Selenium Attenuates LPS-Induced Injury in Ovine Granulosa Cells by Protecting Mitochondrial Ultrastructure and Cellular Homeostasis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation, Culture, and Treatment of Primary Ovine GCs
2.2. Immunofluorescence Staining
2.3. Cell Counting Kit-8 (CCK-8) Assay
2.4. Enzyme-Linked Immunosorbent Assay (ELISA)
2.5. Mitochondrial Membrane Potential (ΔΨm) Detection
2.6. Reactive Oxygen Species (ROS) Detection
2.7. Annexin V-FITC/PI/Hoechst 33342 Apoptosis Assay
2.8. Transmission Electron Microscopy (TEM)
2.9. Catalase (CAT) Activity Detection
2.10. Total Superoxide Dismutase (SOD) Activity Detection
2.11. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR
2.12. Western Blot Analysis
2.13. Statistical Analysis
3. Results
3.1. Identification in Ovine GCs
3.2. Establishment of the LPS-Induced Inflammatory Model
3.3. Screening for the Optimal Se Concentration
3.4. Effects of Se on the Morphological Structure of LPS-Induced Ovine Ovarian GCs
3.5. Effects of Se on ΔΨm, Mitophagy-Related Markers, and Mitochondrial Dynamics in LPS-Induced Ovine Follicular GCs
3.6. Effects of Se on the Expression of Inflammatory Factors in LPS-Induced Ovine Ovarian Follicular GCs
3.7. Effects of Se on the Proliferation and Apoptosis of LPS-Induced Ovine Ovarian Follicular GCs
3.8. Effects of Se on the Antioxidant Capacity of LPS-Induced Ovine Ovarian Follicular GCs
3.9. Effects of Se on Steroid Hormones in LPS-Induced Ovine Ovarian Follicular GCs
4. Discussion
4.1. Effects of Se on Ovine Follicular GCs
4.2. LPS-Induced Inflammatory Model of Ovine Ovarian Follicular GCs
4.3. Se Regulated Mitophagy and Mitochondrial Dynamic Homeostasis in LPS-Induced Ovine Follicular GCs
4.4. Effects of Se on Oxidative Stress Injury in LPS-Induced Ovine GCs
4.5. Effects of Se on Proliferation and Apoptosis in LPS-Induced Ovine Ovarian Follicular GCs
4.6. Effects of Se on Steroid Hormone Synthesis in LPS-Induced Ovine Ovarian Follicular GCs
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, J.; Tang, M.; Tang, H.; Wang, M.; Guan, H.; Tang, L.; Zhang, H. Sphingosine 1-phosphate alleviates radiation-induced ferroptosis in ovarian granulosa cells by upregulating glutathione peroxidase 4. Reprod. Toxicol. 2023, 115, 49–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daghestani, M.H.; Daghestani, M.H.; Warsy, A.; El-Ansary, A.; Omair, M.A.; Omair, M.A.; Hassen, L.M.; Alhumaidhi, E.M.; Al Qahtani, B.; Harrath, A.H. Adverse Effects of Selected Markers on the Metabolic and Endocrine Profiles of Obese Women with and Without PCOS. Front. Endocrinol. 2021, 12, 665446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gershon, E.; Dekel, N. Newly Identified Regulators of Ovarian Folliculogenesis and Ovulation. Int. J. Mol. Sci. 2020, 21, 4565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Q.; Hong, W.; Li, Y.; Ling, S.; Zhou, Z.; Dai, Y.; Wu, W.; Weng, R.; Zhong, Z.; Tan, J.; et al. Chitosan oligosaccharide improves ovarian granulosa cells inflammation and oxidative stress in patients with polycystic ovary syndrome. Front. Immunol. 2023, 14, 1086232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jozkowiak, M.; Piotrowska-Kempisty, H.; Kobylarek, D.; Gorska, N.; Mozdziak, P.; Kempisty, B.; Rachon, D.; Spaczynski, R.Z. Endocrine Disrupting Chemicals in Polycystic Ovary Syndrome: The Relevant Role of the Theca and Granulosa Cells in the Pathogenesis of the Ovarian Dysfunction. Cells 2022, 12, 174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Ren, J.; Wang, F.; Pan, M.; Cui, L.; Li, M.; Qu, F. Mitochondrial and glucose metabolic dysfunctions in granulosa cells induce impaired oocytes of polycystic ovary syndrome through Sirtuin 3. Free Radic. Biol. Med. 2022, 187, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Liu, H.; Li, Z.; Fan, H.; Yan, X.; Liu, X.; Xuan, J.; Feng, D.; Wei, X. The Release of Peripheral Immune Inflammatory Cytokines Promote an Inflammatory Cascade in PCOS Patients via Altering the Follicular Microenvironment. Front. Immunol. 2021, 12, 685724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duffy, D.M.; Ko, C.; Jo, M.; Brannstrom, M.; Curry, T.E. Ovulation: Parallels with Inflammatory Processes. Endocr. Rev. 2019, 40, 369–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seekford, Z.K.; Wohlgemuth, S.E.; Sheldon, I.M.; Bromfield, J.J. Exposure of bovine granulosa cells to lipopolysaccharide reduces progesterone secretion during luteinization. Biol. Reprod. 2025, 112, 1243–1255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bromfield, J.J.; Sheldon, I.M. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 2011, 152, 5029–5040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koga, A.; Thongsiri, C.; Kudo, D.; Phuong, D.N.D.; Iwamoto, Y.; Fujii, W.; Nagai-Yoshioka, Y.; Yamasaki, R.; Ariyoshi, W. Mechanisms Underlying the Suppression of IL-1β Expression by Magnesium Hydroxide Nanoparticles. Biomedicines 2023, 11, 1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fock, E.M.; Parnova, R.G. Protective Effect of Mitochondria-Targeted Antioxidants against Inflammatory Response to Lipopolysaccharide Challenge: A Review. Pharmaceutics 2021, 13, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choudhury, D.; Rong, N.; Senthil Kumar, H.V.; Swedick, S.; Samuel, R.Z.; Mehrotra, P.; Toftegaard, J.; Rajabian, N.; Thiyagarajan, R.; Podder, A.K.; et al. Proline restores mitochondrial function and reverses aging hallmarks in senescent cells. Cell Rep. 2024, 43, 113738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.; Huang, S.; Wang, P.; Shi, X.; Li, S.; Ye, Y.; Zhang, W.; Shi, L.; Zhou, X.; Tang, X. Global trends and hotspots in the field of mitochondrial dynamics and hepatocellular carcinoma: A bibliometric analysis from 2007 to 2023. Heliyon 2024, 10, e24407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J.; Chang, Y.; Hu, M.; Gu, Q.; Dai, J.; Nan, J.; Wang, Z.; Chen, J.; Zhong, D.; Zhou, E.; et al. Global trends in research of mitophagy in liver diseases over past two decades: A bibliometric analysis. Heliyon 2023, 9, e18843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, S.; Dong, Y.; Chen, S.; Liu, Y.; Li, Z.; Jia, X.; Briens, M.; Jiang, X.; Lin, Y.; Che, L.; et al. 2-Hydroxy-4-Methylselenobutanoic Acid Promotes Follicle Development by Antioxidant Pathway. Front. Nutr. 2022, 9, 900789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mickiewicz, B.; Villemaire, M.L.; Sandercock, L.E.; Jirik, F.R.; Vogel, H.J. Metabolic changes associated with selenium deficiency in mice. Biometals 2014, 27, 1137–1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Liu, J.X.; Xiong, J.L.; Wang, Y.M.; Zhang, W.X.; Wang, D.M. Effect of hydroxyselenomethionine on lactation performance, blood profiles, and transfer efficiency in early-lactating dairy cows. J. Dairy Sci. 2019, 102, 6167–6173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Zhang, F.; Guan, W.; Song, H.; Tian, M.; Cheng, L.; Shi, K.; Song, J.; Chen, F.; Zhang, S.; et al. Increasing selenium supply for heat-stressed or actively cooled sows improves piglet preweaning survival, colostrum and milk composition, as well as maternal selenium, antioxidant status and immunoglobulin transfer. J. Trace Elem. Med. Biol. 2019, 52, 89–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Liu, X.R.; Liu, J.Z.; An, X.P.; Zhou, Z.Q.; Cao, B.Y.; Song, Y.X. Supplemented Organic and Inorganic Selenium Affects Milk Performance and Selenium Concentration in Milk and Tissues in the Guanzhong Dairy Goat. Biol. Trace Elem. Res. 2018, 183, 254–260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosnedlova, B.; Kepinska, M.; Skalickova, S.; Fernandez, C.; Ruttkay-Nedecky, B.; Malevu, T.D.; Sochor, J.; Baron, M.; Melcova, M.; Zidkova, J.; et al. A Summary of New Findings on the Biological Effects of Selenium in Selected Animal Species-A Critical Review. Int. J. Mol. Sci. 2017, 18, 2209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamada, H. Effects of selenium-rich yeast supplementation on the plasma progesterone levels of postpartum dairy cows. Asian-Australas. J. Anim. Sci. 2017, 30, 347–354. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Zhao, Y.F.; Yang, J.; Jing, H.Y.; Liang, W.; Chen, M.Y.; Yang, M.; Wang, Y.; Guo, M.Y. Selenium alleviates lipopolysaccharide-induced endometritis via regulating the recruitment of TLR4 into lipid rafts in mice. Food Funct. 2020, 11, 200–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Wang, H.; Cui, L.; Liu, K.; Guo, L.; Li, J.; Dong, J. The effect of selenium on the proliferation of bovine endometrial epithelial cells in a lipopolysaccharide-induced damage model. BMC Vet. Res. 2024, 20, 109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Li, Q.; Ma, Z.; Xu, H.; Peng, F.; Chen, B.; Ma, B.; Qin, L.; Lan, J.; Li, Y.; et al. β-Nicotinamide Mononucleotide Alleviates Hydrogen Peroxide-Induced Cell Cycle Arrest and Death in Ovarian Granulosa Cells. Int. J. Mol. Sci. 2023, 24, 15666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazloomi, S.; Sanoeei Farimani, M.; Tayebinia, H.; Karimi, J.; Amiri, I.; Abbasi, E.; Khodadadi, I. The Association of Mitochondrial Translocator Protein and Voltage-Dependent Anion Channel-1 in Granulosa Cells with Estradiol Levels and Presence of Immature Follicles in Polycystic Ovary Syndrome. J. Reprod. Infertil. 2022, 23, 148–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, K.; Xie, C.; Li, Z.; Zeng, H.; Zhao, Y.; Shi, Z. Selenium Intake and its Interaction with Iron Intake Are Associated with Cognitive Functions in Chinese Adults: A Longitudinal Study. Nutrients 2022, 14, 3005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Surai, P.F.; Kochish, I.I. Food for thought: Nano-selenium in poultry nutrition and health. Anim. Health Res. Rev. 2020, 21, 103–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minich, W.B. Selenium Metabolism and Biosynthesis of Selenoproteins in the Human Body. Biochemistry 2022, 87, S168–S177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.; Dong, L.; Lin, Z.; Sui, X.; Wang, Y.; Li, L.; Liu, T.; Liu, J. Effects of selenium supplementation on Polycystic Ovarian Syndrome: A systematic review and meta-analysis on randomized clinical trials. BMC Endocr. Disord. 2023, 23, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.S.; Hwang, G.; Nam, Y.W.; Hwang, C.H.; Song, J. IKK-mediated TRAF6 and RIPK1 interaction stifles cell death complex assembly leading to the suppression of TNF-α-induced cell death. Cell Death Differ. 2023, 30, 1575–1584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mehta, N.N.; deGoma, E.; Shapiro, M.D. IL-6 and Cardiovascular Risk: A Narrative Review. Curr. Atheroscler. Rep. 2024, 27, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, F.; Liu, Y.; Li, T.; Ma, Q.; Yongmei, Z.; He, P.; Xiong, C. MicroRNA-146 attenuates lipopolysaccharide induced ovarian dysfunction by inhibiting the TLR4/NF- κB signaling pathway. Bioengineered 2022, 13, 11611–11623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mehdi, Y.; Dufrasne, I. Selenium in Cattle: A Review. Molecules 2016, 21, 545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J.; Liu, Q.; Zhang, X.; Dun, S.; Liu, L. Mitochondrial hijacking: A potential mechanism for SARS-CoV-2 to impair female fertility. Med. Hypotheses 2022, 160, 110778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, X.; Yang, D.; Hu, Y.; Yuan, Y.; Song, L. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy. Open Life Sci. 2023, 18, 20220648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yildirim, R.M.; Seli, E. The role of mitochondrial dynamics in oocyte and early embryo development. Semin. Cell Dev. Biol. 2024, 159–160, 52–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, D.; Liu, Y.; Wu, P.; Wei, D. Current Advances of Mitochondrial Dysfunction and Cardiovascular Disease and Promising Therapeutic Strategies. Am. J. Pathol. 2023, 193, 1485–1500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimura, T.; Shiga, R.; Sasatani, M.; Kamiya, K.; Ushiyama, A. Melatonin and MitoEbselen-2 Are Radioprotective Agents to Mitochondria. Genes 2022, 14, 45. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Lázaro, D.; Fernandez-Lazaro, C.I.; Mielgo-Ayuso, J.; Navascués, L.J.; Córdova Martínez, A.; Seco-Calvo, J. The Role of Selenium Mineral Trace Element in Exercise: Antioxidant Defense System, Muscle Performance, Hormone Response, and Athletic Performance. A Systematic Review. Nutrients 2020, 12, 1790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, T.; Liu, T.; Chen, H.; Liu, Q.; Shen, X.; Hu, Q. Demethylzeylasteral alleviates inflammation and colitis via dual suppression of NF-κB and STAT3/5 by targeting IKKα/β and JAK2. Int. Immunopharmacol. 2024, 142, 113260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, J.; Chen, L.; Zhang, L.; Zhang, Z.; Zhao, Y.; Wang, Y.; Ou, J. New Insights Into the Persistent Effects of Acute Exposure to AFB1 on Rat Liver. Front. Microbiol. 2022, 13, 911757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heller, A.; Ulstrup, J. Detlev Müller’s Discovery of Glucose Oxidase in 1925. Anal. Chem. 2021, 93, 7148–7149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, X.; Fu, H.; Xie, N.; Guo, H.; Fu, T.; Shan, Y. Inhibition of JAK2/STAT3 signaling pathway by panaxadiol limits the progression of pancreatic cancer. Aging 2021, 13, 22830–22842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García de la Cadena, S.; Massieu, L. Caspases and their role in inflammation and ischemic neuronal death. Focus on caspase-12. Apoptosis 2016, 21, 763–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.C.; Hsu, S.P.; Hu, M.C.; Lan, Y.T.; Yeh, E.T.H.; Yang, F.M. PEP-sNASP Peptide Alleviates LPS-Induced Acute Lung Injury Through the TLR4/TRAF6 Axis. Front. Med. 2022, 9, 832713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basini, G.; Tamanini, C. Selenium stimulates estradiol production in bovine granulosa cells: Possible involvement of nitric oxide. Domest. Anim. Endocrinol. 2000, 18, 1–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, X.; Ei-Samahy, M.A.; Fan, L.; Zheng, L.; Jin, Y.; Pang, J.; Zhang, G.; Liu, Z.; Wang, F. In vitro influence of selenium on the proliferation of and steroidogenesis in goat luteinized granulosa cells. Theriogenology 2018, 114, 70–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orisaka, M.; Miyazaki, Y.; Shirafuji, A.; Tamamura, C.; Tsuyoshi, H.; Tsang, B.K.; Yoshida, Y. The role of pituitary gonadotropins and intraovarian regulators in follicle development: A mini-review. Reprod. Med. Biol. 2021, 20, 169–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vazakidou, P.; Evangelista, S.; Li, T.; Lecante, L.L.; Rosenberg, K.; Koekkoek, J.; Salumets, A.; Velthut-Meikas, A.; Damdimopoulou, P.; Mazaud-Guittot, S.; et al. The profile of steroid hormones in human fetal and adult ovaries. Reprod. Biol. Endocrinol. 2024, 22, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jefferi, N.E.S.; Shamhari, A.; Hamid, Z.A.; Budin, S.B.; Zulkifly, A.M.Z.; Roslan, F.N.; Taib, I.S. Knowledge Gap in Understanding the Steroidogenic Acute Regulatory Protein Regulation in Steroidogenesis Following Exposure to Bisphenol A and Its Analogues. Biomedicines 2022, 10, 1281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ojo, O.O.; Bhadauria, S.; Rath, S.K. Dose-dependent adverse effects of salinomycin on male reproductive organs and fertility in mice. PLoS ONE 2013, 8, e69086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonnet, A.; Cabau, C.; Bouchez, O.; Sarry, J.; Marsaud, N.; Foissac, S.; Woloszyn, F.; Mulsant, P.; Mandon-Pepin, B. An overview of gene expression dynamics during early ovarian folliculogenesis: Specificity of follicular compartments and bi-directional dialog. BMC Genom. 2013, 14, 904. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Li, Y.; Molenaar, A.; Li, Q.; Cao, Y.; Shen, Y.; Chen, P.; Yan, J.; Gao, Y.; Li, J. Vitamin E and selenium supplementation synergistically alleviate the injury induced by hydrogen peroxide in bovine granulosa cells. Theriogenology 2021, 170, 91–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]











| Gene | PRIMER SEQUENCE | LENGTH | ACCESSION |
|---|---|---|---|
| BAX | F: GACATTGGACTTCCTTCGAGA R: AGCACTCCAGCCACAAAGAT | 126 | XM_027978592.3 |
| BCL-2 | F: GTGGATGACCGAGTACCTGAAC R: AGACAGCCAGGAGAAATCAAAC | 124 | XM_012103831.5 |
| CASPASE3 | F: CCCACTGCAGCAACATTAATCC R: CGACAGGCCATGCCAGTATT | 252 | XM_060406952.1 |
| CYP11A1 | F: AGGCAGAGGGAGACATAAGCA R: GTGTCTTGGCAGGAATCAGGT | 156 | XM_060401375.1 |
| NR5A1 | F: AGGAGGTGCGGGGCTC R: GCTTGAAGAAGCCCTTGCAG | 190 | XM_042245715.2 |
| STAR | F: CAGAAGGGTGTCATCAGAGCG R: CAAAATCCACCTGGGTCTGC | 169 | XM_060406892.1 |
| TNF-α | F: TTGTTCCTCACCCACACCAT R: GGCAGAGAGGATGTTGACCT | 69 | NM_001024860.1 |
| IL-6 | F: ATCTGGGTTCAATCAGGCGAT R: GCTCTGCAACTCCATGACAG | 127 | NM_001009392.1 |
| IL-1β | F: CATGTGTGCTGAAGGCTCTC R: CAGGGTCGGTGTATCACCTT | 173 | NM_001009465.2 |
| P62 | F: GCCTTTCATCCAGAAGCTGT R: TCATCACCTGGCTCCTCTTC | 91 | NM_001009784.3 |
| PARKIN | F: AAGACCTCTACGCCAACACG R: GCCAGGGCAGTGATCTCTTT | 190 | XM_027956386.2 |
| MFN1 | F: CCAGCAACGCCAGATAATGC R: TCCAACAACGATGATGCCCA | 183 | XM 015104932.3 |
| OPA1 | F: CCTGACATCGTGTGGGAGAT R: TCCAGGTGAACCTGTGGTG | 79 | XM_004014953.4 |
| DRP1 | F: GTGGGAACGCAGAGCAGT R: TGCTTCAACTCCATTTTCTTCTCC | 174 | XM 042253359.1 |
| β-ACTIN | F: GGATGAGGCTCAGAGCAAGAGA R: TCGTCCCAGTTGGTGACGAT | 78 | U39357.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Guo, Z.; Li, J.; Fan, X.; Liu, Y.; Li, L.; Lyu, L.; Yang, C.; Ren, Y. Selenium Attenuates LPS-Induced Injury in Ovine Granulosa Cells by Protecting Mitochondrial Ultrastructure and Cellular Homeostasis. Animals 2026, 16, 2095. https://doi.org/10.3390/ani16132095
Guo Z, Li J, Fan X, Liu Y, Li L, Lyu L, Yang C, Ren Y. Selenium Attenuates LPS-Induced Injury in Ovine Granulosa Cells by Protecting Mitochondrial Ultrastructure and Cellular Homeostasis. Animals. 2026; 16(13):2095. https://doi.org/10.3390/ani16132095
Chicago/Turabian StyleGuo, Zeyuan, Jun Li, Xinyu Fan, Yufei Liu, Linzhen Li, Lihua Lyu, Chunhe Yang, and Youshen Ren. 2026. "Selenium Attenuates LPS-Induced Injury in Ovine Granulosa Cells by Protecting Mitochondrial Ultrastructure and Cellular Homeostasis" Animals 16, no. 13: 2095. https://doi.org/10.3390/ani16132095
APA StyleGuo, Z., Li, J., Fan, X., Liu, Y., Li, L., Lyu, L., Yang, C., & Ren, Y. (2026). Selenium Attenuates LPS-Induced Injury in Ovine Granulosa Cells by Protecting Mitochondrial Ultrastructure and Cellular Homeostasis. Animals, 16(13), 2095. https://doi.org/10.3390/ani16132095

