Next Article in Journal
First Identification of Pathogenic and Zoonotic-Relevant Sarcocystis hominis and Other Sarcocystis Species in Slaughtered Cattle in Chile
Previous Article in Journal
Effects of Anthropogenic Disturbance on Mammal Community Diversity and Activity Patterns: Evidence from the Jinfoshan and Jinyunshan National Nature Reserves, China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 16
Issue 5
10.3390/ani16050696
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulatory Effect of circRNA3890 on the Establishment of Receptive Endometrium in Dairy Goats

by
Jiuzeng Cui
,
Linxi Li
,
Yonggan Su
,
Songrong Han
,
Lei Zhang
* and
Yuxuan Song
*
College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
*
Authors to whom correspondence should be addressed.
Animals 2026, 16(5), 696; https://doi.org/10.3390/ani16050696
Submission received: 5 January 2026 / Revised: 29 January 2026 / Accepted: 13 February 2026 / Published: 24 February 2026
(This article belongs to the Topic Advances in Molecular Genetics and Breeding of Cattle, Sheep, and Goats)
Browse Figures
Versions Notes

Simple Summary

Mammalian embryo implantation requires the endometrium to be in a receptive state. Many non-coding RNAs, such as circRNA3890, show differential expression between the receptive endometrium and pre-receptive endometrium of dairy goats, according to our earlier research. This work experimentally showed that circRNA3890 contributes to the establishment of receptive endometrium in dairy goats by controlling the proliferation and apoptosis of dairy goat endometrial epithelial cells (gEECs) by targeting miR-26b-3p/MDM4. These findings will contribute to understanding circRNA and miRNA function in embryo implantation and provide a theoretical basis for further improving the embryo attachment rate.

Abstract

Receptive endometrium (RE) is essential for mammalian embryo implantation. The establishment of RE is a complex and precise dynamic process regulated by various cytokines, including non-coding RNAs (miRNAs, lncRNAs, and circRNAs). We identified candidate miR-26b-3p and circRNA3890 from our previous endometrial non-coding RNA sequencing data. CircRNA3890 adsorbs miR-26b-3p and inhibits its activity. Mouse double minute 4 (MDM4) is a target gene of miR-26b-3p, and circRNA3890 up-regulates the expression level of MDM4 by inhibiting the activity of miR-26b-3p in dairy goat endometrial epithelial cells (gEECs) in vitro. circRNA3890/miR-26b-3p/MDM4 could promote the proliferation of gEECs through the p53 signaling pathway. MiR-26b-3p could regulate the expression levels of vascular endothelial growth factor A (VEGFA) and leukemia inhibitory factor (LIF) through MDM4 in gEECs, which contributes to the development of endometrial receptivity. Furthermore, the results showed that miR-26b-3p significantly promoted the development of RE and embryo implantation. These findings demonstrate that circRNA3890 targets and adsorbs miR-26b-3p to relieve MDM4 inhibition and promotes EEC proliferation through the p53 signaling pathway. They reveal the regulatory effect of miR-26b-3p on receptive endometrial development and embryo implantation in vitro and in vivo.

1. Introduction

The precondition for conception in mammals is successful embryo implantation [1]. Embryo implantation occurs when a healthy embryo interacts with the receptive endometrium (RE) and attaches to the endometrial lining. RE is formed by complex changes in the morphology and physiology of the endometrium [2]. Many biological processes and pathways participate in the dynamic process of RE establishment, including endometrial epithelial cells (EECs) proliferation and apoptosis [3,4,5]. Moreover, the establishment of RE is a necessary condition for embryo implantation. Under natural conditions, the decreased or insufficient receptivity of the mammalian endometrium is one of the reasons for the failure of healthy embryo implantation [6,7]. Abnormal endometrial receptivity leading to failed embryo implantation results in significant economic losses for the livestock industry. Therefore, studying the molecular mechanism of RE establishment for improving the conception rate of mammals is necessary. The dynamic expression and fine-tuned regulation of non-coding RNA (ncRNA) during the establishment of endometrial receptivity has been demonstrated to be a critical factor determining successful embryo implantation [4]. Exogenous supplementation or suppression of specific ncRNAs—such as through miRNA mimics or antagonists—holds promise as a novel therapeutic strategy to enhance endometrial receptivity and improve assisted reproductive technology success rates.
CircRNA is highly stable and tissue-specific in mammals. In contrast to linear RNA, circRNA does not have a 5′-terminal cap and 3′-ployA tail structure and is a closed-loop structure composed of end-to-end connections [8]. Recently, circRNA as a post-transcriptional regulator has become one of the research hotspots in many fields. Studies have shown that circRNA can function as competitive endogenous RNA (ceRNA) to adsorb miRNA and inhibit its activity, subsequently regulating the expression of the miRNA at the transcriptional or post-transcriptional level [9,10]. Furthermore, circRNA regulates the proliferation and apoptosis of many kinds of cells. For example, circCGNL1 promoted the apoptosis of pancreatic cancer cell [11], and circRNA-0013747 promoted the proliferation of mesangial cells [12]. However, it is uncertain how circRNAs affects endometrial epithelial cells and the development of RE. Our previous research revealed that circRNA3890 was down-regulated in RE, potentially participating in the establishment of receptive endometrium in dairy goats [5]. Therefore, this study selected circRNA3890 as the research subject to further elucidate its molecular mechanisms during receptive endometrial establishment.
MicroRNAs (miRNAs) are a class of endogenous non-coding RNAs that act by degrading mRNA or inhibiting protein translation [13]. They are involved in various biological functions and processes in mammals, such as cell proliferation and apoptosis [14,15]. Moreover, miRNAs play an important regulatory role during embryo implantation; for example, miR-124-3p/miR-3074-5p reduces embryo implantation [16,17], whereas let7a/b promotes embryo implantation [18]. As we previously discovered, a significant number of miRNAs, including miR-26b-3p, are differentially expressed in the receptive endometrial period and pre-receptive period in dairy goats [19]. However, the effect of miR-26b-3p and circRNA networks on gEECs and receptive endometrium is unclear.
MDM4 is a cDNA sequence that encodes p53 protein binding and inhibits the transcriptional activity of the wild-type p53 gene [20]. Bioinformatic analysis has predicted that MDM4 is the target gene of miR-26b-3p. Moreover, studies have reported that MDM4 promotes the proliferation of many kinds of cells [21,22]. We hypothesize that MDM4 modulates endometrial epithelial cell proliferation and apoptosis in dairy goats, playing a key role in receptive endometrium formation.
In this experiment, we first clarified the relationship among circRNA3890, miR-26b-3p, and MDM4 in vitro and then tested their effects on gEECs and RE marker genes. We verified the effect of miR-26b-3p on mouse endometrial receptivity and embryo value-added rate in vivo. In conclusion, we explored the effects of circRNA3890, miR-26b-3p and MDM4 on the development of endometrial tolerance and embryo implantation. These findings will contribute to understanding circRNA and miRNA function in embryo implantation and provide a theoretical basis for further improving the embryo attachment rate.

2. Materials and Methods

2.1. Tissue Sample Collection

This study used Saanen dairy goats from the Longxian Dairy Goat Experimental Demonstration Base of Northwest A&F University as the research object. Twelve dairy goats with good reproductive performance were selected for concurrent estrus treatment. The day of mating was recorded as D0 of pregnancy. Our previous research indicates that the endometrium of dairy goats is in a receptive state on day 15 post-breeding (D15), whereas it is in a pre-receptive state on day 5 (D5) [5]. Endometrial samples from the anterior wall of the uterine cavity were collected on D5 (PE) and D15 (RE) of pregnancy [5,19]. All endometrial samples were washed with phosphate-buffered saline and frozen in liquid nitrogen or immediately used for the isolation and culture of gEECs.

2.2. Cell Culture

On the fifth day after breeding, uterine tissue was surgically collected from the dairy goats. The uterus was promptly placed in PBS solution containing penicillin (100 units/mL) and streptomycin (50 mg/mL) and immediately transported to the laboratory. The tissue was first rinsed with 75% ethanol, followed by PBS. In the cell culture room, endometrial tissue was excised from the uterus using a sterile scalpel, then incubated with trypsin for approximately 1 h. Digestion was terminated by adding fetal bovine serum (FBS). The cell suspension was centrifuged at 500 g for 10 min to pellet the cells, and the EECs were resuspended in DMEM/F12 medium containing 10% FBS. To isolate endometrial stromal cells (ESCs), the supernatant was centrifuged at 1000 g for 10 min. These cells were then cultured in the same cell culture system until the third passage to further purify the cells [23,24]. The HEK293T cell lines were provided by our laboratory. The gEECs or HEK293T were cultivated in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) (Gibco, Carlsbad, CA, USA) or DMEM (high glucose) with 10% fetal bovine serum (FBS) and penicillin/streptomycin (100 U/mL and 100 mg/mL, respectively) in a humidified atmosphere of 5% CO2 at 37 °C.
The full length of circRNA3890 and MDM4 coding regions was cloned and inserted into the pcDNA2.1 (+) (Geneseed Biotech, Guangzhou, China) and pcDNA3.1 (+) vectors (Promega, Madison, WI, USA). NC, NC inhibitor (NCH), MiR-26b-3p mimic, miR-26b-3p inhibitor, si-MDM4, and si-CircRNA3890 were synthesized by GenePharma (Shanghai, China). When the cell confluence rate reached about 50%, the small RNA was mixed with the transfection reagent following the instructions for Lipofectamine 2000 (Invitrogen, Waltham, MA, USA). The mixture was incubated at room temperature for 20 min, and subsequently added to the cell culture plate and thoroughly shaken.

2.3. Western Blot and RT-qPCR

Total RNA was extracted from tissues and cells using the Ultrapure RNA Kit (Cabio, Wuhan, China), according to the kit instructions. For mRNA analysis, complementary DNA (cDNA) was synthesized from 1.0 μg total RNA using a reverse transcription kit (TaKaRa, Dalian, China), according to the kit instructions. RT-qPCR was performed in triplicate wells using SYBR Green PCR Master Mix (TaKaRa, Dalian, China). Primer sequences used for PCR are shown in Table 1.
The total proteins were extracted from gEECs as described previously [23]. The total protein concentration was determined by BCA protein concentration assay kit (Beyotime, Shanghai, China), and the Western blot (WB) assay procedure was performed as previously described [23]. The antibodies used in this experiment are shown in Table 2.

2.4. Luciferase Activity Assay

Using miRanda and Targetscan7.0, bioinformatic analysis of the miRNA binding sequences in MDM4 and circRNA3890 was performed to determine the targets of miR-26b-3p. The MDM4 3′UTR fragment and entire circRNA3890, which each include the miR-26b-3p binding site, were cloned and put into the psiCHECK-2 vector (Promega, Madison, WI, USA) to create reporters for luciferase tests. In addition, psiCHECK2-Mut mutant plasmids with altered target sites were created using TaKaRa MutanBEST Kit (TaKaRa, Dalian, China). The specific steps of vector construction are as described above [23,25]. All primer sequences are shown in Table 1, and all construction vectors were verified by sequencing. When the cell confluence reached roughly 60%, the wild-type (psiCHECK2-WT) or mutant (psiCHECK2-MUT) plasmids were co-transfected with the miR-26b-3p mimic into 293T cells. Each experiment was carried out three times, in triplicate. The luciferase reporter assay kit instructions (Promega, Madison, WI, USA) provided thorough instructions on detecting luciferase activity.

2.5. Proliferation Cell, Cycle, and Apoptosis Assay

The EdU incorporation assay (Ribobio, Guangzhou, China) and cell counting kit (CCK8) assay (ZETA, San Francisco, CA, USA) were used to screen for cell proliferation as previously described [23,26]. We used a cell cycle staining kit (Liankebio, Hangzhou, China) to analyze the cell cycle of different treatment groups according to the manufacturer’s instructions [27]. Cell apoptosis was analyzed by V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) kit (Liankebio, Hangzhou, China). The detailed procedures were conducted following the manufacturer’s instructions and referring to our previous research [19]. Analyses were performed using a flow cytometer (BD Biosciences, San Diego, CA, USA).

2.6. Fluorescence In Situ Hybridization

We fixed gEECs using 4% paraformaldehyde, followed by prehybridization with 0.5% (Invitrogen, Waltham, MA, USA), and then performed fluorescence in situ hybridization as previously reported [28]. Next, we incubated cells with RNA probes in hybridization buffer for 12 h. The circRNA3890 probe was labeled with cy3. Nuclei were stained with DAPI (Vector Laboratories, Burlingame, CA, USA). Images were captured using confocal laser scanning microscopy (Leica TCS SP8, Leica Microsystems CMS GmbH, Wetzlar, Germany).

2.7. Animal Experiment

The mice used in the in vivo experiment were 8–10 weeks old ICR female mice weighing about 30–35 g and purchased from Beijing Weishanglide Biotechnology Co., Ltd. (Beijing, China) (SCXK (jing) 2016-0009). The male and female mice were caged for mating, and the vagina of the female mice was examined at 8:00 the following day. Only female mice with vaginal plugs were reserved for use, and the day plug appearance was considered the first day of pregnancy (D1). An operation was performed on day 3 of pregnancy (D3) at 9:00 to expose the left ovary and uterine horns. The uterine horn was injected with 10 µg/20 µL miR-26b-3p agomir (GenePharma, Shanghai, China) into the uterine cavity, with the contralateral uterine horn serving as the control side, where the same dose of NC was injected. On day 4 of pregnancy (D4), the uterine horns of two mice were cut longitudinally and evenly divided. One portion was scraped from the endometrial tissue for PCR detection, while the other was fixed in 2.5% glutarase fixative. Subsequently, for scanning electron microscopy detection, another operation as mentioned above was performed on an additional two mice and both sides of the uterine horns were fixed in 4% paraformaldehyde for subsequent HE and immunohistochemistry backup. On day 9 of pregnancy (D9), pictures of the uterus of three mice were taken, and the embryo value-added rate was counted.

2.8. Immunohistochemistry

Uterine tissue samples were fixed with paraformaldehyde (4%), embedded in paraffin, and sectioned. Sections were dewaxed with xylene and alcohol in turn, rehydrated, placed in citrate buffer, and cooked in a microwave oven for 10 min for antigen retrieval. Endogenous peroxidase was blocked with 3% hydrogen peroxide for 10 min at room temperature, subsequently blocked with 5% BSA for 30 min, and incubated with a primary antibody (as shown in Table 2) overnight at 4 °C.

2.9. Scanning Electron Microscopy

The effects of miR-26b-3p on mouse uterine pinopodes were detected by scanning electron microscopy (SEM) [29]. Uterine tissue was fixed with glutaraldehyde (2.5%) for more than 2 h, dehydrated in non-concentrated ethanol, and subjected to critical point drying. The sample was then positioned with the observation surface (endometrial cavity) upward on the sample stage, and a vacuum film meter was used to coat the sample with conductive silver plastic. The samples were observed under JSM-6330F SEM (JEOL, Tokyo, Japan).

2.10. Statistical Analysis

All the data were processed with SPSS 22.0 (SPSS Inc., Chicago, IL, USA). The data were analyzed using t-test, one-way analysis of variance, and least significant difference (LSD) to determine any significant differences. A value of p < 0.05 was considered statistically significant. Differences with p < 0.5 are indicated by one asterisk and those with p < 0.01 by two asterisks to denote extremely significant differences.

3. Results

3.1. Identification of circRNA3890 in Dairy Goat Endometrium

To analyze the contribution of circRNA to the establishment of endometrial receptivity in dairy goats, we screened published sequencing data and found that circRNA3890 was highly expressed in PE of dairy goats [30]. CircRNA3890 is derived from Exon18 and Exon19 of membrane-associated ring-CH-type finger 6 (MARCH6) on chromosome 20, having a length of 343 bp (Figure 1a). The RT-qPCR results showed that the expression levels of circRNA3890 in PE was significantly up-regulated compared with RE (Figure 1b), which was consistent with the sequencing results. To verify the stability of circRNA3890 in gEECs of goats, we used actinomycin D (an RNA synthesis inhibitor) to treat gEECs and extracted the total RNA. The results showed that the half-life of circRNA3890 was longer than that of linear MARCH6 mRNA (Figure 1c). Furthermore, circRNA3890 was also significantly more resistant to RNase R exonuclease than linear MARCH6 (Figure 1d). The FISH experiments showed that circRNA3890 was generally expressed in the cytoplasm of gEECs (Figure 1e). These findings imply that circRNA3890 is a stable molecular marker and may play a role in the establishment of a receptive endometrium in dairy goats.

3.2. CircRNA3890 as a Competitive ceRNA Target to Suppress the Expression of miRNA-26b-3p in gEECs

Most circRNAs perform their function by adsorbing miRNAs [4,9]. In this study, we predicted the presence of a binding site for circRNA3890 and miR-26b-3p by two public programs (Targetscan 7.0 and miRanda) (Figure 2a). To verify whether circRNA3890 could bind to miR-26b-3p, a double luciferase assay was conducted. MiR-26b-3p down-regulated WT-circRNA3890 dual luciferase activity; however, there was no significant effect on MUT-circRNA3890 (Figure 2b). We successfully constructed the overexpression vector of circRNA3890 (pc3.1-circRNA3890) (Figure S1a). Two siRNAs were designed for circRNA3890 (Figure S1b), and si-circRNA3890-2 (si-circRNA3890) with high interference efficiency was selected for subsequent experiments. Furthermore, circRNA3890 decreased the expression of miR-26b-3p in gEECs (Figure 2c,d). We synthesized miR-26b-3p mimic/miR-26b-3p inhibitor and confirmed it could be used in subsequent experiments (Figure S1c). After transfection with miR-26b-3p mimic, the expression of circRNA3890 in gEECs decreased significantly, and the miR-26b-3p inhibitor significantly increased the expression of circRNA3890 in gEECs (Figure 2e). In summary, circRNA3890 has a targeting relationship with miR-26b-3p and a potential negative feedback regulation relationship in gEECs.
A number of genes, including VEGFA [31] and LIF [32], have been recognized as receptive endometrial marker genes. The WB assay showed that miR-26b-3p significantly up-regulated the protein expression level of VEGFA and LIF in gEECs (Figure 2f–i). Moreover, the circRNA3890 decreased the protein levels of VEGFA and LIF in gEECs (Figure 2j–m), and miR-26b-3p attenuated the regulatory effect of the circRNA3890 on the above proteins. The above results further prove that circRNA3890 is involved in the establishment of RE by targeting adsorption of miR-26b-3p.

3.3. The Effects of circRNA3890 on gEECs

Studies have shown that apoptosis of gEECs contributes to embryo implantation [33]. To verify the function of circRNA3890 in gEECs, the proliferation effect of circRNA3890 on gEECs was detected using CCK8 and EdU. The CCK8 assay showed that circRNA3890 enhanced the cell vitality of gEECs, and the pc2.1-circRNA3890+ miR-26b-3p mimic group reduced the cell viability of gEECs compared with the pc2.1-circRNA3890 group (Figure 3a). CircRNA3890 increased the number of positive cells, and miR-26b-3p could reduce the effect of circRNA3890 on gEECs proliferation (Figure 3b,c). Overexpression of circRNA3890 decreased the protein levels of BAX and significantly increased the protein levels of BCL2 in gEECs in vitro. MiR-26b-3p could reduce the effect of circRNA3890 on these proteins in gEECs (Figure 3d,e). Furthermore, the FCM assay showed that circRNA3890 inhibited gEECs apoptosis, and that miR-26b-3p could reduce the influence of circRNA3890 on gEECs apoptosis (Figure 3f). Meanwhile, circRNA3890 increased the number of gEECs in the S phase and reduced the proportion of gEECs in the G1 phase. Moreover, miR-26b-3p could reduce the effect of circRNA3890 on the cell cycle (Figure 3g and Figure S2). Interference with circRNA3890 was the opposite of overexpression (Figure 4). The above results show that circRNA3890 promoted the proliferation of EEC and inhibited apoptosis. CircRNA3890 may participate in establishing a receptive endometrium by regulating apoptosis in gEECs.

3.4. The Effects of miR-26b-3p on gEECs

CircRNA3890 may affect gEECs through miR-26b-3p, so we examined the effect of miR-26b-3p on gEECs. The RT-qPCR results showed that the expression levels of miR-26b-3p in RE were significantly up-regulated compared with PE (Figure 5a). The EdU and CCK8 assays showed that miR-26b-3p inhibited the proliferation and decreased the cell viability of gEECs (Figure 5b–d). The FMC assay showed that miR-26b-3p promoted the apoptosis of gEECs (Figure 5e).
Furthermore, miR-26b-3p decreased the protein levels of BCL2 and increased the protein levels of BAX in gEECs in vitro (Figure 5f–i). The flow cytometry (FMC) analysis investigated the cell cycle; the results showed that miR-26b-3p increased the proportion of gEECs in the G1 phase while reducing the number of gEECs in the S phase (Figure 5j and Figure S3). In conclusion, circRNA3890 regulated apoptosis in gEECs by targeting miR-26b-3p, thereby participating in the establishment of a receptive endometrium.

3.5. MiR-26b-3p Inhibits the Expression of MDM4 in gEECs

Most miRNAs are involved in post-transcriptional regulation through target genes [23,25]. We predicted that MDM4 might be a target gene of miR-26b-3p by two public programs (Targetscan7.0 and miRanda), and the predicted binding site is located in the 3′UTR. The MDM4 expression in PE was significantly up-regulated compared to RE (Figure 6a). We constructed wild-type (WT-MDM4) and mutated (MUT-MDM4) dual luciferase reporter vectors of the MDM4 gene based on the predicted binding sites (Figure 6b). The double luciferase demonstrated that miR-26b-3p reduced the double luciferase activity of WT-MDM4 but had no significant effect on MUT-MDM4 (Figure 6c). Overexpression of miR-26b-3p significantly decreased MDM4 mRNA and protein expression, whereas inhibition of miR-26b-3p significantly increased MDM4 mRNA and protein expression in gEECs (Figure 6d–f). CircRNA3890 significantly promoted the protein expression level of MDM4 (Figure 6g–i). In addition, the MDM4 decreased the protein levels of VEGFA and LIF in gEECs (Figure 6j,k). In summary, MDM4 was identified as the target gene of miR-26b-3p, and miR-26b-3p negatively regulates the expression of MDM4 in gEECs.

3.6. The Effects of MDM4 on gEECs

To investigate the regulatory effect of MDM4 on gEECs, we first constructed the MDM4 overexpression vector (pc3.1-MDM4), and small interfering RNAs (siRNAs) of MDM4 were synthesized by GenePharma (Shanghai, China). Meanwhile, the RT-qPCR and WB assays verified that the overexpression vector (pc3.1-MDM4) and interference (si-MDM4) of MDM4 could be used in subsequent experiments (Figure S4). The CCK8 assay showed that MDM4 enhanced the cell vitality of gEECs, and miR-26b-3p could reduce the effect of MDM4 on cell vitality (Figure 7a,d). The EdU assay revealed that MDM4 increased the number of positive cells and promoted the proliferation of gEECs. Moreover, miR-26b-3p could reduce the effect of MDM4 on cell proliferation (Figure 7b,c,e,f). The WB assay showed that overexpression of MDM4 significantly decreased the protein levels of BAX and significantly increased the protein levels of BCL2, while si-MDM4 decreased the protein levels of BCL2 and significantly increased the protein levels of BAX, in gEECs in vitro (Figure 7g,i). Furthermore, miR-26b-3p was found to reduce the effect of MDM4 on these proteins in gEECs in vitro (Figure 7h,j). In addition, the apoptosis results showed that MDM4 inhibited EEC apoptosis (Figure 7k,l). The cell cycle assay showed that MDM4 increased the number of gEECs in the S phase and reduced the proportion of gEECs in the G1 phase, while miR-26b-3p could reduce the effect of MDM4 on the cell cycle (Figure 7m,n and Figure S5). These results suggested that MDM4 promoted gEECs proliferation, inhibited apoptosis, and was negatively regulated by miR-26b-3p. They also indicated that MDM4 participates in the establishment of a receptive endometrium.

3.7. circRNA3890/miR-26b-3p/MDM4 Regulates the P53/P21 Signal Pathway in gEECs

In addition, many experiments have demonstrated that MDM4 is a negative regulator of p53 [34,35]. Therefore, we speculated that circRNA3890/miR-26b-3p/MDM4 may regulate the proliferation and apoptosis of gEECs through the P53/P21 signaling pathway. The WB assay showed that MDM4 inhibited the protein levels of P53 and P21, and promoted the protein levels of CDK2 and cyclinE1 (Figure 8a–d). In addition, miR-26b-3p attenuated the regulatory effect of MDM4 on the above proteins (Figure 8e–h). The regulation of these proteins by miR-26b-3p was opposite to that of MDM4. The WB assay also showed that circRNA3890 inhibited the protein levels of P53 and P21, and promoted the protein levels of CDK2 and cyclinE1 (Figure 8i–l). The above study results indicated that circRNA3890/miR-26b-3p/MDM4 regulated the survival rate of gEECs through the P53/P21 signaling pathway.

3.8. miR-26b-3p Promotes Embryonic Engraftment in Mice

To verify the regulatory effect of miR-26b-3p on endometrial receptivity and embryo implantation in vivo, we injected miR-26b-3p-Agomir and NC-Agomir on both sides of mouse uterine horns on day 3 of gestation. The RT-qPCR assay showed that the expression of miR-26b-3p was up-regulated in the uterine horn on the side injected with miR-26b-3p-Agomir, indicating that we successfully constructed a mouse model (Figure 9a). The SEM results showed that miR-26b-3p promotes the development of the uterine pinopode process (Figure 9b). The RT-qPCR and immunohistochemical results showed that miR-26b-3p up-regulated the expression levels of VEGFA and LIF (Figure 9c,g,h). The results of the dissection test on day 9 of pregnancy showed that miR-26b-3p increased the embryo implantation rate (Figure 9d,e). The HE staining showed that miR-26b-3p had no significant effect on endometrial thickness (Figure 9f). The above results indicated that miR-26b-3p promoted the establishment of mouse endometrial receptivity and increased the embryonic replication rate.

4. Discussion

Recently, miRNAs and long non-coding RNAs (lncRNA) have been reported to play important regulatory roles during embryo implantation [36]. In addition, many studies have shown that miRNA and lncRNA can participate in the development of endometrial receptivity [37]. However, the role of circRNA in the establishment of endometrial receptivity remains to be further studied. Our previous study identified a circRNA 3890 associated with endometrial receptivity. CircRNA3890 acts as a ceRNA to adsorb miR-26b-3p to relieve the inhibitory effect on MDM4, activate the P53 signaling pathway, and regulate the establishment of receptive endometrium.
Currently, most studies on miRNAs focus on tumor molecular markers [38], and few study the role of RE. In this study, the expression level of miR-26b-3p in RE was significantly higher than that in PE, and the expression level in the uterus was relatively high. Therefore, we speculated that miR-26b-3p might be involved in the establishment of RE in dairy goats. Similar to miRNAs, miR-26b-3p can serve as a molecular therapeutic target for cancer or tumors. For example, miR-26b-3p regulates glioma cell migration and proliferation, as well as apoptosis [39]. Endometrial cells undergo proliferation and apoptosis during the estrus cycle of humans and most mammals. Studies have shown that EEC apoptosis is important for embryos to break through the barriers of the uterine surface and implant in the uterus [4,40]. The results of this experiment show that miR-26b-3p promoted apoptosis and inhibited proliferation of gEECs, increased the proportion of gEECs in the G1 phase, and reduced the number of gEECs in the S phase. These findings suggest a critical role for miR-26b-3p in the establishment of receptive endometrium.
Most miRNAs are known to participate in post-transcriptional regulation by inhibiting the expression of their target genes. For example, miRNA-143-3p regulates the differentiation of human stem cells through its target gene NFIC [41], miR-335 regulates the progression of corneal neovascularization by targeting EGFR [42]. In this study, we validated that MDM4 is the target gene of miR-26b-3p by a dual luciferase assay. In addition, the results of this study showed that miR-26b-3p negatively regulates the expression of MDM4 in gEECs. We speculated that miR-26b-3p might play a role in gEECs through its target gene, MDM4. Furthermore, MDM4 was observed to inhibit apoptosis and promote the proliferation of gEECs, increase the number of gEECs in the S phase and reduce the proportion of gEECs in the G1 phase, while miR-26b-3p could restore the regulatory effect of MDM4 on gEECs.
CircRNA as a new ceRNA, is mainly involved in post-transcriptional regulation as a molecular sponge for miRNA. For example, circRNA RSF1 targets miR-135b-5p to regulate the proliferation, apoptosis, and inflammation of vascular endothelial cells [43]. circ-CCNB1 acts as a ceRNA to adsorb miR-223 to regulate the proliferation and invasion of trophoblast cell, thereby affecting embryo implantation [44]. In this study, we found that circRNA3890 was significantly higher in the early endometrial receptive phase than in the receptive phase, and combined with bioinformatics tools, the analysis results showed that circRNA3890 has a targeted binding sequence to miR-26b-3p. Luciferase reporter gene and RT-qPCR analysis showed that circRNA3890 targeted down-regulation of miR-26b-3p. Our research suggests that the overexpression of circRNA3890 has a considerable impact on the suppression of miR-26b-3p expression, whereas the overexpression of linear MARCH6 mRNA has no effect. The immunofluorescence assay showed that circRNA3890 was mainly localized in the cytoplasm, which increased the possibility of binding to miRNAs. Our results indicate that miR-26b-3p promotes apoptosis in gEECs, and circRNA3890 may participate in regulating gEEC apoptosis by modulating miR-26b-3p expression. Furthermore, circRNA3890 was observed to act as a regulator of cell proliferation and apoptosis by sponge miR-26b-3p in gEECs. These findings suggest that the circRNA3890–miR-26b-3p–MDM4 axis is involved in regulating the proliferation and apoptosis of gEECs.
MDM4 is a negative regulator of tumor suppressor gene P53. In addition, the P53/P21 signaling pathway is an important signaling cascade regulator of cell survival, proliferation, apoptosis, and the cell cycle [45]. For example, HAUS6 regulates the proliferation, apoptosis, and cycle of colon cancer cells by activating the p53/p21 signaling pathway. The P53/P21 pathway is a crucial mechanism in cancer biology, playing a central role in regulating the cell cycle and apoptosis [46]. P21 is one of the most important target genes of P53 [46]. During the endometrial preparation for embryo implantation, moderate activity of the P53/P21 pathway may coordinate cell proliferation and differentiation, ensuring the endometrium reaches optimal condition during the implantation window [47]. Combining the above findings, we speculated that the circRNA3890–miR-26b-3p–MDM4 axis regulated gEECs through the p53/p21 signaling pathway. Our findings showed that miR-26b-3p targets MDM4 to regulate gEECs by activating the P53/P21 signaling pathway, and circRNA3890 attenuated the regulatory effect of miR-26b-3p on the p53/p21 signaling pathway. In summary, these findings further confirmed that the circRNA3890–miR-26b-3p–MDM4 axis exerts regulatory roles in cell cycling, proliferation, and apoptosis.
p53 is known to be involved in the establishment of endometrial receptivity by regulating LIF and plays an important role in maternal reproduction [48]. Moreover, p53 regulates the protein expression levels of VEGFA [49]. We speculated that the circRNA3890–miR-26b-3p–MDM4 axis is involved in the establishment of endometrial receptivity in dairy goats through P53. To test this hypothesis, we also examined the effect of the circRNA3890–miR-26b-3p–MDM4 axis on the protein expression levels of the receptivity marker genes VEGFA and LIF. Our results showed that miR-26b-3p promoted the protein expression levels of VEGFA and LIF. Meanwhile, miR-26b-3p reduced the effect of MDM4 on these proteins. circRNA3890 inhibited the regulation of miR-26b-3p on these proteins. Therefore, these findings suggest that the circRNA3890–miR-26b-3p–MDM4 axis may be involved in regulating the establishment of endometrial receptivity in dairy goats.
Pinopodes are a good marker for evaluating endometrial receptivity [50,51]. The results of this study in vivo showed that miR-26b-3p significantly promoted the development of mouse pinopodes. The immunohistochemistry and RT-qPCR results showed that miR-26b-3p promoted the expression of endometrial receptivity marker genes such as VEGFA and LIF in mouse endometrium. In addition, miR-26b-3p promoted embryo implantation into the endometrium in mice. These findings suggest that miR-26b-3p promoted the establishment of endometrial receptivity and promoted embryo implantation in mice.

5. Conclusions

This study found that circRNA3890 sponges miR-26b-3p to relieve the inhibitory effect of the target gene MDM4 and promoted the proliferation of gEECs through the P53/P21 signaling pathway (Figure 10). In addition, the circRNA3890–miR-26b-3p–MDM4 axis plays an important role in the establishment of receptive endometrium, which may be a potential target for regulating embryo implantation.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani16050696/s1. Figure S1: Overexpression or inhibition of circRNA3890 and miR-26b-3p; Figure S2: circRNA3890 inhibited gEECs apoptosis; Figure S3: MiR-26b-3p induces gEECs apoptosis; Figure S4: Overexpression or inhibition of MDM4 transfection efficiency in gEECs; Figure S5: MDM4 inhibited gEECs apoptosis.

Author Contributions

J.C. conceived and designed the experiments; L.L., J.C. and S.H. performed the experiments; Y.S. (Yonggan Su) and L.L. analyzed the data; L.Z. and Y.S. (Yuxuan Song) contributed reagents/materials/analysis tools; J.C. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Shaanxi Livestock and Poultry Breeding Double-chain Fusion Key Project (2022GD-TSLD-46-0202), Science and Technology Innovation 2030—Major Project Funding (2022ZD0401403), the project of central government’s funds guiding local scientific and technological development in Shaanxi Province (2024ZY-CGZY-20), and basic research on free exploration in Shaanxi Province (2024ZY-JCYJ-02-06). The funders had no role in study design, data collection and analysis, decision to publish, or manuscript preparation.

Institutional Review Board Statement

All the animal use and care protocols were confirmed in accordance with the No. 5 proclamation of the Ministry of Agriculture, P. R. China. The animal protocols were approved by the Review Committee for the Use of Animal Subjects of Northwest A&F University (Approval No. DK20211015).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

We are grateful to express our gratitude to Liu Xiaorui for her assistance in the SEM experiment.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hu, S.J.; Ren, G.; Liu, J.L.; Zhao, Z.A.; Yu, Y.S.; Su, R.W.; Ma, X.H.; Ni, H.; Lei, W.; Yang, Z.M. MicroRNA expression and regulation in mouse uterus during embryo implantation. J. Biol. Chem. 2008, 283, 23473–23484. [Google Scholar] [CrossRef] [PubMed]
  2. Achache, H.; Revel, A. Endometrial receptivity markers, the journey to successful embryo implantation. Hum. Reprod. Update 2006, 12, 731–746. [Google Scholar] [CrossRef] [PubMed]
  3. Gao, X.Y.; Zhang, Y.; Zhao, W.P.; Tian, E.J.; Ommati, M.M.; Wang, J.C.; Wang, H.W.; Zhou, B.H. Molybdenum interferes with MMPs/TIMPs expression to reduce the receptivity of porcine endometrial epithelial cells. Chem. Biol. Interact. 2025, 405, 111304. [Google Scholar] [CrossRef]
  4. Liu, X.; Zhang, L.; Liu, Y.; Cui, J.; Che, S.; An, X.; Song, Y.; Cao, B. Circ-8073 regulates CEP55 by sponging miR-449a to promote caprine endometrial epithelial cells proliferation via the PI3K/AKT/mTOR pathway. Biochim. Biophys. Acta Mol. Cell Res. 2018, 1865, 1130–1147. [Google Scholar] [CrossRef]
  5. Zhang, L.; An, X.P.; Liu, X.R.; Fu, M.Z.; Han, P.; Peng, J.Y.; Hou, J.X.; Zhou, Z.Q.; Cao, B.Y.; Song, Y.X. Characterization of the Transcriptional Complexity of the Receptive and Pre-receptive Endometria of Dairy Goats. Sci. Rep. 2015, 5, 14244. [Google Scholar] [CrossRef]
  6. Margalioth, E.J.; Ben-Chetrit, A.; Gal, M.; Eldar-Geva, T. Investigation and treatment of repeated implantation failure following IVF–ET. Hum. Reprod. 2006, 21, 3036–3043. [Google Scholar] [CrossRef] [PubMed]
  7. Makker, A.; Goel, M.M. Uterine leiomyomas: Effects on architectural, cellular, and molecular determinants of endometrial receptivity. Reprod. Sci. 2013, 20, 631–638. [Google Scholar] [CrossRef]
  8. Thum, T.; Condorelli, G. Long noncoding RNAs and microRNAs in cardiovascular pathophysiology. Circ. Res. 2015, 116, 751–762. [Google Scholar] [CrossRef]
  9. Wang, W.; Huang, L.; Lv, J.; Miao, Z.; Jin, S.; Li, S.; Cheng, Q. Silencing circRNA-ZFAND6 induces trophoblast apoptosis by activating the mitochondrial pathway through the miR-575/SOD2 axis in unexplained recurrent spontaneous abortion. BMC Women’s Health 2025, 25, 164. [Google Scholar] [CrossRef]
  10. Huo, Y.; Yuan, D.; Liu, H.; Song, Y. Fusion circRNA F-circEA1 facilitates EML4-ALK1 positive lung adenocarcinoma progression through the miR-4673/SMAD4/ADAR1 axis. Cell. Signal. 2025, 127, 111571. [Google Scholar] [CrossRef]
  11. Yuan, H.; Chen, C.; Li, H.; Qu, G.; Chen, L.; Liu, Y.; Zhang, Y.; Zhao, Q.; Lian, C.; Ji, A.; et al. Role of a novel circRNA-CGNL1 in regulating pancreatic cancer progression via NUDT4-HDAC4-RUNX2-GAMT-mediated apoptosis. Mol. Cancer 2024, 23, 27. [Google Scholar] [CrossRef] [PubMed]
  12. Zou, H.; Deng, W.; Xu, L.; Shi, M.; Liu, L.; Gong, L.; Cui, D.; Zhang, F. CircRNA-0013747 Promotes Mesangial Cell Proliferation in Immunoglobulin a Nephropathy through Modulation of the Warburg Effect. J. Physiol. Investig. 2025, 68, 43–56. [Google Scholar] [CrossRef]
  13. Ha, M.; Kim, V.N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 2014, 15, 509–524. [Google Scholar] [CrossRef] [PubMed]
  14. Cheng, A.M.; Byrom, M.W.; Shelton, J.; Ford, L.P. Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res. 2005, 33, 1290–1297. [Google Scholar] [CrossRef]
  15. Yang, G.; Li, M.; Yang, Q.; Zhai, X.; Halima, J.; Hu, Q.; Lei, C.; Dang, R. Bta-miR-127 inhibits secretion, proliferation and promotes apoptosis by targeting ITGA6 in bovine Sertoli cell. Int. J. Biol. Macromol. 2023, 253, 126838. [Google Scholar] [CrossRef]
  16. Yao, K.; Kang, Q.; Chen, K.; Shi, B.; Jin, X. MiR-124-3p negatively impacts embryo implantation via suppressing uterine receptivity formation and embryo development. Reprod. Biol. Endocrinol. 2024, 22, 16. [Google Scholar] [CrossRef]
  17. Yang, L.; Xu, H.R.; Zhang, X.; Shi, Y.; Shi, J.X.; Chen, Q.Q.; Shen, X.R.; He, Y.P.; Tang, J.N.; Gu, W.W.; et al. Increased miR-3074-5p expression promotes M1 polarization and pyroptosis of macrophages via ERalpha/NLRP3 pathway and induces adverse pregnancy outcomes in mice. Cell Death Discov. 2024, 10, 171. [Google Scholar] [CrossRef]
  18. Inyawilert, W.; Fu, T.Y.; Lin, C.T.; Tang, P.C. Let-7-mediated suppression of mucin 1 expression in the mouse uterus during embryo implantation. J. Reprod. Dev. 2015, 61, 138–144. [Google Scholar] [CrossRef]
  19. Song, Y.; An, X.; Zhang, L.; Fu, M.; Peng, J.; Han, P.; Hou, J.; Zhou, Z.; Cao, B. Identification and profiling of microRNAs in goat endometrium during embryo implantation. PLoS ONE 2015, 10, e0122202. [Google Scholar] [CrossRef]
  20. Shvarts, A.; Steegenga, W.T.; Riteco, N.; van Laar, T.; Dekker, P.; Bazuine, M.; van Ham, R.C.; van der Houven van Oordt, W.; Hateboer, G.; van der Eb, A.J.; et al. MDMX: A novel p53-binding protein with some functional properties of MDM2. EMBO J. 1996, 15, 5349–5357. [Google Scholar] [CrossRef] [PubMed]
  21. Soliman, A.M.; Kodous, A.S.; Al-Sherif, D.A.; Ghorab, M.M. Quinazoline sulfonamide derivatives targeting MicroRNA-34a/MDM4/p53 apoptotic axis with radiosensitizing activity. Future Med. Chem. 2024, 16, 929–948. [Google Scholar] [CrossRef]
  22. Krivec, N.; Couvreu de Deckersberg, E.; Lei, Y.; Al Delbany, D.; Regin, M.; Verhulst, S.; van Grunsven, L.A.; Sermon, K.; Spits, C. Gain of 1q confers an MDM4-driven growth advantage to undifferentiated and differentiating hESC while altering their differentiation capacity. Cell Death Dis. 2024, 15, 852. [Google Scholar] [CrossRef]
  23. Zhang, L.; Liu, X.; Liu, J.; Ma, X.; Zhou, Z.; Song, Y.; Cao, B. miR-26a promoted endometrial epithelium cells (EECs) proliferation and induced stromal cells (ESCs) apoptosis via the PTEN-PI3K/AKT pathway in dairy goats. J. Cell Physiol. 2018, 233, 4688–4706. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, L.; Liu, X.; Liu, J.; Zhou, Z.; Song, Y.; Cao, B.; An, X. miR-182 aids in receptive endometrium development in dairy goats by down-regulating PTN expression. PLoS ONE 2017, 12, e0179783. [Google Scholar] [CrossRef] [PubMed]
  25. An, X.; Liu, X.; Zhang, L.; Liu, J.; Zhao, X.; Chen, K.; Ma, H.; Li, G.; Cao, B.; Song, Y. MiR-449a regulates caprine endometrial stromal cell apoptosis and endometrial receptivity. Sci. Rep. 2017, 7, 12248. [Google Scholar] [CrossRef]
  26. Liu, X.; Zhang, L.; Yang, L.; Cui, J.; Che, S.; Liu, Y.; Han, J.; An, X.; Cao, B.; Song, Y. miR-34a/c induce caprine endometrial epithelial cell apoptosis by regulating circ-8073/CEP55 via the RAS/RAF/MEK/ERK and PI3K/AKT/mTOR pathways. J. Cell Physiol. 2020, 235, 10051–10067. [Google Scholar] [CrossRef] [PubMed]
  27. Peng, S.; Song, C.; Li, H.; Cao, X.; Ma, Y.; Wang, X.; Huang, Y.; Lan, X.; Lei, C.; Chaogetu, B.; et al. Circular RNA SNX29 Sponges miR-744 to Regulate Proliferation and Differentiation of Myoblasts by Activating the Wnt5a/Ca2+ Signaling Pathway. Mol. Ther. Nucleic Acids 2019, 16, 481–493. [Google Scholar] [CrossRef]
  28. Zhu, K.; Hu, X.; Chen, H.; Li, F.; Yin, N.; Liu, A.L.; Shan, K.; Qin, Y.W.; Huang, X.; Chang, Q.; et al. Downregulation of circRNA DMNT3B contributes to diabetic retinal vascular dysfunction through targeting miR-20b-5p and BAMBI. EBioMedicine 2019, 49, 341–353. [Google Scholar] [CrossRef]
  29. Ma, L.; Zhang, M.; Cao, F.; Han, J.; Han, P.; Wu, Y.; Deng, R.; Zhang, G.; An, X.; Zhang, L.; et al. Effect of MiR-100-5p on proliferation and apoptosis of goat endometrial stromal cell in vitro and embryo implantation in vivo. J. Cell Mol. Med. 2022, 26, 2543–2556. [Google Scholar] [CrossRef]
  30. Song, Y.; Zhang, L.; Liu, X.; Niu, M.; Cui, J.; Che, S.; Liu, Y.; An, X.; Cao, B. Analyses of circRNA profiling during the development from pre-receptive to receptive phases in the goat endometrium. J. Anim. Sci. Biotechnol. 2019, 10, 34. [Google Scholar] [CrossRef]
  31. Miravet-Valenciano, J.A.; Rincon-Bertolin, A.; Vilella, F.; Simon, C. Understanding and improving endometrial receptivity. Curr. Opin. Obstet. Gyn 2015, 27, 187–192. [Google Scholar] [CrossRef] [PubMed]
  32. Cullinan, E.B.; Abbondanzo, S.J.; Anderson, P.S.; Pollard, J.W.; Lessey, B.A.; Stewart, C.L. Leukemia inhibitory factor (LIF) and LIF receptor expression in human endometrium suggests a potential autocrine/paracrine function in regulating embryo implantation. Proc. Natl. Acad. Sci. USA 1996, 93, 3115–3120. [Google Scholar] [CrossRef]
  33. Parr, E.L.; Tung, H.N.; Parr, M.B. Apoptosis as the mode of uterine epithelial cell death during embryo implantation in mice and rats. Biol. Reprod. 1987, 36, 211–225. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, S.Y.; Lou, J.F.; Li, Y.F.; Zhou, F.L.; Yan, Z.Q.; Lyu, X.L.; Zhao, Y.J. Recent Progress and Clinical Development of Inhibitors that Block MDM4/p53 Protein-Protein Interactions. J. Med. Chem. 2021, 64, 10621–10640. [Google Scholar] [CrossRef]
  35. Liu, Y.; Wang, X.H.; Wang, G.; Yang, Y.S.; Yuan, Y.; Ouyang, L. The past, present and future of potential small-molecule drugs targeting p53-MDM2/MDMX for cancer therapy. Eur. J. Med. Chem. 2019, 176, 92–104. [Google Scholar] [CrossRef]
  36. Adu-Gyamfi, E.A.; Cheeran, E.A.; Salamah, J.; Enabulele, D.B.; Tahir, A.; Lee, B.K. Long non-coding RNAs: A summary of their roles in placenta development and pathologydagger. Biol. Reprod. 2024, 110, 431–449. [Google Scholar] [CrossRef]
  37. Zhang, L.; Liu, X.; Cui, J.; Che, S.; Liu, Y.; An, X.; Cao, B.; Song, Y. LncRNA882 regulates leukemia inhibitory factor (LIF) by sponging miR-15b in the endometrial epithelium cells of dairy goat. J. Cell Physiol. 2019, 234, 4754–4767. [Google Scholar] [CrossRef]
  38. Lee, Y.S.; Dutta, A. MicroRNAs in cancer. Annu. Rev. Pathol. 2009, 4, 199–227. [Google Scholar] [CrossRef] [PubMed]
  39. Geng, F.; Lu, G.F.; Ji, M.H.; Kong, D.Y.; Wang, S.Y.; Tian, H.; Xie, Z.M.; Pan, M.; Gong, N.L. MicroRNA-26b-3p/ANTXR1 signaling modulates proliferation, migration, and apoptosis of glioma. Am. J. Transl. Res. 2019, 11, 7568–7578. [Google Scholar]
  40. Tranguch, S.; Dey, S.K. A lifetime of deciphering complexities of embryo implantation. Int. J. Dev. Biol. 2014, 58, 79–86. [Google Scholar] [CrossRef]
  41. Gao, S.; Ge, L.H.; Zhao, Y.M.; Li, P.; Li, Y.Y.; Zhao, W. Hsa-miRNA-143-3p regulates the odontogenic differentiation of human stem cells from the apical papilla by targeting NFIC. Int. Endod. J. 2022, 55, 263–274. [Google Scholar] [CrossRef]
  42. Qian, J.; Yu, J.; Zhu, X.; Liang, S. MiR-335 promotes corneal neovascularization by Targeting EGFR. BMC Ophthalmol. 2022, 22, 267. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, X.H.; Lu, J.Y.; Zhang, Q.H.; Luo, Q.; Liu, B. CircRNA RSF1 regulated ox-LDL induced vascular endothelial cells proliferation, apoptosis and inflammation through modulating miR-135b-5p/HDAC1 axis in atherosclerosis. Biol. Res. 2021, 54, 11. [Google Scholar] [CrossRef] [PubMed]
  44. Jing, M.Y.; Xie, L.D.; Chen, X.; Zhou, Y.; Jin, M.M.; He, W.H.; Wang, D.M.; Liu, A.X. Circ-CCNB1 Modulates Trophoblast Proliferation and Invasion in Spontaneous Abortion by Regulating miR-223/SIAH1 axis. Endocrinology 2022, 163, bqac093. [Google Scholar] [CrossRef] [PubMed]
  45. Li, W.; Li, K.; Wang, Z.; Fa, Z. MicroRNA-377-3p promotes cell proliferation and inhibits cell cycle arrest and cell apoptosis in hepatocellular carcinoma by affecting EGR1-mediated p53 activation. Pathol. Res. Pract. 2022, 234, 153855. [Google Scholar] [CrossRef]
  46. Thangavelu, L.; Altamimi, A.S.A.; Ghaboura, N.; Babu, M.A.; Roopashree, R.; Sharma, P.; Pal, P.; Choudhary, C.; Prasad, G.V.S.; Sinha, A.; et al. Targeting the p53–p21 axis in liver cancer: Linking cellular senescence to tumor suppression and progression. Pathol. Res. Pract. 2024, 263, 155652. [Google Scholar] [CrossRef]
  47. Palomares, A.R.; Castillo-Dominguez, A.A.; Ruiz-Galdon, M.; Rodriguez-Wallberg, K.A.; Reyes-Engel, A. Genetic variants in the p53 pathway influence implantation and pregnancy maintenance in IVF treatments using donor oocytes. J. Assist. Reprod. Genet. 2021, 38, 3267–3275. [Google Scholar] [CrossRef]
  48. Hu, W.; Feng, Z.; Teresky, A.K.; Levine, A.J. p53 regulates maternal reproduction through LIF. Nature 2007, 450, 721–724. [Google Scholar] [CrossRef]
  49. Gutierrez-Seijo, A.; Garcia-Martinez, E.; Barrio-Alonso, C.; Pareja-Malagon, M.; Acosta-Ocampo, A.; Fernandez-Santos, M.E.; Puig-Kroger, A.; Parra-Blanco, V.; Mercader, E.; Marquez-Rodas, I.; et al. CCL20/TNF/VEGFA Cytokine Secretory Phenotype of Tumor-Associated Macrophages Is a Negative Prognostic Factor in Cutaneous Melanoma. Cancers 2021, 13, 3943. [Google Scholar] [CrossRef]
  50. Quinn, C.E.; Casper, R.F. Pinopodes: A questionable role in endometrial receptivity. Hum. Reprod. Update 2009, 15, 229–236. [Google Scholar] [CrossRef]
  51. D’Ippolito, S.; Di Nicuolo, F.; Papi, M.; Castellani, R.; Palmieri, V.; Masciullo, V.; Arena, V.; Tersigni, C.; Bernabei, M.; Pontecorvi, A.; et al. Expression of Pinopodes in the Endometrium from Recurrent Pregnancy Loss Women Role of Thrombomodulin and Ezrin. J. Clin. Med. 2020, 9, 2634. [Google Scholar] [CrossRef] [PubMed]
Animals 16 00696 g001
Figure 1. Expression and stability of circRNA3890 in various tissues. (a) Schematic for circRNA 3890 was derived from the MARCH6 gene. (b) circRNA3890 levels in PE and RE. (c) CircRNA3890 and MARCH6 expression levels in gEECs treated with actinomycin D (1 mg/mL). (d) RT-qPCR was used to ascertain the amounts of circRNA3890 and MARCH6 in gEECs that had received RNase R treatment. (e) Fluorescence in situ hybridization was used to detect the expression of circRNA3890 in gEECs. The scale bar represents 50 μm. Each result is shown as the mean ± SEM of three values: ** p < 0.01.
Figure 1. Expression and stability of circRNA3890 in various tissues. (a) Schematic for circRNA 3890 was derived from the MARCH6 gene. (b) circRNA3890 levels in PE and RE. (c) CircRNA3890 and MARCH6 expression levels in gEECs treated with actinomycin D (1 mg/mL). (d) RT-qPCR was used to ascertain the amounts of circRNA3890 and MARCH6 in gEECs that had received RNase R treatment. (e) Fluorescence in situ hybridization was used to detect the expression of circRNA3890 in gEECs. The scale bar represents 50 μm. Each result is shown as the mean ± SEM of three values: ** p < 0.01.
Animals 16 00696 g001
Animals 16 00696 g002
Figure 2. circRNA3890 targets miR-26b-3p and reduces its level in gEECs. (a) Luciferase reporter genes with binding sites (WT-circRNA3890) and binding site mutations (MUT-circRNA3890) are shown in a schematic design. The red-labeled nucleotides represent the “seed sequence” of miR-26b-3p, while the yellow ones represent mutated nucleotides. (b) After co-transfecting 293T cells with WT-circRNA3890, MUT-circRNA3890 or miR-26b-3p, NC (negative control), double luciferase activity was analyzed. (c,d) Regulatory effect of circRNA3890 on miR-26b-3p in gEECs was detected using qRT-PCR. (e) miR-26b-3p decreased the circRNA3890 levels in gEECs. (f–i) Effects of miR-26b-3p on LIF and VEGFA protein expression in gEECs. (j–m) Protein expression levels of LIF and VEGFA after transfection with pc2.1-circRNA3890/si-circRNA3890. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Figure 2. circRNA3890 targets miR-26b-3p and reduces its level in gEECs. (a) Luciferase reporter genes with binding sites (WT-circRNA3890) and binding site mutations (MUT-circRNA3890) are shown in a schematic design. The red-labeled nucleotides represent the “seed sequence” of miR-26b-3p, while the yellow ones represent mutated nucleotides. (b) After co-transfecting 293T cells with WT-circRNA3890, MUT-circRNA3890 or miR-26b-3p, NC (negative control), double luciferase activity was analyzed. (c,d) Regulatory effect of circRNA3890 on miR-26b-3p in gEECs was detected using qRT-PCR. (e) miR-26b-3p decreased the circRNA3890 levels in gEECs. (f–i) Effects of miR-26b-3p on LIF and VEGFA protein expression in gEECs. (j–m) Protein expression levels of LIF and VEGFA after transfection with pc2.1-circRNA3890/si-circRNA3890. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Animals 16 00696 g002
Animals 16 00696 g003
Figure 3. Regulatory effect of circRNA3890 on gEECs. (a–c) Indicators of cell proliferation were measured following treatment with CCK-8 and EdU. The scale bar represents 100 μm. (d,e) The protein expression levels of BCL2 and BAX analyzed using Western blotting after overexpression of circRNA3890 in gEECs. (f,g) FCM was used to detect apoptosis and cell phases. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Figure 3. Regulatory effect of circRNA3890 on gEECs. (a–c) Indicators of cell proliferation were measured following treatment with CCK-8 and EdU. The scale bar represents 100 μm. (d,e) The protein expression levels of BCL2 and BAX analyzed using Western blotting after overexpression of circRNA3890 in gEECs. (f,g) FCM was used to detect apoptosis and cell phases. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Animals 16 00696 g003
Animals 16 00696 g004
Figure 4. Interference with circRNA3890 promotes apoptosis in gEECs. (a) CCK-8 investigation of the effects of circRNA3890 interference on gEECs cell viability. (b,c) EdU analysis of the effects of circRNA3890 interference on gEECs cell proliferation. The scale bar represents 100 μm. (d,e) The amounts of BCL2 and BAX protein expression were determined using Western blotting following the interference of circRNA3890 in gEECs. (f,g) FCM was used to examine how circRNA3890 interference affected cell phases and apoptosis. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Figure 4. Interference with circRNA3890 promotes apoptosis in gEECs. (a) CCK-8 investigation of the effects of circRNA3890 interference on gEECs cell viability. (b,c) EdU analysis of the effects of circRNA3890 interference on gEECs cell proliferation. The scale bar represents 100 μm. (d,e) The amounts of BCL2 and BAX protein expression were determined using Western blotting following the interference of circRNA3890 in gEECs. (f,g) FCM was used to examine how circRNA3890 interference affected cell phases and apoptosis. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Animals 16 00696 g004
Animals 16 00696 g005
Figure 5. Regulatory effects of miR-26b-3p on gEECs in vitro. (a) miR-26b-3p levels in pre-receptive endometrium (PE) and receptive endometrium (RE) of dairy goats. (b,c) The influence of gEECs after transfection with miR-26b-3p mimic/inhibitor was analyzed using EdU. The scale bar represents 100 μm. (d) CCK-8 analysis of EEC activity after transfection with miR-26b-3p mimic/inhibitor. (e,f) Effects of apoptosis and cell cycle phases after transfection with miR-26b-3p mimic/inhibitor were analyzed by FCM. (g–j) The expression levels of BCL2 and BAX in gEECs after transfection with miR-26b-3p mimic/inhibitor were analyzed using Western blotting. Each result is shown as the mean ± SEM of three values: ** p < 0.01.
Figure 5. Regulatory effects of miR-26b-3p on gEECs in vitro. (a) miR-26b-3p levels in pre-receptive endometrium (PE) and receptive endometrium (RE) of dairy goats. (b,c) The influence of gEECs after transfection with miR-26b-3p mimic/inhibitor was analyzed using EdU. The scale bar represents 100 μm. (d) CCK-8 analysis of EEC activity after transfection with miR-26b-3p mimic/inhibitor. (e,f) Effects of apoptosis and cell cycle phases after transfection with miR-26b-3p mimic/inhibitor were analyzed by FCM. (g–j) The expression levels of BCL2 and BAX in gEECs after transfection with miR-26b-3p mimic/inhibitor were analyzed using Western blotting. Each result is shown as the mean ± SEM of three values: ** p < 0.01.
Animals 16 00696 g005
Animals 16 00696 g006
Figure 6. MDM4 is the target of miR-26b-3p. (a) MDM4 mRNA levels in PE and RE of dairy goat. (b) Luciferase reporter genes with binding sites (WT-MDM4-3′UTR) and binding site mutations (MUT-MDM4-3′UTR) are shown in a schematic design. The red-labeled nucleotides represent the “seed sequence” of miR-26b-3p, while the blue ones represent mutated nucleotides. (c) Double luciferase activity was analyzed after co-transfecting 293T cells with WT-MDM4-3′UTR, MUT-MDM4-3′UTR, or miR-26b-3p, NC (negative control). (d–f) The mRNA and protein expression levels of MDM4 in gEECs after transfection with miR-26b-3p mimic/inhibitor. (g–i) The regulatory effect of circRNA3890 on MDM4 protein levels was detected using Western blotting in gEECs. (j,k) Effects of MDM4 overexpression or interference on LIF and VEGFA protein expression in gEECs. Each result is shown as the mean ± SEM of three values; ** p < 0.01; * p < 0.05.
Figure 6. MDM4 is the target of miR-26b-3p. (a) MDM4 mRNA levels in PE and RE of dairy goat. (b) Luciferase reporter genes with binding sites (WT-MDM4-3′UTR) and binding site mutations (MUT-MDM4-3′UTR) are shown in a schematic design. The red-labeled nucleotides represent the “seed sequence” of miR-26b-3p, while the blue ones represent mutated nucleotides. (c) Double luciferase activity was analyzed after co-transfecting 293T cells with WT-MDM4-3′UTR, MUT-MDM4-3′UTR, or miR-26b-3p, NC (negative control). (d–f) The mRNA and protein expression levels of MDM4 in gEECs after transfection with miR-26b-3p mimic/inhibitor. (g–i) The regulatory effect of circRNA3890 on MDM4 protein levels was detected using Western blotting in gEECs. (j,k) Effects of MDM4 overexpression or interference on LIF and VEGFA protein expression in gEECs. Each result is shown as the mean ± SEM of three values; ** p < 0.01; * p < 0.05.
Animals 16 00696 g006
Animals 16 00696 g007
Figure 7. Regulatory effects of MDM4 on gEECs in vitro. (a–c) The effects of MDM4 overexpression on gEECs proliferation were analyzed using EdU and CCK-8. The scale bar represents 100 μm. (d–f) The effects of MDM4 interference on the proliferation of gEECs were analyzed by CCK8 and EdU. The scale bar represents 100 μm. (g–j) The protein expression levels of BCL2 and BAX were analyzed using Western blotting after overexpression or interference of MDM4 in gEECs. (k–n) The effects of overexpression or interference of MDM4 on apoptosis and cell cycle phases were analyzed using FCM. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Figure 7. Regulatory effects of MDM4 on gEECs in vitro. (a–c) The effects of MDM4 overexpression on gEECs proliferation were analyzed using EdU and CCK-8. The scale bar represents 100 μm. (d–f) The effects of MDM4 interference on the proliferation of gEECs were analyzed by CCK8 and EdU. The scale bar represents 100 μm. (g–j) The protein expression levels of BCL2 and BAX were analyzed using Western blotting after overexpression or interference of MDM4 in gEECs. (k–n) The effects of overexpression or interference of MDM4 on apoptosis and cell cycle phases were analyzed using FCM. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Animals 16 00696 g007
Animals 16 00696 g008
Figure 8. Effects of circRNA3890/miR-26b-3p/MDM4 axis on key P53/P21 signaling pathway proteins. (a–d) Effects of MDM4 overexpression or interference on P21, P53, CDK2, and cyclinE1 protein expression in gEECs. (e–h) Effects of miR-26b-3p on P21, P53, CDK2, and cyclinE1 protein expression in gEECs. (i–l) Protein expression levels of P21, P53, CDK2 and cyclinE1 after transfection with pc2.1-circRNA3890/si-circRNA3890. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Figure 8. Effects of circRNA3890/miR-26b-3p/MDM4 axis on key P53/P21 signaling pathway proteins. (a–d) Effects of MDM4 overexpression or interference on P21, P53, CDK2, and cyclinE1 protein expression in gEECs. (e–h) Effects of miR-26b-3p on P21, P53, CDK2, and cyclinE1 protein expression in gEECs. (i–l) Protein expression levels of P21, P53, CDK2 and cyclinE1 after transfection with pc2.1-circRNA3890/si-circRNA3890. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Animals 16 00696 g008
Animals 16 00696 g009
Figure 9. MiR-26b-3p promotes mouse embryo attachment. (a) The mRNA expression level of miR-26b-3p was detected using RT-qPCR. (b) The effect of miR-26b-3p agomir on endometrium pinopodes was observed using scanning electron microscopy. The scale bar represents 2 μm. The red arrows indicate annotations for pinopodes. (c) Immunohistochemical analysis of VEGFA and LIF expression in the endometrium. The red scale represents 50 μm. (d,e) miR-26b-3p promotes the implantation of mouse embryos. (f) The thickness of the endometrium was observed by HE staining. The scale bar represents 50 μm. (g,h) RT-qPCR was used to detect mRNA expression levels of receptive endometrial marker genes. UC: uterine cavity, LE: luminal epithelial cells, GE: glandular epithelial cells, SC: stromal cells. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Figure 9. MiR-26b-3p promotes mouse embryo attachment. (a) The mRNA expression level of miR-26b-3p was detected using RT-qPCR. (b) The effect of miR-26b-3p agomir on endometrium pinopodes was observed using scanning electron microscopy. The scale bar represents 2 μm. The red arrows indicate annotations for pinopodes. (c) Immunohistochemical analysis of VEGFA and LIF expression in the endometrium. The red scale represents 50 μm. (d,e) miR-26b-3p promotes the implantation of mouse embryos. (f) The thickness of the endometrium was observed by HE staining. The scale bar represents 50 μm. (g,h) RT-qPCR was used to detect mRNA expression levels of receptive endometrial marker genes. UC: uterine cavity, LE: luminal epithelial cells, GE: glandular epithelial cells, SC: stromal cells. Each result is shown as the mean ± SEM of three values: ** p < 0.01; * p < 0.05.
Animals 16 00696 g009
Animals 16 00696 g010
Figure 10. Model of circRNA3890 regulatory mechanism on gEECs. In this model, circRNA3890 regulates gEECs by functioning as a ceRNA for miR-26b-3p and shows a circRNA–miRNA–mRNA network, thereby exerting biological effects.
Figure 10. Model of circRNA3890 regulatory mechanism on gEECs. In this model, circRNA3890 regulates gEECs by functioning as a ceRNA for miR-26b-3p and shows a circRNA–miRNA–mRNA network, thereby exerting biological effects.
Animals 16 00696 g010
Table 1. Primer sequences.
Table 1. Primer sequences.
GenePrimer Sequences (5′ → 3′)
β-actinF: GATCTGGCACCACACCTTCT
R: GGGTCATCTTCTCACGGTTG
MDM4 (qPCR)F: GATCAGCAGGAGCAGCACATGG
R: GCAGCATCTGTAGCAGCAGTAGC
MDM4 (pcDNA3.1)F: cgaGGTACCATGACATCATTTTCCACCTCTACCCAGTG
R: CGCTCGAGCTATGCTACAAAAACCTTAATAACCAACTGAATCTCCTTCT
MDM4 (Check2)F: cgCTCGAGTATTTAATTTAATTTCTTACTGTTATTTTCTGGTAGGGAATGTTCTTGGGCA
R: ATGCGGCCGCCGAGACAGAGATGTGCTACTG
circRNA3890 (qPCR)F: AGAAGTCCTTACGGGCGAGT
R: GCAGAAGCAGCTCAAGGGAC
circRNA3890 (pcD2.1-ciR)F: GGGGTACCTGAAATATGCTATCTTACAGTGATGCTCCAGTGAGTGAACTGTCC
R: CGGGATCCTCAAGAAAAAATATATTCACCTGAGTGGAAAATTTAAAGGC
circRNA3890 (Check2)F: cgCTCGAGTGATGCTCCAGTGAGTGAACTGTCC
R: ATGCGGCCGCCCTGAGTGGAAAATTTAAAGGC
MARCH6 (qPCR)F: ACTGTCCCTTGAGCTGCTTC
R: CGGGCATGCTGGTTATTGTT
VEGFA (qPCR)F: GGGCTCTTCTCGCTCCGTAGTAG
R: CCCTCTCCTCTTCCTTCTCTTCCTC
LIF (qPCR)F: TGTAAATGCCACCTGTGCCATACG
R: CATTGAGCTGTGCCAGTTGATTCTTG
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
miR-26b-3p-LoopgtcgtatccagtgcagggtccgaggtattcgcactggatacgacGAGCCAAG
miR-26b-3p-FWgcgcgcCCTGTTCTCCATTA
Reverse PrimerGTGCAGGGTCCGAGGT
Note: The characters with underscore were restriction enzyme cutting sites of Xho I and Not I for constructing psiCHECK2. The italicized characters with underscore were restriction enzyme cutting sites of Kpn I and Xho I for constructing pcDNA3.1. The italicized characters with underscore were restriction enzyme cutting sites of Kpn I and BamH I for constructing pCD2.1-ciR. circRNA3890 (qPCR) was an outward-facing primer and divergently primed.
Table 2. Antibody information for Western blots.
Table 2. Antibody information for Western blots.
GeneManufacturerProduct NumberDilution Ratio
β-actinBeyotime, Shanghai, ChinaAA1281:1000
BAXBeyotime, Shanghai, ChinaAB0261:500
BCL2Beyotime, Shanghai, ChinaAB1121:500
MDM4Proteintech, Wuhan, China17914-1-AP1:500
P53Beyotime, Shanghai, ChinaAF02551:500
P21Beyotime, Shanghai, ChinaAP0211:500
CDK2Abways, Shanghai, ChinaCY50201:1000
Cyclin E1Abways, Shanghai, ChinaCY54661:1000
VEGFABBI, Shanghai, ChinaD1607881:500
LIFBoster, Wuhan, ChinaBA1239-21:500
HRP-labeled Goat Anti-Rabbit IgG (H+L)Beyotime, Shanghai, ChinaA02081:1000
HRP-labeled Goat Anti-Mouse IgG (H+L)Beyotime, Shanghai, ChinaA02161:1000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cui, J.; Li, L.; Su, Y.; Han, S.; Zhang, L.; Song, Y. Regulatory Effect of circRNA3890 on the Establishment of Receptive Endometrium in Dairy Goats. Animals 2026, 16, 696. https://doi.org/10.3390/ani16050696

AMA Style

Cui J, Li L, Su Y, Han S, Zhang L, Song Y. Regulatory Effect of circRNA3890 on the Establishment of Receptive Endometrium in Dairy Goats. Animals. 2026; 16(5):696. https://doi.org/10.3390/ani16050696

Chicago/Turabian Style

Cui, Jiuzeng, Linxi Li, Yonggan Su, Songrong Han, Lei Zhang, and Yuxuan Song. 2026. "Regulatory Effect of circRNA3890 on the Establishment of Receptive Endometrium in Dairy Goats" Animals 16, no. 5: 696. https://doi.org/10.3390/ani16050696

APA Style

Cui, J., Li, L., Su, Y., Han, S., Zhang, L., & Song, Y. (2026). Regulatory Effect of circRNA3890 on the Establishment of Receptive Endometrium in Dairy Goats. Animals, 16(5), 696. https://doi.org/10.3390/ani16050696

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop