Capacity, Lipid-Related Transcript Expression and the Economics of Broiler Chickens Fed Different Levels of Rutin
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds, Diets and Management
2.2. Experimental Design
2.3. Performance Traits
2.4. Sample Collection
2.5. Hematological Evaluation
2.6. Serum Biochemical Indices and Antioxidant Capacity
2.7. Antioxidant and Lipid-Related Gene Expression in the Liver by RQ-PCR
2.8. Economic Efficiency of Diet
2.9. Statistical Analysis
3. Results
3.1. Effect of Dietary Rutin on Performance Traits
3.2. Effect of Dietary Rutin on Hematological Parameters
3.3. Effect of Dietary Rutin on Serum Biochemical Indices and Antioxidant Capacity
3.4. Effect of Dietary Rutin on Antioxidant and Lipid-Related Gene Expression
3.5. Effect of Dietary Rutin on Economic Efficiency
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Jahromi, M.F.; Altaher, Y.W.; Shokryazdan, P.; Ebrahimi, R.; Ebrahimi, M.; Idrus, Z.; Goh, Y.M.; Tufarelli, V.; Liang, J.B. Dietary supplementation of a mixture of lactobacillus strains enhances performance of broiler chickens raised under heat stress conditions. Int. J. Biometeorol. 2016, 60, 1099–1110. [Google Scholar] [CrossRef]
- Surai, P. Polyphenol compounds in the chicken/animal diet: From the past to the future. J. Anim. Physiol. Anim. Nutr. 2014, 98, 19–31. [Google Scholar] [CrossRef] [PubMed]
- Tufarelli, V.; Casalino, E.; D’Alessandro, A.G.; Laudadio, V. Dietary phenolic compounds: Biochemistry, metabolism and significance in animal and human health. Curr. Drug Metab. 2017, 18, 905–913. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Kumar, S.; Tripathi, M.; Mehta, N.; Ranjan, R.; Bhat, Z.; Singh, P.K. Flavonoids in the development of functional meat products: A review. Vet. World 2013, 6, 573–578. [Google Scholar] [CrossRef]
- Aherne, S.A.; O’Brien, N.M. Dietary flavonols: Chemistry, food content, and metabolism. Nutrition 2002, 18, 75–81. [Google Scholar] [CrossRef]
- Boyle, S.; Dobson, V.; Duthie, S.J.; Hinselwood, D.; Kyle, J.; Collins, A. Bioavailability and efficiency of rutin as an antioxidant: A human supplementation study. Eur. J. Clin. Nutr. 2000, 54, 774–782. [Google Scholar] [CrossRef]
- Yoo, H.; Ku, S.-K.; Baek, Y.-D.; Bae, J.-S. Anti-inflammatory effects of rutin on HMGB1-induced inflammatory responses in vitro and in vivo. Inflamm. Res. 2014, 63, 197–206. [Google Scholar] [CrossRef]
- Alonso-Castro, A.J.; Domínguez, F.; García-Carrancá, A. Rutin exerts antitumor effects on nude mice bearing SW480 tumor. Archiv. Med. Res. 2013, 44, 346–351. [Google Scholar] [CrossRef]
- Pu, F.; Mishima, K.; Irie, K.; Motohashi, K.; Tanaka, Y.; Orito, K.; Egawa, T.; Kitamura, Y.; Egashira, N.; Iwasaki, K. Neuroprotective effects of quercetin and rutin on spatial memory impairment in an 8-arm radial maze task and neuronal death induced by repeated cerebral ischemia in rats. J. Pharmacol. Sci. 2007, 104, 329–334. [Google Scholar] [CrossRef]
- Mellou, F.; Loutrari, H.; Stamatis, H.; Roussos, C.; Kolisis, F.N. Enzymatic esterification of flavonoids with unsaturated fatty acids: Effect of the novel esters on vascular endothelial growth factor release from K562 cells. Process Biochem. 2006, 41, 2029–2034. [Google Scholar] [CrossRef]
- Mendes-Junior, L.d.G.; Monteiro, M.M.; Carvalho Ados, S.; Queiroz, T.M.; Braga Vde, A. Oral supplementation with the rutin improves cardiovagal baroreflex sensitivity and vascular reactivity in hypertensive rats. Appl. Physiol. Nutr. Metab. 2013, 38, 1099–1106. [Google Scholar] [CrossRef] [PubMed]
- Dubey, S.; Ganeshpurkar, A.; Shrivastava, A.; Bansal, D.; Dubey, N. Rutin exerts antiulcer effect by inhibiting the gastric proton pump. Ind. J. Pharmacol. 2013, 45, 415. [Google Scholar]
- AOAC. Official Methods of Analysis of AOAC International, 17th ed.; AOAC: Gaithersburg, MD, USA, 2000. [Google Scholar]
- Wagner, D.; Furrow, R.; Bradley, B. Subchronic toxicity of monensin in broiler chickens. Vet. Pathol. 1983, 20, 353–359. [Google Scholar] [CrossRef] [PubMed]
- McDonald, P.; Edwards, R.A.; Greenhalgh, J.F.D. Animal Nutrition, 4th ed.; Longman Group: Hongkong, China, 1988. [Google Scholar]
- Brody, S. Bioenergetics and Growth: With Special Reference to the Efficiency Complex in Domestic Animals; Reinhold Publishing Corporation: New York, NY, USA, 1945. [Google Scholar]
- Feldman, B.F.; Zinkl, J.G.; Jain, N.C. Schalm’s Veterinary Hematology, 5th ed.; Lippincott: London, UK, 2000. [Google Scholar]
- Dacie, J.V.; Lewis, S.M. Practical Haematology; Churchill Livingstone: Edinburgh, UK; New York, NY, USA, 1991. [Google Scholar]
- Placer, Z.A.; Cushman, L.L.; Johnson, B.C. Estimation of product of lipid peroxidation (malonyl dialdehyde) in biochemical systems. Anal. Biochem. 1966, 16, 359–364. [Google Scholar] [CrossRef]
- Sun, Y.; Oberley, L.W.; Li, Y. A simple method for clinical assay of superoxide dismutase. Clin. Chem. 1988, 34, 497–500. [Google Scholar] [PubMed]
- Cowell, D.; Dowman, A.; Lewis, R.; Pirzad, R.; Watkins, S. The rapid potentiometric detection of catalase positive microorganisms. Biosens. Bioelectron. 1994, 9, 131–138. [Google Scholar] [CrossRef]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-transferases the first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef]
- Awad, W.; Ghareeb, K.; Böhm, J. Evaluation of the chicory inulin efficacy on ameliorating the intestinal morphology and modulating the intestinal electrophysiological properties in broiler chickens. J. Anim. Physiol. Nutr. 2011, 95, 65–72. [Google Scholar] [CrossRef]
- Viveros, A.; Chamorro, S.; Pizarro, M.; Arija, I.; Centeno, C.; Brenes, A. Effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. Poultry Sci. 2011, 90, 566–578. [Google Scholar] [CrossRef]
- Ouyang, K.; Xu, M.; Jiang, Y.; Wang, W. Effects of alfalfa flavonoids on broiler performance, meat quality, and gene expression. Can. J. Anim. Sci. 2016, 96, 332–341. [Google Scholar] [CrossRef]
- Xie, B.-X.; Min-hong, Z. Effect of flavonoid on lipid metabolism and production performance of broilers. Acta Zoonut. Sin. 2002, 4, 12. [Google Scholar]
- Starčević, K.; Krstulović, L.; Brozić, D.; Maurić, M.; Stojević, Z.; Mikulec, Ž.; Bajić, M.; Mašek, T. Production performance, meat composition and oxidative susceptibility in broiler chicken fed with different phenolic compounds. J. Sci. Food Agric. 2015, 95, 1172–1178. [Google Scholar] [CrossRef] [PubMed]
- Koehler, B. Organic Hog Production Using Several Organic Feed Diets. Research Report; Southwest Research and Outreach Center (SWROC) of the University of Minnesota: Minneapolis, MN, USA, 2002. [Google Scholar]
- Islam, M.; Siddiqui, M.; Sayed, M.; Tahjib-Ul-Arif, M.; Islam, M.; Hossain, M. Dietary effects of buckwheat (Fagopyrum esculentum) and black cumin (Nigella sativa) seed on growth performance, serum lipid profile and intestinal microflora of broiler chicks. S. Afr. J. Anim. Sci. 2016, 46, 103–111. [Google Scholar] [CrossRef]
- Sayed, M.; Islam, M.; Haque, M.; Shah, M.; Ahmed, R.; Siddiqui, M.; Hossain, M. Dietary effects of chitosan and buckwheat (Fagopyrum esculentum) on the performance and serum lipid profile of broiler chicks. S. Afr. J. Anim. Sci. 2015, 45, 429–440. [Google Scholar] [CrossRef]
- Dmoch, M.; Polonis, A. Effect of vitamin C with rutin and herbal mixture supplements on chosen hematological and biochemical blood parameters and production results of slaughter turkeys. Annal. UMCS Zootech. 2011, 2, 32–43. [Google Scholar] [CrossRef]
- Pês, T.S.; Saccol, E.M.; Ourique, G.M.; Londero, É.P.; Gressler, L.T.; Finamor, I.A.; Rotili, D.A.; Golombieski, J.I.; Glanzner, W.G.; Llesuy, S.F. Effect of diets enriched with rutin on blood parameters, oxidative biomarkers and pituitary hormone expression in silver catfish (Rhamdia quelen). Fish Physiol. Biochem. 2016, 42, 321–333. [Google Scholar] [CrossRef]
- Kanashiro, A.; Andrade, D.C.; Kabeya, L.M.; Turato, W.M.; Faccioli, L.H.; Uyemura, S.A.; Lucisano-Valim, Y.M. Modulatory effects of rutin on biochemical and hematological parameters in hypercholesterolemic Golden Syrian hamsters. Anais Academia Brasileira Ciências 2009, 81, 67–72. [Google Scholar] [CrossRef]
- Hong, J.C.; Steiner, T.; Aufy, A.; Lien, T.F. Effects of supplemental essential oil on growth performance, lipid metabolites and immunity, intestinal characteristics, microbiota and carcass traits in broilers. Livest. Sci. 2012, 144, 253–262. [Google Scholar] [CrossRef]
- Mahmoud, S.S.; Dekinesh, S.I.; Ahmed, M.A. Medicago sativa seeds as a natural source of isoflavones to counteract the toxicity of contaminated broiler rations. Glob. J. Pharmacol. 2014, 8, 437–443. [Google Scholar]
- Cervantes-Laurean, D.; Schramm, D.D.; Jacobson, E.L.; Halaweish, I.; Bruckner, G.G.; Boissonneault, G.A. Inhibition of advanced glycation end product formation on collagen by rutin and its metabolites. J. Nutr. Biochem. 2006, 17, 531–540. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Pan, R.; Ding, L.; Zhang, F.; Hu, L.; Ding, B.; Zhu, L.; Xia, Y.; Dou, X. Rutin exhibits hepatoprotective effects in a mouse model of non-alcoholic fatty liver disease by reducing hepatic lipid levels and mitigating lipid-induced oxidative injuries. Int. Immunopharmacol. 2017, 49, 132–141. [Google Scholar] [CrossRef] [PubMed]
- Ahmadipour, B.; Hassanpour, H.; Rafiei, F.; Khajali, F. Antioxidative, antihyperlipidemic, and growth-promoting effects of Kelussia odoratissima in meat-type chickens. Poultry Sci. J. 2015, 3, 37–46. [Google Scholar]
- Chuffa, L.G.A.; Fioruci-Fontanelli, B.A.; Bordon, J.G.; Pires, R.B.; Braga, C.P.; Seiva, F.R.; Fernandes, A.A.H. Rutin ameliorates glycemic index, lipid profile and enzymatic activities in serum, heart and liver tissues of rats fed with a combination of hypercaloric diet and chronic ethanol consumption. Ind. J. Biochem. Biophys. 2014, 51, 215–222. [Google Scholar]
- Cavallini, D.C.; Bedani, R.; Bomdespacho, L.Q.; Vendramini, R.C.; Rossi, E.A. Effects of probiotic bacteria, isoflavones and simvastatin on lipid profile and atherosclerosis in cholesterol-fed rabbits: A randomized double-blind study. Lipid. Health Dis. 2009, 8, 1. [Google Scholar] [CrossRef] [PubMed]
- Skibola, C.F.; Smith, M.T. Potential health impacts of excessive flavonoid intake. Free Radic. Biol. Med. 2000, 29, 375–383. [Google Scholar] [CrossRef]
- Jiang, M.; Ma, H.; Zhong, X.; Xie, F.; Zeng, W. Effects of Erk signal transduction on the cell cycle of rat hepatic stellate cells stimulated by acetaldehyde. Chin. J. Hepatol. 2003, 11, 650–653. [Google Scholar]
- Al-Rejaie, S.S.; Aleisa, A.M.; Sayed-Ahmed, M.M.; AL-Shabanah, O.A.; Abuohashish, H.M.; Ahmed, M.M.; Al-Hosaini, K.A.; Hafez, M.M. Protective effect of rutin on the antioxidant genes expression in hypercholestrolemic male Westar rat. BMC Complement. Altern. Med. 2013, 13, 136. [Google Scholar] [CrossRef] [PubMed]
- Janbaz, K.H.; Saeed, S.A.; Gilani, A.H. Protective effect of rutin on paracetamol-and CCl4-induced hepatotoxicity in rodents. Fitoterapia 2002, 73, 557–563. [Google Scholar] [CrossRef]
- Alsaif, M.A. Beneficial effects of rutin and vitamin C coadministration in a streptozotocin-induced diabetes rat model of kidney nephrotoxicity. Pak. J. Nutr. 2009, 8, 745–754. [Google Scholar] [CrossRef]
- Silan, C.; Uzun, Ö.; Çomunoglu, N.Ü.; Gokçen, S.; Bedirhan, S.; Cengiz, M. Gentamicin-induced nephrotoxicity in rats ameliorated and healing effects of resveratrol. Biol. Pharm. Bull. 2007, 30, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Tufarelli, V.; Rizzo, A.; Lacalandra, G.M.; Guaricci, A.C.; Laudadio, V.; Valentini, L. Effects of the supplementation with a high-polyphenols extra-virgin olive oil on kinetic sperm features and seminal plasma oxidative status in healthy dogs. Reprod. Domest. Anim. 2018, 53, 582–587. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.; Jiang, S.; Lin, Y.; Xi, P.; Yu, D.; Wu, T. Effects of soybean isoflavone on growth performance, meat quality, and antioxidation in male broilers. Poultry Sci. 2007, 86, 1356–1362. [Google Scholar] [CrossRef] [PubMed]
- Kamboh, A.; Zhu, W.-Y. Effect of increasing levels of bioflavonoids in broiler feed on plasma anti-oxidative potential, lipid metabolites, and fatty acid composition of meat. Poultry Sci. 2013, 92, 454–461. [Google Scholar] [CrossRef] [PubMed]
- Lien, T.F.; Yeh, H.S.; Su, W.T. Effect of adding extracted hesperetin, naringenin and pectin on egg cholesterol, serum traits and antioxidant activity in laying hens. Arch. Anim. Nutr. 2008, 62, 33–43. [Google Scholar] [CrossRef] [PubMed]
- Jeon, S.-M.; Bok, S.-H.; Jang, M.-K.; Lee, M.-K.; Nam, K.-T.; Park, Y.B.; Rhee, S.-J.; Choi, M.-S. Antioxidative activity of naringin and lovastatin in high cholesterol-fed rabbits. Life Sci. 2001, 69, 2855–2866. [Google Scholar] [CrossRef]
- Ting, S.; Yeh, H.; Lien, T. Effects of supplemental levels of hesperetin and naringenin on egg quality, serum traits and antioxidant activity of laying hens. Anim. Feed Sci. Technol. 2011, 163, 59–66. [Google Scholar] [CrossRef]
- Kim, H.-J.; Oh, G.T.; Park, Y.B.; Lee, M.-K.; Seo, H.-J.; Choi, M.-S. Naringin alters the cholesterol biosynthesis and antioxidant enzyme activities in LDL receptor-knockout mice under cholesterol fed condition. Life Sci. 2004, 74, 1621–1634. [Google Scholar] [CrossRef] [PubMed]
- Aliaga, C.; Lissi, E.A. Comparison of the free radical scavenger activities of quercetin and rutin: An experimental and theoretical study. Can. J. Chem. 2004, 82, 1668–1673. [Google Scholar] [CrossRef]
- Prior, R.L.; Wu, X.; Schaich, K. Standardized methods for the determination of antioxidant capacity and phenolics in foods and dietary supplements. J. Agric. Food Chem. 2005, 53, 4290–4302. [Google Scholar] [CrossRef]
- Yang, J.; Guo, J.; Yuan, J. In vitro antioxidant properties of rutin. LWT-Food Sci. Technol. 2008, 41, 1060–1066. [Google Scholar] [CrossRef]
- Zielinska, D.; Szawara-Nowak, D.; Zielinski, H. Determination of the antioxidant activity of rutin and its contribution to the antioxidant capacity of diversified buckwheat origin material by updated analytical strategies. Pol. J. Food Nutr. Sci. 2010, 60, 315–321. [Google Scholar]
- Yuan, Z.; Zhang, K.; Ding, X.; Luo, Y.; Bai, S.; Zeng, Q.; Wang, J. Effect of tea polyphenols on production performance, egg quality, and hepatic antioxidant status of laying hens in vanadium-containing diets. Poultry Sci. 2016, 95, 1709–1717. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Yang, X.; Guo, Y.; Long, F. Effects of dietary lipids and Clostridium butyricum on serum lipids and lipid-related gene expression in broiler chickens. Animal 2011, 5, 1909–1915. [Google Scholar] [CrossRef] [PubMed]
- Richards, M.P.; Poch, S.M.; Coon, C.N.; Rosebrough, R.W.; Ashwell, C.M.; McMurtry, J.P. Feed restriction significantly alters lipogenic gene expression in broiler breeder chickens. J. Nutr. 2003, 133, 707–715. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Yang, D.; Gao, S.; Wang, T. Effects of soy-lecithin on lipid metabolism and hepatic expression of lipogenic genes in broiler chickens. Livest. Sci. 2008, 118, 53–60. [Google Scholar] [CrossRef]
- Pan, H.; Gao, Y.; Tu, Y. Mechanisms of body weight reduction by black tea polyphenols. Molecules 2016, 21, 1659. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhang, Y.; Zhou, Y.; Zhang, Z.; Xie, Z.; Zhang, J.; Wan, X. Green tea polyphenols alleviate obesity in broiler chickens through the regulation of lipid-metabolism-related genes and transcription factor expression. J. Agric. Food Chem. 2013, 61, 8565–8572. [Google Scholar] [CrossRef]
- Nie, C.; Zhang, W.; Ge, W.; Wang, Y.; Liu, Y.; Liu, J. Effects of fermented cottonseed meal on the growth performance, apparent digestibility, carcass traits, and meat composition in yellow-feathered broilers. Turk. J. Vet. Anim. Sci. 2015, 39, 350–356. [Google Scholar] [CrossRef]


| Ingredients | Starter (0 to 10 d) | Grower (11 to 24 d) | Finisher (25 to 42 d) |
|---|---|---|---|
| Yellow corn | 56.00 | 60.60 | 62.00 |
| Soybean meal, 48% | 34.86 | 29.00 | 25.00 |
| Corn gluten, 60% | 3.50 | 4.50 | 4.00 |
| Wheat bran | - | - | 1.90 |
| Soybean oil | 1.80 | 2.00 | 3.66 |
| Calcium carbonate | 1.00 | 1.00 | 0.90 |
| Dicalciumphosphate | 1.80 | 1.90 | 1.60 |
| Common salt | 0.30 | 0.30 | 0.30 |
| Premix * | 0.30 | 0.30 | 0.30 |
| DL- Methionine, 98% | 0.18 | 0.14 | 0.11 |
| Lysine, HCl, 78% | 0.16 | 0.16 | 0.13 |
| Toxenil | 0.10 | 0.10 | 0.10 |
| Calculated chemical composition † | |||
| ME, Kcal/Kg | 3042.27 | 3104.52 | 3202.02 |
| CP, % | 23.30 | 21.44 | 19.57 |
| EE, % | 4.28 | 4.60 | 6.24 |
| CF, % | 2.64 | 2.55 | 2.63 |
| Ca, % | 0.97 | 0.98 | 0.86 |
| Available P, % | 0.47 | 0.48 | 0.41 |
| Lysine, % | 1.38 | 1.22 | 1.10 |
| Methionine, % | 0.57 | 0.52 | 0.46 |
| Gene | Sequence (5′ → 3′) | GenBank Number |
|---|---|---|
| ß-actin | F: ATTGTCCACCGCAA ATGCTTC R: AAATAAAGCCATGCCAATCTCGTC | NM_205518.1 |
| GSH-PX | F: TTGTAAACATCAGGGGCAAA R: ATGGGCCAAGATCTTTCTGTAA | NM_001163245.1 |
| SOD | F: AGGGGGTCATCCACTTCC R: CCCATTTGTGTTGTCTCCAA | NM_205064.1 |
| CAT | F: ACCAAGTACTGCAAGGCGAA R: TGAGGGTTCCTCTTCTGGCT | NM_001031215.1 |
| ACC | F: AATGGCAGCTTTGGAGGTGT R: TCTGTTTGGGTGGGAGGTG | NM_205505 |
| FAS | F: CTATCGACACAGCCTGCTCCT R: CAGAATGTTGACCCCTCCTACC | J03860 |
| CPT1 | F: CAATGAGGTACTCCCTGAAA R: CATTATTGGTCCACGCCCTC | AY675193 |
| PPARα | F: TGGACGAATGCCAAGGTC R: GATTTCCTGCAGTAAAGGGTG | AF163809 |
| Parameters | Rutin, g/kg Base Diet | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| 0 | 0.25 | 0.5 | 1 | Linear | Quadratic | ||
| Initial body weight, g | 45.60 | 44.80 | 45.20 | 45.00 | 0.36 | 0.688 | 0.700 |
| Final body weight, g | 1953 c | 2012 b,c | 2079 b | 2225 a | 14.55 | 0.000 | 0.012 |
| Body weight gain, g | 1907 c | 1967 b,c | 2034 b | 2180 a | 15.58 | 0.000 | 0.013 |
| Total feed intake, g | 3611 | 3646 | 3685 | 3692 | 11.83 | 0.202 | 0.838 |
| Feed conversion ratio | 1.89 a | 1.85 a | 1.81 a | 1.69 b | 0.02 | 0.001 | 0.099 |
| Protein efficiency ratio | 2.59 b | 2.63 b | 2.61 b | 2.79 a | 0.11 | 0.000 | 0.051 |
| Relative growth rate, % | 190.83 | 191.28 | 191.51 | 192.07 | 2.16 | 0.061 | 0.702 |
| Parameters | Rutin, g/kg Base Diet | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| 0 | 0.25 | 0.5 | 1 | Linear | Quadratic | ||
| RBCs, 106/µL | 2.45 | 2.46 | 2.51 | 2.52 | 0.05 | 0.584 | 0.933 |
| Hb, g/dL | 6.21 | 6.24 | 6.32 | 6.25 | 0.13 | 0.760 | 0.783 |
| HCT, % | 25.92 | 24.96 | 26.58 | 27.05 | 0.29 | 0.063 | 0.239 |
| MCV, fl | 132.66 | 134.39 | 133.64 | 134.15 | 1.73 | 0.241 | 0.375 |
| MCH, pg | 41.99 | 42.66 | 42.86 | 43.06 | 0.23 | 0.102 | 0.605 |
| MCHC, g/dL | 30.41 | 30.55 | 31. 08 | 31.36 | 0.29 | 0.190 | 0.929 |
| WBCs, 103/µL | 19.35 b | 20.65 a,b | 21.88 a | 22.24 a | 0.26 | 0.000 | 0.254 |
| Lymphocyte, 103/µL | 13.61 b | 14.78 a,b | 15.54 a | 15.81 a | 0.21 | 0.000 | 0.187 |
| Heterophil, 103/µL | 4.78 | 5.08 | 5.64 | 5.57 | 0.14 | 0.080 | 0.468 |
| H/L ratio | 0.35 | 0.34 | 0.36 | 0.35 | 0.01 | 0.919 | 0.764 |
| Parameters | Rutin, g/kg Base Diet | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| 0 | 0.25 | 0.5 | 1 | Linear | Quadratic | ||
| Serum indices | |||||||
| Total protein, g/dL | 5.98 | 5.99 | 6.11 | 6.60 | 0.12 | 0.063 | 0.275 |
| Albumin, g/dL | 3.23 | 3.23 | 3.42 | 3.62 | 0.09 | 0. 065 | 0.597 |
| Globulin, g/dL | 2.75 | 2.76 | 2.69 | 2.98 | 0.09 | 0.477 | 0.484 |
| Cholesterol, mg/dL | 131.58 a | 121.53 a,b | 112.26 b | 91.15 c | 2.79 | 0.000 | 0.046 |
| Triacylglycerol, mg/dL | 94.08 a | 91.06 a | 92.06 a | 78.14 b | 1.25 | 0.000 | 0.001 |
| HDL cholesterol, mg/dL | 41.62 | 40.14 | 39.15 | 37.16 | 1.62 | 0.067 | 0.944 |
| LDL cholesterol, mg/dL | 70.15 a | 60.91 a,b | 52.21 b | 36.23 c | 0.78 | 0.000 | 0.040 |
| ALT, U/L | 110.63 a | 109.21 a | 104.12 a | 87.12 b | 3.94 | 0.000 | 0.005 |
| AST, U/L | 75.11 | 75.76 | 73.63 | 70.12 | 4.49 | 0.246 | 0.536 |
| Antioxidant parameters | |||||||
| SOD, U/mL | 17.12 c | 19.18 b,c | 21.22 ab | 24.37 a | 1.12 | 0.008 | 0.460 |
| CAT, U/mL | 9.12 b | 11.18 b | 15.31 a | 15.91 a | 1.48 | 0.000 | 0.209 |
| GSH-PX, U/mL | 2.10 b | 3.21 a | 3.42 a | 3.57 a | 0.13 | 0.000 | 0.014 |
| MDA, nmol/mL | 3.87 a | 2.48 b | 1.18 c | 1.11 c | 0.04 | 0.001 | 0.008 |
| Parameters | Rutin, g/kg Control Diet | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| 0 | 0.25 | 0.5 | 1 | Linear | Quadratic | ||
| Total feed cost/bird, $ | 1.62 d | 1.71 c | 1.81 b | 1.99 a | 0.03 | 0.000 | 0.021 |
| Feed cost/kg gain, $ | 0.85 | 0.87 | 0.89 | 0.91 | 0.08 | 0.090 | 0.939 |
| Profit/kg gain, $ | 0.62 | 0.60 | 0.58 | 0.56 | 0.07 | 0.075 | 0.941 |
| Benefit-cost ratio | 0.73 | 0.69 | 0.65 | 0.62 | 0.16 | 0.081 | 0.997 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hassan, F.A.M.; Roushdy, E.M.; Kishawy, A.T.Y.; Zaglool, A.W.; Tukur, H.A.; Saadeldin, I.M. Growth Performance, Antioxidant Capacity, Lipid-Related Transcript Expression and the Economics of Broiler Chickens Fed Different Levels of Rutin. Animals 2019, 9, 7. https://doi.org/10.3390/ani9010007
Hassan FAM, Roushdy EM, Kishawy ATY, Zaglool AW, Tukur HA, Saadeldin IM. Growth Performance, Antioxidant Capacity, Lipid-Related Transcript Expression and the Economics of Broiler Chickens Fed Different Levels of Rutin. Animals. 2019; 9(1):7. https://doi.org/10.3390/ani9010007
Chicago/Turabian StyleHassan, Fardos A. M., Elshimaa M. Roushdy, Asmaa T. Y. Kishawy, Asmaa W. Zaglool, Hammed A. Tukur, and Islam M. Saadeldin. 2019. "Growth Performance, Antioxidant Capacity, Lipid-Related Transcript Expression and the Economics of Broiler Chickens Fed Different Levels of Rutin" Animals 9, no. 1: 7. https://doi.org/10.3390/ani9010007
APA StyleHassan, F. A. M., Roushdy, E. M., Kishawy, A. T. Y., Zaglool, A. W., Tukur, H. A., & Saadeldin, I. M. (2019). Growth Performance, Antioxidant Capacity, Lipid-Related Transcript Expression and the Economics of Broiler Chickens Fed Different Levels of Rutin. Animals, 9(1), 7. https://doi.org/10.3390/ani9010007

