Next Article in Journal
Recurrent Alternate Parthenogenesis in the Common Smooth-Hound Shark (Mustelus mustelus) with Additional Cases and Further Evidence for a Putative Adaptive Reproductive Strategy
Previous Article in Journal
Hunting and Stray Dogs as Reservoirs of Echinococcus Species
Previous Article in Special Issue
Antimicrobial Resistant Isolates in Surgical and Bite Wounds in Dogs and Cats: A 12-Year Retrospective Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 16
Issue 9
10.3390/ani16091422
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Assessment of Selected Postbiotic Substances Against Methicillin-Resistant and Methicillin-Susceptible Staphylococcus spp. and Mammaliicoccus spp. of Bovine Mastitis Origin

by
Mariola Bochniarz
1,*,
Joanna Kowalik
1,
Aneta Nowakiewicz
1,
Aleksandra Trościańczyk
1,
Agata Hahaj-Siembida
1,
Katarzyna Michalak
2,
Dorota Pietras-Ożga
2,
Łukasz Adaszek
2 and
Andrea Lauková
3
1
Sub-Department of Veterinary Microbiology, Department of Preclinical Veterinary Sciences, Faculty of Veterinary Medicine, University of Life Sciences, Akademicka 12, 20-033 Lublin, Poland
2
Department of Epizootiology and Clinic of Infectious Diseases, Faculty of Veterinary Medicine, University of Life Sciences, Gleboka 30, 20-612 Lublin, Poland
3
Centre of Biosciences of the Slovak Academy of Sciences, Institute of Animal Physiology, Šoltésovej 4-6, 040 01 Košice, Slovakia
*
Author to whom correspondence should be addressed.
Animals 2026, 16(9), 1422; https://doi.org/10.3390/ani16091422
Submission received: 18 March 2026 / Revised: 23 April 2026 / Accepted: 2 May 2026 / Published: 6 May 2026
(This article belongs to the Special Issue Antimicrobial Resistance and Innovative Strategies in Veterinary Medicine)
Versions Notes

Simple Summary

Mastitis is one of the most common diseases affecting dairy cattle and has a significant impact on the physico-chemical properties and composition of milk, as well as on animal welfare. The increasing antibiotic resistance of bacteria means that more and more strains are no longer responding to available drugs, which drastically limits therapeutic options. Especially, methicillin-resistant staphylococci, which are resistant to all β-lactam antibiotics, pose a particularly serious problem, often accompanied by resistance to other antibiotic groups (multidrug resistance). Therefore, it is necessary to develop new alternatives for treating infections that will reduce antibiotic use. One of the most promising areas of research is bacteriocins which are proteinaceous substances synthesized on ribosomes by both Gram-positive and Gram-negative bacteria and that have a bactericidal effect (eliminating microorganisms) or a bacteriostatic effect (inhibiting the growth of some microorganisms).

Abstract

The growing problem of antibiotic resistance poses one of the greatest threats to modern medicine, making the search for new, alternative strategies to treat bacterial infections a matter of priority. The aim of the study was to evaluate the antimicrobial activity of selected postbiotic substances (PS) and nisin against methicillin-susceptible (MS) and methicillin-resistant (MR) strains of coagulase-negative staphylococci (NAS) and mammaliicocci. The study was conducted on 24 strains of coagulase-negative staphylococci and mammaliicocci isolated from milk collected from Holstein-Friesian (HF) cows with subclinical mastitis. In vitro, PS/EMo (100–400 AU/mL) and PS/Eas (100–200 AU/mL) were the most effective, inhibiting the growth of all MS and MR strains of NAS and Mammaliicoccus spp. (100.0%). A high percentage of strains were also sensitive to postbiotic substances produced by Lactococcus lactis subsp. lactis PS/MK2/8 (400–1600 AU/mL), PS/MK1/3 (100–400 AU/mL), and nisin (100–25,600 AU/mL), both in MR strains (94.1%, 82.4%, 88.2%, respectively) and in MS strains (100.0%, 85.7% and 100%, respectively). PS/Esach (100–25,600 AU/mL) inhibited the growth of all strains, including the mecA gene-positive mammaliicocci strains (100.0%), but was slightly less effective against the MS strains (64.7%). The lowest activity was observed with postbiotic substances produced by Enterococcus faecium, PS/4231 (100–1600 AU/mL) and PS/9296 (100–6400 AU/mL), which inhibited the growth of 3 out of 17 MR strains (17.65%). Among the Mammaliicoccus strains with the mecA gene, postbiotic substances derived from strains PS/4231 and PS/9296 inhibited the growth of 42.9% and 28.6% of the strains, respectively. Four tested strains were sensitive to all postbiotic substances (MSC9, MSC11, MSC12 and SCH3). This study confirms that postbiotic substances and nisin inhibit the growth of staphylococci isolated from the milk of cows with subclinical mastitis, including methicillin-resistant strains.

1. Introduction

Mastitis is one of the most common diseases affecting dairy cattle and has a significant impact on the physico-chemical properties and composition of milk, as well as on animal welfare [1,2,3]. It causes significant economic losses for farmers, including the costs of diagnostic tests, treatments, veterinary services, removal of sick animals from the herd, and decreased quality of the product sold [4]. Furthermore, it poses a potential risk to human health due to the possibility of zoonotic transmission and the rising incidence of antibiotic resistance [5]. Mastitis in cows can be caused by various pathogens, including bacteria, fungi, viruses, and algae [2,6,7,8]. However, it should be emphasized that the most common cause of mastitis is bacteria belonging to the genus Staphylococcus. They play a particularly important role, especially coagulase-positive Staphylococcus aureus [9]. Currently, a significantly higher percentage of mastitis cases are caused by coagulase-negative staphylococci, also known as non-aureus staphylococci (NAS), which are widespread in the natural environment and colonize the mucous membranes and skin of both animals and humans [10,11,12,13,14]. The most common NAS species isolated from the milk of cows with mastitis include S. haemolyticus, S. chromogenes, S. epidermidis, S. warneri, S. cohnii, S. simulans, S. hominis, S. capitis, and S. xylosus [15,16]. However, five NAS species that were previously classified in the genus Staphylococcus have been reclassified into the genus Mammaliicoccus based on 16S rRNA gene sequence analysis (M. sciuri, M. fleurettii, M. lentus, M. stepanovicii, and M. vitulinus) [17].
Mammaliicoccus spp. are Gram-positive, catalase-positive, non-spore-forming cocci characterized by aerobic or facultative anaerobic growth and variable oxidase activity. They are part of the normal microbiota of humans and animals and are considered potentially opportunistic pathogens capable of causing infections [18]. Similar to NAS, mammaliicocci can cause mastitis in various animal species and can also transfer resistance genes to other pathogenic microbiota, thereby contributing to the spread of multidrug resistance [19]. Especially, methicillin-resistant staphylococci, which are resistant to all β-lactam antibiotics, pose a particularly serious problem, often accompanied by resistance to other antibiotic groups (multidrug resistance). The mechanism of methicillin resistance involves the acquisition of the mecA gene, which encodes a modified enzyme protein (PBP2a), responsible for peptidoglycan biosynthesis in the bacterial cell wall [20,21]. For many years, the issue of MRSA was limited to hospitalized patients; strains isolated in hospitals are called HA-MRSA (hospital-acquired MRSA). However, in recent years, new groups of staphylococci have been isolated from the natural environment, known as CA (community-acquired) and FA/LA (food animal/livestock-associated) methicillin-resistant staphylococci [22]. The occurrence of these pathogens, which are also resistant to a number of other antibiotics, poses a potential risk to human and animal health [23]. To combat antibiotic resistance, it is essential to discover new, effective antibacterial agents of natural origin. Bacteriocins—antimicrobial peptides or proteins (AMPs) produced by certain bacteria with bactericidal or bacteriostatic effects represent a group of compounds with potential as both new-generation antibiotics and natural food preservatives [24].
Bacteriocins are proteinaceous substances synthesized on ribosomes and produced by both Gram-positive and Gram-negative bacteria. They exhibit antimicrobial activity and are usually secreted outside the bacterial cell [25]. The history of bacteriocins dates back to the early 1920s, with their antibacterial activity first discovered in 1928. In the 1960s, the first bacteriocin, nisin, was discovered, produced by the strain Lactococcus lactis subsp. lactis MCFB497 [26], and was later purified and recognized as a food preservative by the FAO/WHO in 1969 [27]. Bacteriocins either have a bactericidal or a bacteriostatic effect. These substances can have a broad inhibitory spectrum or a narrow one targeting specific species. As research on bacteriocins has advanced, a distinction has emerged between two categories of proteinaceous antimicrobial substances: postbiotic substances (PS), which have not been purified to homogeneity, and bacteriocins sensu stricto, defined as peptides purified to homogeneity [28,29,30,31,32]. According to ISAPP (International Scientific Association for Probiotics and Prebiotics), postbiotic substances are generally defined as preparations of inactive microorganisms and/or their components that provide health benefits to the host [28]. They include a broad range of metabolites, such as organic acids (lactic, acetic, and propionic), exopolysaccharides, enzymes, short-chain fatty acids, bioactive peptides, vitamins, and antimicrobial protein substances [30]. Substances referred to as bacteriocin-like inhibitory substances (BLIS), which have not been purified to a level of homogeneity but exhibit inhibitory activity against pathogens, are currently classified as postbiotic substances [33,34].
The aim of the study was to evaluate the antimicrobial activity of seven selected postbiotic substances and one lantibiotic bacteriocin-nisin against methicillin-susceptible (MS) and methicillin-resistant (MR) strains of coagulase-negative staphylococci and mammaliicocci isolated from the milk of cows with subclinical mastitis.

2. Materials and Methods

2.1. Classification of Animals for Study and Milk Sampling

Twenty-four strains of coagulase-negative Staphylococcus spp. and Mammaliicoccus spp. isolated from the milk of Holstein-Friesian (HF) cows with subclinical mastitis on one farm located in the Lublin Province (Poland). The herd consisted of 120 dairy cows. The cows were kept in a tie-stall system, fed a TMR (Total Mixed Ration), and straw was used as bedding material. The cows were milked twice a day using a high-line system, which is a type of milking pipeline system in which the milk pipeline is installed above the cows’ backs, usually above the milking stalls or along the ceiling of the barn. The average milk yield of the cows was 8610 kg per year. The average somatic cell count in the collected milk was 388,000 cells/mL of milk.
During morning milking, the California Mastitis Test (CMT) was performed as standard. If the test result is positive, a clinical examination of the cows was performed, and milk samples were collected for bacteriological testing and somatic cell count (SCC) determination. Before collecting milk samples, the teat skin was washed with water and then disinfected with 70% alcohol. The initial streams of milk were discarded. Milk for bacteriological testing was collected from the middle part into sterile, properly labeled tubes. The milk samples collected during morning milking were transported to the Department of Microbiology at the Faculty of Veterinary Medicine, University of Life Sciences in Lublin, and stored at 4 °C.

2.2. Classification of Mastitis Form

In cases of subclinical mastitis, there are no visible changes in milk or the udder, and no systemic symptoms are observed; however, the condition is diagnosed by an SCC > 200,000 cells/mL in milk and the presence of microorganisms in milk, as detected through microbiological testing. The SCC was measured using Somacount FC (Bentley, KS, USA).

2.3. Bacteriological Examination

The sensitivity assessment of seven selected postbiotic substances and one lantibiotic bacteriocin, nisin, was conducted on 24 strains of coagulase-negative Staphylococcus and Mammaliicoccus isolated from the milk of Holstein-Friesian (HF) cows with subclinical mastitis. Milk samples were thoroughly mixed, and then 10 µL of milk was inoculated onto agar medium with the addition of 5% defibrinated sheep blood (Columbia agar, Oxoid, Basingstoke, UK). The medium was incubated at 37 °C for 24 h under aerobic conditions. The initial identification involved assessing bacterial colony morphology, performing a catalase test, and preparing Gram-stained microscopic slides. Next, individual bacterial colonies grown on Columbia agar were inoculated onto differential media: Mannitol Salt Agar (Oxoid, Basingstoke, UK) and Baird-Parker (Oxoid, Basingstoke, Hampshire, UK). These media were used to differentiate staphylococci. Incubation was carried out under aerobic conditions at 37 °C for 24 h. Additionally, a test for the presence of the clumping factor (CF) was performed using the Staphytec Test (Oxoid, Basingstoke, UK), which differentiates between coagulase-positive and coagulase-negative staphylococcal strains. Pure cultures of isolated strains were identified using Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) [35].

2.4. Evaluation of Methicillin Sensitivity in the Strains of Coagulase-Negative Staphylococci and Mammaliicocci

Phenotypic resistance to methicillin in coagulase-negative staphylococci and mammaliicocci was assessed using the disk diffusion method with a 30 µg cefoxitin disk. A bacterial suspension with a density of 0.5 on the McFarland scale was applied to Mueller-Hinton agar using a sterile swab. The results were interpreted after 24 h of incubation at 35 °C. Strains were considered resistant if an inhibition zone was ≤24 mm and sensitive if it was ≥25 mm, in accordance with CLSI (2009) recommendations [36].

2.5. Detection of the Presence of the mecA Gene Using Polymerase Chain Reaction (PCR)

The presence of the mecA gene was detected using the PCR method (Table 1). DNA from bacterial cells of NAS and Mammaliicoccus strains was extracted using the PCR Mix Plus Red (A&A Biotechnology, Gdańsk, Poland) according to the manufacturer’s instructions. The next step of the study was to verify the presence of the mecA gene in the genome of isolated strains using standard PCR. The primer sequences and PCR conditions were determined based on the available data [37]. Reactions were carried out in a thermocycler (TPersonal thermal cycler—Biometra GmbH, Goettingen, Germany).

2.6. Sensitivity to Postbiotic Substances of Selected Coagulase-Negative Staphylococci and Mammaliicocci

The antimicrobial activity was tested using an agar spot test as described by De Vuyst et al. [38]. An overnight culture of the indicator/tested strains (200 µL, with an absorbance at A600 between 0.6 and 1.0) was added to 4.0 mL of semi-solid Brain Heart agar (0.7%, w/v, Difco, Franklin Lakes, NJ, USA). This solid medium (BHA, 1.5% w/v, Difco) was overlaid with semi-solid agar containing the strain. The volume of 10 µL of each serial dilution of the postbiotic substance was spotted onto the surface of soft agar containing the bacterial/indicator strain, and the plate was incubated at 37 °C for 18 h. The postbiotic substances and nisin were diluted in phosphate buffer (pH 6.5, 1:1). After incubation, the zones of bacterial growth inhibition were evaluated. Inhibition activity was expressed in arbitrary units per milliliter (AU/mL) as the reciprocal of the highest twofold dilution of postbiotic substances and nisin, showing complete inhibition of the tested strain. All tests were repeated twice. The following postbiotic substances and lantibiotic bacteriocin nisin were used (Table 2): nisin, a lantibiotic bacteriocin prepared as previously described by Lauková et al. [39]. The postbiotic substances used were produced by the strains isolated, characterized, and studied at the Laboratory of Animal Microbiology, Center of Biosciences of the Slovak Academy of Sciences, Institute of Animal Physiology in Košice, Slovakia, and characterized at the same workplace location. The postbiotic substance PS/MK1/3 is produced by the strain Lactococcus lactis MK1/3, isolated from raw goat milk (accession number ON114093 in GenBank) as reported by Lauková et al. [40]. PS/MK2/8 (accession number PQ158272 in GenBank) is produced by Lactococcus lactis MK2/8, also isolated from raw goat milk [41]. PS/Ent 4231 is produced by the ruminal strain Enterococcus faecium CCM4231 [42]. Silage strain E. faecium EF9296 produces PS/Ent9296 [43]. PS/EMo/1-1Nik is produced by the strain E. moraviensis EMo1-1Nik from the buccal mucosa of Slovak warm-blood horses (accession number MW326085 in GenBank) [44]. E. asini Eas 1/11D27, originating from horses of the Slovak breed Norik from Muráň (accession number in GenBank MN822908), produces PS/EntEas [45]. PS/Esach is produced by E. saccharolyticus Es 3/11 D27 (accession number MN822909 in GenBank), isolated from the inner part of the auricle mucosa of a clinically healthy mare of Norik breed from Muráň [46].

3. Results

The bacteriological examination of milk sampled from cows with subclinical mastitis identified 13 strains of coagulase-negative staphylococci belonging to the genus Staphylococcus: S. cohnii (1 strain), S. equorum (1 strain), S. haemolyticus (1 strain), S. saprophyticus (2 strains), S. simulans (2 strains), S. succinus (3 strains), S. xylosus (3 strains), and 11 strains belonging to the genus Mammaliicoccus: M. sciuri (10 strains) and M. vitulinus (1 strain). Among the identified strains, 7 methicillin-resistant strains (MR) were detected: 6 of M. sciuri (MSC1, MSC7, MSC8, MSC9, MSC10, and MSC19) and one strain of M. vitulinus (MV19). The remaining 17 strains were methicillin-susceptible (MS): one strain of S. cohnii (SCH3), one strain of S. equorum (SQ21), one strain of S. haemolyticus (SHae4), two strains of S. saprophyticus (SP6 and SP24), four strains of M. sciuri (MSC2, MSC5, MSC11, and MSC12), two strains of S. simulans (SM27 and SM28), three strains of S. succinus (SS13, SS14, and SS25), and three strains of S. xylosus (SX17, SX20, and SX23).

3.1. Sensitivity to Postbiotic Substances of Methicillin-Susceptible NAS and Mammaliicoccus Strains

Postbiotic substance PS/EMo produced by Enterococcus moraviensis EMo 1-1Nik inhibited indicator strains with inhibitory activity in the range from 100 to 400 AU/mL. PS/Eas produced by E. asini Eas 1/11D27 was found to be the most effective (100–200 AU/mL, inhibiting the growth of all methicillin-susceptible NAS and Mammaliicoccus spp. (100.0% of strains, Table 3). A high percentage of strains were also sensitive to PS MK2/8, PS/MK1/3 (produced by Lactococcus lactis subsp. lactis MK2/8, MK1/3), and nisin (94.1%, 82.4%, 88.2%, respectively) with an inhibitory activity ranging from 400 to 1600 AU/mL and, 100–400 AU/mL and 100–25,600 AU/mL, respectively. The antimicrobial activity of PS/Esach, obtained from E. saccharolyticus Es 3/11D27, was comparatively weaker, affecting 11 of 17 indicator strains (64.7%) at concentrations between 100 and 25,600 AU/mL. The lowest activity was noted in the case of postbiotic substances PS/4231 and PS/9296 produced by E. faecium CCM4231 and EF9296. They inhibited the growth of only 3 of 17 strains (17.65%) with inhibitory activity of 100–1600 AU/mL and 100–6400 AU/mL, respectively (Table 3). Among the strains tested, M. sciuri MSC11, MSC12, and S. cohnii SCH3 were sensitive to all postbiotic substances (Table 3).

3.2. Sensitivity to Postbiotic Substances of Methicillin-Resistant Mammaliicoccus Strains

The highest efficacy against mecA gene-positive strains showed PS/EMo (100–400 AU/mL), PS/Eas (100–200 AU/mL), PS/MK2/8 (100–1600 AU/mL), and lantibiotic bacteriocin nisin (100–25,600 AU/mL) (Table 4). PS/MK1/3 (100–400 AU/mL) inhibited 85.7% of methicillin-resistant (MR) strains, whereas PS/Esach (100 AU/mL) was effective against 57.1% of them. The highest percentages of resistant strains were found in PS/4231 (57.1%, inhibitory activity 100–200 AU/mL) and PS/9296 (71.4%, 100–800 AU/mL). One mecA gene-positive strain, M. sciuri MSC9, was sensitive to all postbiotic substances and nisin (Table 4).

4. Discussion

In recent years, there has been a significant increase in the number of infections caused by strains of bacteria resistant to antibiotics used to treat humans and animals. The risk of infection from pathogenic microorganisms resistant to commonly used antibiotics is currently one of the most serious dangers [47,48,49]. The rapid spread of multidrug-resistant bacteria, including strains resistant to all available antibiotics, is mainly caused by misuse and overuse of antibiotics in both human and animal populations [50,51]. It should be emphasized that the unjustified use of drugs on farm animals plays a significant role in this process, and the most frequently reported reason for the use of antibiotic therapy in cow breeding is mastitis [1]. The problem is continuously escalating and poses a serious threat to human health, as approximately 62.0% of isolated mastitis-causing agents are resistant to at least one antibiotic [52]. Therefore, it is necessary to develop new alternatives for treating infections that will reduce antibiotic use. Increasing emphasis is being placed on natural antimicrobial therapies. It has been documented that the use of probiotics (live, non-pathogenic microorganisms) and postbiotics (non-living bacteria, cell components, metabolites, or fermentation by-products) decreases the incidence of pathogens in large-scale animal breeding [53,54]. Research results indicate that postbiotic substances exhibit high antimicrobial activity, including the possibility of eradicating bacterial biofilm without negatively affecting obligate microbiota, are resistant to temperature and pH changes, and are characterized by low toxicity [55,56].
The most studied are lantibiotics produced, e.g., by certain strains of Lactococcus lactis subsp. lactis [57] such as nisin, which is active against many Gram-positive bacteria and is currently registered in the European Union (EU) under Regulation (EC) 1333/2008 as a food biopreservative (E 234) [58]. High activity of nisin has also been documented in treating various infections caused by multidrug-resistant strains of microorganisms, immunomodulation, and even anti-cancer therapies [59]. In our study, nisin effectively inhibited the growth of all mecA gene-positive strains and a large percentage (88.2%) of methicillin-sensitive strains of NAS and Mammaliicoccus spp. The results of our research align with those of other authors. Wu et al. [60] demonstrated that intramammary application of nisin at a dose of 2,500,000 IU for 3 days in cows with subclinical mastitis had bacteriological cure rates of 90.1% for Streptococcus agalactiae, 50.0% for Staphylococcus aureus, and 58.8% for coagulase-negative staphylococci. Similar results were obtained by Cao et al. [61], who studied the in vivo effects of nisin and compared it with that of gentamicin (GM). Their experiment showed that nisin offered a clinical cure rate similar to GM (90.2 vs. 91.1%). The high efficacy of nisin against bacteria isolated from cows with mastitis was also confirmed in studies by Kaczorek et al. [62]. These authors found that even a low concentration of nisin solution (≥9.76 IU/mL) can inhibit the growth of Str. uberis, Str. agalactiae and Str. dysgalactiae. Many studies are currently underway to enhance the activity of nisin. Field et al. [63] demonstrated in their research on bioengineered nisin derivatives that nisin A variants have improved antimicrobial activity against pathogenic staphylococci, including strains isolated from the milk of cows with mastitis, without negatively affecting the commensal microbiota of milk.
In addition to nisin, Lactococcus lactis (L. lactis) can also produce other postbiotic substances with antimicrobial properties. From the perspective of practical applications of postbiotic substances in the dairy industry, research on L. lactis MK1/3 (CCM 9209) and MK2/8 strains, isolated from raw goat’s milk by Lauková et al. [40,41], is particularly interesting. These strains have a favorable profile—they are susceptible to antibiotics, do not produce toxic enzymes (including β-glucuronidase), have a low ability to form biofilms, and tolerate bile and low pH. The postbiotic substances secreted by strains MK1/3 and MK2/8 primarily inhibit Gram-positive bacteria [40,41]. In our study, a high percentage of strains, both MR strains (94.1% and 82.4%, respectively) and MS strains (100.0% and 85.7%, respectively), were sensitive to PS/MK2/8 and PS/MK1/3.
The ability to produce postbiotic substances is not limited solely to lactic acid bacteria. Among postbiotic substances with documented antibacterial activity, Enterocin CCM 4231 (Ent 4231), produced by the ruminal strain Enterococcus faecium CCM 4231 plays a special role [42]. It was one of the first enterocins reported by Lauková and Czikková [64], which exhibits a broad spectrum of activity against Gram-positive bacteria, including Listeria monocytogenes (bactericidal effect) and S. aureus (bacteriostatic effect). The enterocin-producing strain 4231 was then used in numerous rabbit experiments in combination with sage extract, showing a beneficial effect on the intestinal microbiota and health parameters [65]. Another important postbiotic substance with inhibitory activity against Gram-positive bacteria, including Enterococcus spp. and L. monocytogenes, is produced by the E. faecium EF 9296 strain isolated from silage [43]. This strain was sensitive to ampicillin, erythromycin, tetracycline, rifampicin, and vancomycin, and only resistant to kanamycin. In this study, the postbiotic substances produced by E. faecium showed the weakest activity among those tested. PS/4231 and PS/9296 inhibited the growth of only 17.65% MR strains. Among the group of mecA gene-positive Mammaliicoccus, PS/4231 and PS/9296 were effective against 42.9% and 28.6% strains, respectively.
In the search for new sources of postbiotic substances, the species Enterococcus moraviensis, first isolated from surface waters, is especially noteworthy. Lauková et al. [44] described E. moraviensis EMo 1-1Nik strain isolated from the oral mucosa of Slovak warm-blood horses (99.93% similarity to NR113937.1). This strain is hemolysis-negative, lacks virulence factor genes, and has low biofilm formation ability. Up to 60.0% of EMo 1-1Nik colonies produced bacteriocins against E. avium EA5, reaching an activity of 800 AU/mL. Additionally, this substance is heat-stable and resistant to enzymatic processing. In our own study, PS/Emo inhibited the growth of all MS and MR strains of staphylococci and Mammalicoccus spp. (100.0% of strains).
An even less-known species with postbiotic potential is Enterococcus asini, first described by de Vaux et al. [66]. Lauková et al. [45] conducted pioneering research on the E. asini EAs 1/11D27 strain, isolated from the mucous membrane of the Slovak horse breed Norik from Muráň (99.86% similarity to NR113929.1, GenBank AN: MN822908). The EAs 1/11D27 strain is hemolysis-negative (ɤ-hemolysis), DNase-negative, gelatinase-negative, absent of virulence factor genes, sensitive to antibiotics, and does not produce toxic enzymes. The postbiotic substance of this strain inhibited the growth of 97.0% of tested indicator strains, with the highest inhibitory potential observed against staphylococci, enterococci, lactococci, and streptococci. It should also be emphasized that the growth of 9 of 10 Gram-negative bacterial strains was also inhibited, opening new perspectives for the use of PS in veterinary medicine. In our study, PS/Eas inhibited the growth of all MS and MR strains of staphylococci and Mammalicoccus spp. (100.0% strains).
Research on the microbiota of the Slovak horse breed Norik from Muráň horse has also identified the Enterococcus saccharolyticus Es 3/11 D27 strain, which is a valuable addition to our knowledge of the species diversity of enterococci colonizing the mucous membranes of equines [46]. The species E. saccharolyticus, originally described by Farrow et al. [67] as Streptococcus saccharolyticus and reclassified to the genus Enterococcus, is relatively rarely isolated from clinical material and has not yet been studied for its postbiotic potential. The detection of this species in the equine microbiome suggests that equids may harbor previously unknown strains of enterococci with potential bacteriocinogenic activity. In our study, more than half of the MR and MS strains (57.1% and 64.7%, respectively) were sensitive to PS/Esach.

5. Conclusions

In summary, our research confirms that postbiotic substances and nisin inhibit the growth of staphylococci isolated from the milk of cows with subclinical mastitis, including methicillin-resistant strains. Particularly promising are findings related to the postbiotic potential of lesser-known species such as E. moraviensis (EMo 1-1Nik), E. asini (EAs 1/11D27), and E. saccharolyticus (Es 3/11 D27), as well as the L. lactis MK1/3 and MK2/8 strains. Given the increasing problem of antibiotic resistance, bacteriocins and postbiotics appear to be a safe, effective, and environmentally friendly alternative for preventing and treating mastitis in cows, and warrant further intensive clinical research.

Author Contributions

Conceptualization, M.B. and A.T.; data curation, M.B. and J.K.; formal analysis, M.B. and A.N.; funding acquisition, M.B. and A.L.; investigation, J.K., A.H.-S., K.M., D.P.-O., M.B. and A.L.; methodology, K.M., D.P.-O., Ł.A. and A.L.; project administration, M.B.; resources, A.T.; supervision, A.L.; writing—original draft, M.B.; writing—review and editing, M.B., A.N. and A.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The research was carried out as part of a collaboration under an agreement signed in March 2024 between the University of Life Sciences in Lublin and CBs SAS IAP in Košice. All procedures for collecting material for animal testing, carried out within the project, were recognized by the Local Ethical Committee for Animal Experiments in Lublin as routine veterinary services for dairy cows. Therefore, the study was conducted in accordance with Polish law (Act of 17 November 2021 amending the Act on the protection of animals used for scientific or educational purposes (Dz.U. 2021, poz. 2338), as well as with European Union regulations contained in the Directive 2010/63/EU on the protection of animals used for scientific purposes.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

We would like to sincerely thank Dana Melišová for her invaluable professional assistance and tremendous effort at every stage of the laboratory research assessing bacterial sensitivity to postbiotic substances.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ruegg, P.L. A 100-Year Review: Mastitis detection, management, and prevention. J. Dairy Sci. 2017, 100, 10381–10397. [Google Scholar] [CrossRef] [PubMed]
  2. Taponen, S.; Liski, E.; Heikkilä, A.M.; Pyörälä, S. Factors associated with intramammary infection in dairy cows caused by coagulase-negative staphylococci, Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, Corynebacterium bovis, or Escherichia coli. J. Dairy Sci. 2017, 100, 493–503. [Google Scholar] [CrossRef] [PubMed]
  3. Yu, W.; Zhang, Z.; Wang, Z.; Lin, X.; Dong, X.; Hou, Q. Comprehensive Prevention and Control of Mastitis in Dairy Cows: From Etiology to Prevention. Vet. Sci. 2025, 12, 800. [Google Scholar] [CrossRef] [PubMed]
  4. Rasmussen, P.; Barkema, H.W.; Osei, P.P.; Taylor, J.; Shaw, A.P.; Conrady, B.; Chaters, G.; Muñoz, V.; Hall, D.C.; Apenteng, O.O.; et al. Global losses due to dairy cattle diseases: A comorbidity-adjusted economic analysis. J. Dairy Sci. 2024, 107, 6945–6970. [Google Scholar] [CrossRef]
  5. Costa, A.; Bovenhuis, H.; Egger-Danner, C.; Fuerst-Waltl, B.; Boutinaud, M.; Guinard-Flament, J.; Obritzhauser, W.; Visentin, G.; Penasa, M. Mastitis has a cumulative and lasting effect on milk yield and lactose content in dairy cows. J. Dairy Sci. 2025, 108, 635–650. [Google Scholar] [CrossRef]
  6. Jiang, L.; Li, Q.; Liao, H.; Liu, H.; Wang, Z. Enhancing Agricultural Productivity in Dairy Cow Mastitis Management: Innovations in Non-Antibiotic Treatment Technologies. Vet. Sci. 2025, 12, 662. [Google Scholar] [CrossRef]
  7. Zalewska, M.; Brzozowska, P.; Rzewuska, M.; Kawecka-Grochocka, E.; Urbańska, D.M.; Sakowski, T.; Bagnicka, E. The quality and technological parameters of milk obtained from dairy cows with subclinical mastitis. J. Dairy Sci. 2025, 108, 1285–1300. [Google Scholar] [CrossRef]
  8. Ghazvineh, N.; Mokhtari, A.; Ghorbanpoor Najaf Abadi, M.; Kadivar, A.; Shahrokh Shahraki, S. Molecular detection of selective virulence factors of Mycoplasma bovis local isolates involved in bovine mastitis. Kafkas Univ. Vet. Fak. Derg. 2024, 30, 631–639. [Google Scholar] [CrossRef]
  9. Ruegg, P.L. The future of udder health: Antimicrobial stewardship and alternative therapy of bovine mastitis. JDS Commun. 2025, 25, S31–S36. [Google Scholar] [CrossRef]
  10. Bochniarz, M.; Wawron, W.; Szczubiał, M. Coagulase-negative staphylococci (CNS) as an aetiological factor of mastitis in cows. Pol. J. Vet. Sci. 2013, 16, 487–492. [Google Scholar] [CrossRef]
  11. Bochniarz, M.; Zdzisińska, B.; Wawron, W.; Szczubiał, M.; Dąbrowski, R. Milk and serum IL-4, IL-6, IL-10, and amyloid A concentrations in cows with subclinical mastitis caused by coagulase-negative staphylococci. J. Dairy Sci. 2017, 100, 9674–9680. [Google Scholar] [CrossRef]
  12. Crippa, B.L.; de Matos, L.G.; Souza, F.N.; Silva, N.C.C. Non-aureus staphylococci and mammaliicocci (NASM): Their role in bovine mastitis and One Health. J. Dairy Res. 2024, 91, 44–56. [Google Scholar] [CrossRef]
  13. Getahun, Y.A.; Abey, S.L.; Beyene, A.M.; Belete, M.A.; Tessema, T.S. Coagulase-negative staphylococci from bovine milk: Antibiogram profiles and virulent gene detection. BMC Microbiol. 2024, 24, 263. [Google Scholar] [CrossRef]
  14. Tomazi, T.; Gonçalves, J.L.; Barreiro, J.R.; Arcari, M.A.; dos Santos, M.V. Bovine clinical intramammary infection caused by coagulase-negative staphylococci increases somatic cell count but has no effect on milk yield or composition. J. Dairy Sci. 2015, 98, 3071–3078. [Google Scholar] [CrossRef]
  15. Bochniarz, M.; Adaszek, Ł.; Dzięgiel, B.; Nowaczek, A.; Wawron, W.; Dąbrowski, R.; Szczubiał, M.; Winiarczyk, S. Factors responsible for subclinical mastitis in cows caused by Staphylococcus chromogenes and its susceptibility to antibiotics based on bap, fnbA, eno, mecA, tetK, and ermA genes. J. Dairy Sci. 2016, 99, 9514–9520. [Google Scholar] [CrossRef] [PubMed]
  16. Traversari, J.; Van Den Borne, B.H.P.; Dolder, C.; Thomann, A.; Perreten, V.; Bodmer, M. Non-aureus staphylococci species in the teat canal and milk in four commercial Swiss dairy herds. Front. Vet. Sci. 2019, 6, 186. [Google Scholar] [CrossRef] [PubMed]
  17. Madhaiyan, M.; Wirth, J.S.; Saravanan, V.S. Phylogenomic analyses of the Staphylococcaceae family suggest the reclassification of five species within the genus Staphylococcus as heterotypic synonyms the promotion of five subspecies to novel species the taxonomic reassignment of five Staphylococcus species to Mammaliicoccus gen. nov., and the formal assignment of Nosocomiicoccus to the family Staphylococcaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 5926–5936. [Google Scholar] [CrossRef]
  18. Beuckelaere, L.; De Visscher, A.; Souza, F.N.; Meyer, E.; Haesebrouck, F.; Piepers, S.; De Vliegher, S. Colonization and local host response following intramammary Staphylococcus chromogenes challenge in dry cows. Vet. Res. 2021, 52, 137. [Google Scholar] [CrossRef]
  19. Lienen, T.; Schnitt, A.; Hammerl, J.A.; Maurischat, S.; Tenhagen, B.A. Mammaliicoccus spp. from German Dairy Farms Exhibit a Wide Range of Antimicrobial Resistance Genes and Non-Wildtype Phenotypes to Several Antibiotic Classes. Biology 2022, 11, 152. [Google Scholar] [CrossRef]
  20. Tluanpuii, V.; Mahajan, R.K. Detection of the mecA Gene and Its Association with Antimicrobial Resistance Among Coagulase-Negative Staphylococci Isolated from Clinical Samples in a Tertiary Care Hospital: A Cross-Sectional Study. Cureus 2025, 17, 81643. [Google Scholar] [CrossRef] [PubMed]
  21. Javed, M.U.; Ijaz, M.; Ahmed, A.; Rasheed, H.; Sabir, M.J.; Jabir, A.A. Molecular dynamics and antimicrobial resistance pattern of β-lactam resistant coagulase positive Staphylococcus aureus isolated from goat mastitis. Pak. Vet. J. 2024, 44, 423–429. [Google Scholar] [CrossRef]
  22. Larsen, A.R.; Fitzgerald, J.R.; Larsen, J. Methicillin-Resistant Staphylococcus aureus in Food Animals. In Zoonoses: Infections Affecting Humans and Animals; Sing, A., Ed.; Springer: Cham, Switzerland, 2023. [Google Scholar] [CrossRef]
  23. Fetsch, A.; Etter, D.; Johler, S. Livestock-Associated Meticillin-Resistant Staphylococcus aureus—Current Situation and Impact From a One Health Perspective. Curr. Clin. Micro. Rpt. 2021, 8, 103–113. [Google Scholar] [CrossRef]
  24. Ban-Cucerzan, A.; Morar, A.; Tîrziu, E.; Bucur, I.-M.; Popa, S.A.; Imre, K. Bovine Mastitis Therapy at a Crossroads: Pharmacokinetic Barriers, Biofilms, Antimicrobial Resistance, and Emerging Solutions. Pharmaceuticals 2026, 19, 175. [Google Scholar] [CrossRef] [PubMed]
  25. Simons, A.; Alhanout, K.; Duval, R.E. Bacteriocins, Antimicrobial Peptides from Bacterial Origin: Overview of Their Biology and Their Impact against Multidrug-Resistant Bacteria. Microorganisms 2020, 8, 639. [Google Scholar] [CrossRef]
  26. Bozaris, I.S.; Adams, M.R. Effect of chelators and nisin produced in situ on inhibition and inactivation of Gram negatives. Int. J. Food Microbiol. 1999, 53, 105–113. [Google Scholar] [CrossRef]
  27. Nes, I.F. History, Current Knowledge, and Future Directions on Bacteriocin Research in Lactic Acid Bacteria. In Prokaryotic Antimicrobial Peptides; Drider, D., Rebuffat, S., Eds.; Springer: New York, NY, USA, 2011; pp. 3–12. [Google Scholar] [CrossRef]
  28. Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef]
  29. Chikindas, M.L.; Weeks, R.; Drider, D.; Chistyakov, V.A.; Dicks, L.M. Functions and emerging applications of bacteriocins. Curr. Opin. Biotechnol. 2018, 49, 23–28. [Google Scholar] [CrossRef] [PubMed]
  30. Abdul Hakim, B.N.; Xuan, N.J.; Oslan, S.N.H. A Comprehensive Review of Bioactive Compounds from Lactic Acid Bacteria: Potential Functions as Functional Food in Dietetics and the Food Industry. Foods 2023, 12, 2850. [Google Scholar] [CrossRef] [PubMed]
  31. Cotter, P.D.; Hill, C.; Ross, R.P. Bacteriocins: Developing innate immunity for food. Nat. Rev. Microbiol. 2005, 3, 777–788. [Google Scholar] [CrossRef]
  32. Cotter, P.D.; Ross, R.P.; Hill, C. Bacteriocins—A viable alternative to antibiotics? Nat. Rev. Microbiol. 2013, 11, 95–105. [Google Scholar] [CrossRef]
  33. Liang, B.; Xing, D. The current and future perspectives of postbiotics. Probiotics Antimicrob. Proteins 2023, 15, 1626–1643. [Google Scholar] [CrossRef]
  34. Mosca, A.; Abreu, Y.; Abreu, A.T.; Gwee, K.A.; Ianiro, G.; Tack, J.; Nguyen, T.V.H.; Hill, C. The clinical evidence for postbiotics as microbial therapeutics. Gut Microbes 2022, 14, 2117508. [Google Scholar] [CrossRef] [PubMed]
  35. Andreadi, A.; Tsivelekidou, E.; Dermitzakis, I.; Theotokis, P.; Gargani, S.; Meditskou, S.; Manthou, M.E. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights. Open Life Sci. 2025, 20, 20251136. [Google Scholar] [CrossRef] [PubMed]
  36. CLSI (2009) Performance Standards for Antimicrobial Susceptibility Testing CLSI M100-S19; Nineteenth Informational Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2009; Volume 29.
  37. Larsen, A.R.; Stegger, M.; Sørum, M. spa typing directly from a mecA, spa and pvl multiplex PCR assay-a cost-effective improvement for methicillin-resistant Staphylococcus aureus surveillance. Clin. Microbiol. Infect. 2008, 14, 611–614. [Google Scholar] [CrossRef]
  38. De Vuyst, L.; Callewaert, R.; Pot, B. Characterization of the antagonistic activity of Lactobacillus amylovorus DCE471 and large-scale isolation of its bacteriocin amylovorin L471. Syst. Appl. Microb. 1996, 19, 9–20. [Google Scholar] [CrossRef]
  39. Lauková, A.; Štyriak, I.; Mareková, M. In vitro antagonistic effect of nisin on faecal enterococci and staphylococci. Vet. Med. 2001, 46, 237–240. Available online: https://vetmed.agriculturejournals.cz/pdfs/vet/2001/09/02.pdf (accessed on 7 February 2026). [CrossRef]
  40. Lauková, A.; Tomáška, M.; Drončovský, M.; Mucha, R.; Dvorožňáková, E.; Kološta, M.; Pogány Simonová, M. The application potential of the raw goat milk-derived strain Lactococcus lactis MK1/3 for the dairy industry. Appl. Sci. 2025, 15, 6781. [Google Scholar] [CrossRef]
  41. Lauková, A.; Maďar, M.; Zábolyová, N.; Troscianczyk, A.; Pogány Simonová, M. Fortification of goat milk yogurts with encapsulated postbiotic active lactococci. Life 2024, 14, 1147. [Google Scholar] [CrossRef]
  42. Lauková, A.; Mareková, M.; Javorský, P. Detection and antimicrobial spectrum of a bacteriocin-like substance produced by Enterococcus faecium CCM4231. Lett. Appl. Microbiol. 1993, 16, 257–260. [Google Scholar] [CrossRef]
  43. Marciňáková, M.; Lauková, A.; Simonová, M.; Strompfová, V.; Kóreneková, B.; Naď, P. A new probiotic and bacteriocin-produicng strain of Enterococcus faecium EF9296 and its use in silage grass ensiling. Czech. J. Anim. Sci. 2008, 53, 335–344. [Google Scholar] [CrossRef]
  44. Lauková, A.; Styková, E.; Focková, V.; Maďar, M. Enterococcus moraviensis EMo 1-1Nik of horse origin:characteristics and potential bacteriocin-producing strain. Vet. Res. Com. 2023, 47, 1471–1478. [Google Scholar] [CrossRef]
  45. Lauková, A.; Styková, E.; Focková, V.; Troscianczyk, A.; Maďar, M. Postbiotic Activity of Enterococcus asini EAs 1/11D27 Strain Originating from the Norik of Muráň breed. Int. J. Equine Sci. 2024, 3, 51–57. [Google Scholar] [CrossRef]
  46. Lauková, A.; Styková, E.; Focková, V.; Maďar, M. Enterococcus saccharolyticus Es 3/11 D27 Isolated from Horses and its Postbiotic Activity. JSM Vet. Med. Res. 2024, 3, 6. Available online: https://www.jsmcentral.org/assets/articles/jsmvmr822544.pdf (accessed on 7 February 2026).
  47. Kovačević, Z.; Samardžija, M.; Horvat, O.; Tomanić, D.; Radinović, M.; Bijelić, K.; Vukomanović, A.G.; Kladar, N. Is There a Relationship between Antimicrobial Use and Antibiotic Resistance of the Most Common Mastitis Pathogens in Dairy Cows? Antibiotics 2022, 12, 3. [Google Scholar] [CrossRef]
  48. Mestrovic, T.; Aguilar, G.R.; Swetschinski, L.R.; Ikuta, K.S.; Gray, A.P.; Weaver, N.D.; Han, C.; Wool, E.E.; Hayoon, A.G.; Hay, S.I. The burden of bacterial antimicrobial resistance in the WHO European region in 2019: A cross-country systematic analysis. Lancet Public Health 2022, 7, 897–913. [Google Scholar] [CrossRef]
  49. Tomanić, D.; Samardžija, M.; Kovačević, Z. Alternatives to Antimicrobial Treatment in Bovine Mastitis Therapy: A Review. Antibiotics 2023, 12, 683. [Google Scholar] [CrossRef]
  50. Krömker, V.; Leimbach, S. Mastitis treatment—Reduction in antibiotic usage in dairy cows. Reprod. Domest. Anim. 2017, 52, 21–29. [Google Scholar] [CrossRef] [PubMed]
  51. Avanus, K.; Yılmaz, A.; Güneş, H.; Altınel, A.; Ekiz, B.; Yalçıntan, H.; Keçici, D.; Doğan, N. CXCR1 Gene SNP variability that affects mastitis resistance in Holstein cows in Türkiye. Kafkas Univ. Vet. Fak. Derg. 2025, 31, 119–124. [Google Scholar] [CrossRef]
  52. Tommasoni, C.; Fiore, E.; Lisuzzo, A.; Gianesella, M. Mastitis in Dairy Cattle: On-Farm Diagnostics and Future Perspectives. Animals 2023, 13, 2538. [Google Scholar] [CrossRef] [PubMed]
  53. Aggarwal, S.; Sabharwal, V.; Kaushik, P.; Joshi, A.; Aayushi, A.; Suri, M. Postbiotics: From emerging concept to application. Front. Sustain. Food Syst. 2022, 6, 887642. [Google Scholar] [CrossRef]
  54. Zhong, Y.; Wang, S.; Di, H.; Deng, Z.; Liu, J.; Wang, H. Gut health benefit and application of postbiotics in animal production. J. Anim. Sci. Biotechnol. 2022, 13, 38. [Google Scholar] [CrossRef] [PubMed]
  55. Zábolyová, N.; Lauková, A.; Pogány Simonová, M. Susceptibility to postbiotics—Enterocins of methicillin-resistant Staphylococcus aureus strains isolated from rabbits. Vet. Res. Commun. 2024, 48, 1449–1457. [Google Scholar] [CrossRef]
  56. Celebi, D.; Celebi, O.; Baser, S.; Ari, B.; Kalayci, S.E.; Kara, A. Efficacy of Pyocyanin Isolated from Pseudomonas aeruginosa and Lactobacillus plantarum Against Methicillin Resistant Staphylococcus aureus Caused Bovine Mastitis. Kafkas Univ. Vet. Fak. Derg. 2025, 31, 237–245. [Google Scholar] [CrossRef]
  57. Delves-Broughton, J.; Blackburn, P.; Evans, R.J.; Hugenholtz, J. Applications of the bacteriocin, nisin. Antonie Van Leeuwenhoek 1996, 69, 193–202. [Google Scholar] [CrossRef]
  58. Kaczorek-Łukowska, E.; Foksiński, P.; Małaczewska, J.; Wójcik, R.; Szyryńska, N. The Effects of Low Concentrations of Nisin on Biofilm Formation by Staphylococcus aureus Isolated from Dairy Cattle. Pathogens 2025, 14, 566. [Google Scholar] [CrossRef]
  59. Shin, J.M.; Gwak, J.W.; Kamarajan, P.; Fenno, J.C.; Rickard, A.H.; Kapila, Y.L. Biomedical applications of nisin. J. Appl. Microbiol. 2016, 120, 1449–1465. [Google Scholar] [CrossRef]
  60. Wu, J.; Hu, S.; Cao, L. Therapeutic effect of nisin Z on subclinical mastitis in lactating cows. Antimicrob. Agents Chemother. 2007, 51, 3131–3135. [Google Scholar] [CrossRef]
  61. Cao, L.T.; Wu, J.Q.; Xie, F.; Hu, S.H.; Mo, Y. Efficacy of nisin in treatment of clinical mastitis in lactating dairy cows. J. Dairy Sci. 2007, 90, 3980–3985. [Google Scholar] [CrossRef]
  62. Kaczorek, E.; Małaczewska, J.; Wójcik, R.; Rękawek, W.; Siwicki, A.W. Phenotypic and genotypic antimicrobial susceptibility pattern of Streptococcus spp. isolated from cases of clinical mastitis in dairy cattle in Poland. J. Dairy Sci. 2017, 100, 6442–6453. [Google Scholar] [CrossRef] [PubMed]
  63. Field, D.; Considine, K.; O’Connor, P.M.; Ross, R.P.; Hill, C.; Cotter, P.D. Bio-Engineered Nisin with Increased Anti-Staphylococcus and Selectively Reduced Anti-Lactococcus Activity for Treatment of Bovine Mastitis. Int. J. Mol. Sci. 2021, 22, 3480. [Google Scholar] [CrossRef] [PubMed]
  64. Lauková, A.; Czikková, S. The use of enterocin CCM 4231 in soy milk to control the growth of Listeria monocytogenes and Staphylococcus aureus. J. Appl. Microbiol. 1999, 87, 182–186. [Google Scholar] [CrossRef]
  65. Szabóová, R.; Lauková, A.; Herich, R.; Tarabová, L.; Chrastinová, Ľ.; Faixová, Z.; Maková, Z.; Piešová, E. The effect of dietary supplementation of sage plant extract and Enterocin M on the mucus in the small intestine and caecum in rabbits. Pol. J. Vet. Sci. 2021, 24, 23–28. [Google Scholar] [CrossRef]
  66. de Vaux, A.; Laguerre, G.; Diviès, C.; Prévost, H. Enterococcus asini sp. nov. isolated from the caecum of donkeys (Equus asinus). Int. J. Syst. Bacteriol. 1998, 48, 383–387. [Google Scholar] [CrossRef]
  67. Farrow, J.A.E.; Kruze, J.; Phillips, B.; Bramley, A.J.; Collins, M.D. Taxonomic studies on Streptococcus bovis and Streptococcus equinus: Description of Streptococcus alactolyticus sp. nov. and Streptococcus saccharolyticus sp. nov. Syst. Appl. Microbiol. 1984, 5, 467–482. [Google Scholar] [CrossRef]
Table 1. Sequences of the primer used in the study.
Table 1. Sequences of the primer used in the study.
GenePrimer Sequence (5′ Do 3′)Product Size (bp)Source
mecAF: TCCAGATTACAACTTCACCAGG162Larsen et al. [37]
R: CCACTTCATATCTTGTAACG
Table 2. The postbiotic substances used in the study.
Table 2. The postbiotic substances used in the study.
SubstanceProducer StrainSourceReferences
NisinLactococcus lactis subsp. lactis MCFB497 Bozaris and Adams, 1999 [26]Lauková et al. [39]
PSMK1/3L. lactis MK1/3 AN ON114093Raw goat milkLauková et al. [40]
PSMK2/8L. lactis MK2/8 AN PQ158272Raw goat milkLauková et al. [41]
PS/Ent4231E. faecium CCM4231Ruminal strainLauková et al. [42]
PS/Ent 9296E. faecium EF9296Silage strainMarciňáková et al. [43]
PS/EMoE. moraviensis EMo 1-1Nik MW326085Buccal mucosa of Slovak warm-blood horsesLauková et al. [44]
PS/EasE. asini Eas 1/11D27 MN822908Slovak horse breed Norik from MuráňLauková et al. [45]
PS/EsachE. saccharolyticus Es 3/11 D27 MN822909Auricle mucosa of a clinically healthy mare of Norik breed from Muráň Lauková et al. [46]
Table 3. Sensitivity to postbiotic substances of methicillin-susceptible NAS and Mammaliicoccus strains expressed in arbitrary units per milliliter (AU/mL).
Table 3. Sensitivity to postbiotic substances of methicillin-susceptible NAS and Mammaliicoccus strains expressed in arbitrary units per milliliter (AU/mL).
NisPS/MK1/3PS/MK2/8PS/4231PS/9296PS/EMoPS/EasPS/Esach
MSC264004001600001002000
MSC56400200160000400200100
MSC11800200160016006400400200200
MSC124004001600100800100100100
SHae425,600200400001002000
SX1716001001600001001000
SX201002001600001001000
SX233200100160000100200100
SCH3160040016001001002002000
SP6100100100002001000
SP241600100160000100100100
SQ211600100160000100100100
SM27001000010010025,600
SM280000010010012,800
SS13800400160000100100100
SS141600080000200100100
SS253200200160000100200100
Total15/17
(88.2%)		14/17
(82.4%)		16/17
(94.1%)		3/17
(17.65%)		3/17
(17.65%)		17/17
(100.0%)		17/17
(100.0%)		11/17
(64.7%)
MSC—Mammaliicoccus sciuri; SHae—Staphylococcus haemolyticus; SX—Staphylococcus xylosus; SCH—Staphylococcus cohnii; SP—Staphylococcus saprophyticus; SQ—Staphylococcus equorum; SM—Staphylococcus simulans; SS—Staphylococcus succinus; PS—postbiotic substances.
Table 4. Sensitivity to postbiotic substances of methicillin-resistant Mammaliicoccus strains.
Table 4. Sensitivity to postbiotic substances of methicillin-resistant Mammaliicoccus strains.
NisPS/MK1/3PS/MK2/8PS/4231PS/9296PS/EMoPS/EasPS/Esach
MSC112,8004001600002002000
MSC780010040010002001000
MSC825,60001000100100100100
MSC932004001600200800400100100
MSC1016002001001000200100100
MSC198004001600 00400100100
MV221001001600002001000
Total7/7
(100.0%)		6/7
(85.7%)		7/7
(100.0%)		3/7
(42.9%)		2/7
(28.6%)		7/7
(100.0%)		7/7
(100.0%)		4/7
(57.1%)
MSC—Mammaliicoccus sciuri; MV—Mammaliicoccus vitulinus; PS—postbiotic substances.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bochniarz, M.; Kowalik, J.; Nowakiewicz, A.; Trościańczyk, A.; Hahaj-Siembida, A.; Michalak, K.; Pietras-Ożga, D.; Adaszek, Ł.; Lauková, A. In Vitro Assessment of Selected Postbiotic Substances Against Methicillin-Resistant and Methicillin-Susceptible Staphylococcus spp. and Mammaliicoccus spp. of Bovine Mastitis Origin. Animals 2026, 16, 1422. https://doi.org/10.3390/ani16091422

AMA Style

Bochniarz M, Kowalik J, Nowakiewicz A, Trościańczyk A, Hahaj-Siembida A, Michalak K, Pietras-Ożga D, Adaszek Ł, Lauková A. In Vitro Assessment of Selected Postbiotic Substances Against Methicillin-Resistant and Methicillin-Susceptible Staphylococcus spp. and Mammaliicoccus spp. of Bovine Mastitis Origin. Animals. 2026; 16(9):1422. https://doi.org/10.3390/ani16091422

Chicago/Turabian Style

Bochniarz, Mariola, Joanna Kowalik, Aneta Nowakiewicz, Aleksandra Trościańczyk, Agata Hahaj-Siembida, Katarzyna Michalak, Dorota Pietras-Ożga, Łukasz Adaszek, and Andrea Lauková. 2026. "In Vitro Assessment of Selected Postbiotic Substances Against Methicillin-Resistant and Methicillin-Susceptible Staphylococcus spp. and Mammaliicoccus spp. of Bovine Mastitis Origin" Animals 16, no. 9: 1422. https://doi.org/10.3390/ani16091422

APA Style

Bochniarz, M., Kowalik, J., Nowakiewicz, A., Trościańczyk, A., Hahaj-Siembida, A., Michalak, K., Pietras-Ożga, D., Adaszek, Ł., & Lauková, A. (2026). In Vitro Assessment of Selected Postbiotic Substances Against Methicillin-Resistant and Methicillin-Susceptible Staphylococcus spp. and Mammaliicoccus spp. of Bovine Mastitis Origin. Animals, 16(9), 1422. https://doi.org/10.3390/ani16091422

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop