Sanguinarine Alleviates the Adverse Effects of Excessive Dietary Histamine on Growth and Intestinal and Hepatic Health in Juvenile American Eels (Anguilla rostrata)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Diet Formulation
2.2. Feeding and Sampling
2.3. Analytical Methods
2.3.1. Determination Growth Performance and Feed Utilization
2.3.2. Serum Biochemical Parameters
2.3.3. Histological and Ultrastructural Observation
2.3.4. Determination the Antioxidant Capacity
2.3.5. Assessment of Intestinal Digestive Enzymes
2.3.6. Real-Time Quantitative PCR (RT-PCR)
2.3.7. Analysis of Gut Microbiota
2.3.8. Metabolomics Analysis
2.4. Statistical Analysis
3. Results
3.1. Growth Performance and Feed Utilization
3.2. Serum Lipid Indices


3.3. Liver Histology
3.4. Hepatic Antioxidant Capacity
3.5. Histological Assessment of Intestine
3.6. Intestinal Antioxidant Capacity
3.7. Intestinal Digestive Enzyme Activities
3.8. Relative mRNA Level of Genes Associated with Intestinal Inflammation
3.9. Gut Microbiota Profiling
3.10. Metabolomics Analysis of the Intestine
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CAT | catalase |
| Con | control diet |
| DAO | diamine oxidase |
| D-lac | D-lactate |
| FBW | final body weight |
| FE | feed efficiency |
| FI | feed intake |
| gapdh | glyceraldehyde-3-phosphate dehydrogenase |
| GOT | glutamic-oxalacetic transaminase |
| GPT | glutamic-pyruvic transaminase |
| GSH-Px | glutathione peroxidase |
| HDL-C | high-density lipoprotein cholesterol |
| HH | high-histamine diet |
| H&E | hematoxylin and eosin |
| IBW | initial body weight |
| ifn-γ | interferon gamma |
| il-10 | interleukin 10 |
| LDL-C | low-density lipoprotein cholesterol |
| MDA | malondialdehyde |
| MT | muscular thickness |
| nf-κb | nuclear factor kappa-b |
| RT-PCR | real-time quantitative PCR |
| SAN | sanguinarine |
| SEM | scanning electron microscope |
| SOD | superoxide dismutase |
| SGR | specific growth rate |
| SR | survival rate |
| S.D. | standard deviation |
| TC | total cholesterol |
| TG | triglyceride |
| tgf-β | transforming growth factor beta |
| tnf-α | tumor necrosis factor alpha |
| T-AOC | total antioxidant capacity |
| VH | villus height |
| WGR | weight gain rate |
References
- Ding, F.F.; Zhou, N.N.; Mao, Y.J.; Yang, J.; Limbu, S.M.; Galindo-Villegas, J.; Du, Z.Y.; Zhang, M.L. Lactiplantibacillus plantarum Attenuate gossypol-induced hepatic lipotoxicity by altering intestinal microbiota for enriching microbial tryptophan metabolites in nile tilapia (Oreochromis niloticus). Microbiome 2025, 13, 180. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.C.; Pantopoulos, K.; Zheng, H.; Zito, E.; Zhao, T.; Tan, X.Y.; Wei, X.L.; Song, Y.F.; Luo, Z. Phosphorus Overload promotes hepatic lipolysis by suppressing GSK3β-dependent phosphorylation of PPARα at Ser84 and Thr265 in a freshwater teleost. Environ. Sci. Technol. 2023, 57, 2351–2361. [Google Scholar] [CrossRef] [PubMed]
- Zhai, S.; Wang, Y.; He, Y.; Chen, X. Oligomeric Proanthocyanidins counteracts the negative effects of high level of dietary histamine on American eel (Anguilla rostrata). Front. Mar. Sci. 2020, 7, 549145. [Google Scholar] [CrossRef]
- Mih, H.; Lacherai, A. Evaluation of histamine contents during the fish meal production process. Croat. J. Fish. 2020, 78, 203–209. [Google Scholar] [CrossRef]
- Schnedl, W.J.; Enko, D. Considering histamine in functional gastrointestinal disorders. Crit. Rev. Food Sci. Nutr. 2021, 61, 2960–2967. [Google Scholar] [CrossRef]
- Li, W.; Liu, B.; Liu, Z.; Yin, Y.; Xu, G.; Han, M.; Xie, L. Effect of dietary histamine on intestinal morphology, inflammatory status, and gut microbiota in yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 2021, 117, 95–103. [Google Scholar] [CrossRef]
- Liu, Y.; Fu, X.; Huang, H.; Fan, J.; Zhou, H.; Deng, J.; Tan, B. High dietary histamine induces digestive tract oxidative damage in juvenile striped catfish (Pangasianodon hypophthalmus). Antioxidants 2022, 11, 2276. [Google Scholar] [CrossRef]
- Liu, Z.Y.; Yang, H.L.; Hu, L.H.; Yang, W.; Ai, C.X.; Sun, Y.Z. Dose-dependent effects of histamine on growth, immunity and intestinal health in juvenile grouper (Epinephelus coioides). Front. Mar. Sci. 2021, 8, 685720. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, H.; Liu, Y.; Zhu, L.; Fan, J.; Huang, H.; Jiang, W.; Deng, J.; Tan, B. Dietary histamine impairs the digestive physiology function and muscle quality of hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Antioxidants 2023, 12, 502. [Google Scholar] [CrossRef]
- Li, S.; Gong, Y.; Liu, S.; He, M.; Li, D.; Morais, S.; Huang, X.; Chen, N.; Li, S. Effects of triterpene-rich olive extract alone or in combination with green tea extract and Eucommia ulmoides extract on growth performance and health status of mandarin fish (Siniperca chuatsi). Aquaculture 2026, 612, 743233. [Google Scholar] [CrossRef]
- Salomón, R.; Firmino, J.P.; Reyes-López, F.E.; Andree, K.B.; González-Silvera, D.; Esteban, M.A.; Tort, L.; Quintela, J.C.; Pinilla-Rosas, J.M.; Vallejos–Vidal, E.; et al. The Growth promoting and immunomodulatory effects of a medicinal plant leaf extract obtained from Salvia officinalis and Lippia citriodora in gilthead seabream (Sparus aurata). Aquaculture 2020, 524, 735291. [Google Scholar] [CrossRef]
- Huang, L.J.; Lan, J.X.; Wang, J.H.; Huang, H.; Lu, K.; Zhou, Z.N.; Xin, S.Y.; Zhang, Z.Y.; Wang, J.Y.; Dai, P.; et al. Bioactivity and mechanism of action of sanguinarine and its derivatives in the past 10 years. Biomed. Pharmacother. 2024, 173, 116406. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Zhong, L.; Chen, K.; Fan, Y.; Xie, K.; Zhang, J.; Dai, J.; Hu, Y. Sanguinarine attenuates hydrogen peroxide–induced toxicity in liver of Monopterus albus: Role of oxidative stress, inflammation and apoptosis. Fish Shellfish Immunol. 2022, 125, 190–199. [Google Scholar] [CrossRef]
- Liu, Y.L.; Zhong, L.; Chen, T.; Shi, Y.; Hu, Y.; Zeng, J.G.; Liu, H.Y.; Xu, S.D. Dietary sanguinarine supplementation on the growth performance, immunity and intestinal health of grass carp (Ctenopharyngodon idellus) fed cottonseed and rapeseed meal diets. Aquaculture 2020, 528, 735521. [Google Scholar] [CrossRef]
- Shi, Y.; Liu, Y.; Xie, K.; Zhang, J.; Wang, Y.; Hu, Y.; Zhong, L. Sanguinarine improves intestinal health in grass carp fed high-fat diets: Involvement of antioxidant, physical and immune barrier, and intestinal microbiota. Antioxidants 2023, 12, 1366. [Google Scholar] [CrossRef]
- Zhang, L.; Ma, L.; Yang, Q.; Liu, Y.; Ai, X.; Dong, J. Sanguinarine protects channel catfish against Aeromonas hydrophila infection by inhibiting aerolysin and biofilm formation. Pathogens 2022, 11, 323. [Google Scholar] [CrossRef] [PubMed]
- Lu, W.; Yu, H.; Liang, Y.; Zhai, S. Effects of white fish meal replaced by low-quality brown fish meal with compound additives on growth performance and intestinal health of juvenile American eel (Anguilla rostrata). Animals 2023, 13, 2873. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Xu, Q.; Hu, X.; Yang, J.; Zhai, S. Excessive dietary histamine inhibits growth performance and impairs intestinal and hepatic health in juvenile American eel (Anguilla rostrata). Front. Physiol. 2026, 17, 1797772. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Chen, G.; Hu, X.; Peng, Z.; Yang, J.; Zhai, S. Effects of dietary iron supplementation on growth performance, iron utilization, and intestinal health in juvenile American eels (Anguilla rostrata). Aquac. Rep. 2026, 46, 103296. [Google Scholar] [CrossRef]
- Xu, Y.; Wang, S.; Hu, X.; Wang, P.; Han, X.; Yang, J.; Liang, Y.; Zhai, S. Appropriate dietary phosphorus levels promote growth performance, mineral retention, and hepatic lipid metabolism in juvenile American eels (Anguilla rostrata). Aquac. Rep. 2025, 41, 102656. [Google Scholar] [CrossRef]
- Liu, Z.Y.; Yang, H.L.; Hu, L.H.; Yang, W.; Ai, C.X.; Sun, Y.Z. Autochthonous Probiotics alleviate the adverse effects of dietary histamine in juvenile grouper (Epinephelus coioides). Front. Microbiol. 2021, 12, 792718. [Google Scholar] [CrossRef] [PubMed]
- Yan, Q.; Li, X.; Zhou, X.; Chen, W.; Tian, X.; Wittayakun, S.; Paengkoum, P.; Tan, Z. Macleaya cordata extract exhibits some potential as a surrogate antibiotic by improving gastrointestinal epithelial status and humoral response in goats. Anim. Nutr. 2024, 18, 356–366. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Lv, W.H.; Hogstrand, C.; Zhang, D.G.; Xu, Y.C.; Xu, Y.H.; Luo, Z. Sirt3–Sod2–mROS–mediated manganese triggered hepatic mitochondrial dysfunction and lipotoxicity in a freshwater teleost. Environ. Sci. Technol. 2022, 56, 8020–8033. [Google Scholar] [CrossRef]
- Taru, V.; Szabo, G.; Mehal, W.; Reiberger, T. Inflammasomes in chronic liver disease: Hepatic injury, fibrosis progression and systemic inflammation. J. Hepatol. 2024, 81, 895–910. [Google Scholar] [CrossRef]
- Filali-Mouncef, Y.; Hunter, C.; Roccio, F.; Zagkou, S.; Dupont, N.; Primard, C.; Proikas-Cezanne, T.; Reggiori, F. The Ménage à Trois of autophagy, lipid droplets and liver disease. Autophagy 2022, 18, 50–72. [Google Scholar] [CrossRef]
- McGill, M.R. The past and present of serum aminotransferases and the future of liver injury biomarkers. EXCLI J. 2016, 15, 817–828. [Google Scholar]
- Liu, X.W.; Tang, C.L.; Zheng, H.; Wu, J.X.; Wu, F.; Mo, Y.Y.; Liu, X.; Zhu, H.J.; Yin, C.L.; Cheng, B.; et al. Investigation of the hepatoprotective effect of Corydalis saxicola bunting on carbon tetrachloride–induced liver fibrosis in rats by 1H-NMR-based metabonomics and network pharmacology approaches. J. Pharm. Biomed. Anal. 2018, 159, 252–261. [Google Scholar] [CrossRef]
- Wang, M.; Huang, X.; Liu, Y.; Zeng, J. Effects of Macleaya cordata extract on blood biochemical indices and intestinal flora in heat-stressed mice. Animals 2022, 12, 2589. [Google Scholar] [CrossRef] [PubMed]
- Dias, K.A.; Oliveira, L.A.; Pereira, S.M.S.; Abrantes, L.C.S.; Vicente, L.C.O.d.S.; Gonçalves, R.V.; Della Lucia, C.M. Anti–inflammatory and antioxidant effects of anthocyanins in nonalcoholic fatty liver disease (NAFLD): A systematic review of in vivo studies. Crit. Rev. Food Sci. Nutr. 2025, 65, 7479–7496. [Google Scholar] [CrossRef]
- Gulcin, İ. Antioxidants: A comprehensive review. Arch. Toxicol. 2025, 99, 1893–1997. [Google Scholar] [CrossRef]
- Hissen, K.L.; He, W.; Wu, G.; Criscitiello, M.F. Immunonutrition: Facilitating mucosal immune response in teleost intestine with amino acids through oxidant-antioxidant balance. Front. Immunol. 2023, 14, 1241615. [Google Scholar] [CrossRef]
- Osadnik, T.; Goławski, M.; Lewandowski, P.; Morze, J.; Osadnik, K.; Pawlas, N.; Lejawa, M.; Jakubiak, G.K.; Mazur, A.; Schwingschackl, L.; et al. A network meta-analysis on the comparative effect of nutraceuticals on lipid profile in adults. Pharmacol. Res. 2022, 183, 106402. [Google Scholar] [CrossRef] [PubMed]
- Cai, G.H.; Hu, Z.Y.; Guo, Y.T.; Guo, Z.X.; Sun, Y.Z.; Zhai, S.W. Dietary chlorogenic acid supplementation to alleviate intestinal damage in juvenile American eel (Anguilla rostrata) under histamine stress. Aquac. Rep. 2025, 43, 102946. [Google Scholar] [CrossRef]
- Musazadeh, V.; Assadian, K.; Rajabi, F.; Faghfouri, A.H.; Soleymani, Y.; Kavyani, Z.; Najafiyan, B. The effect of synbiotics on liver enzymes, obesity indices, blood pressure, lipid profile, and inflammation in patients with non-alcoholic fatty liver: A systematic review and meta-analysis of randomized controlled trials. Pharmacol. Res. 2024, 208, 107398. [Google Scholar] [CrossRef]
- Chen, R.; Huang, L.; Zhai, S. Effects of Macleaya Cordata extract on growth performance, serum biochemical parameters, and intestinal health of juvenile American eel (Anguilla rostrata). Fishes 2022, 7, 229. [Google Scholar] [CrossRef]
- Rogalska, M.; Rogalski, P.; Andrzejuk, A.; Błachnio-Zabielska, A.; Zabielski, P.; Flisiak, R. Lipidome remodeling in primary biliary cholangitis. Lipids Health Dis. 2026, 25, 73. [Google Scholar] [CrossRef]
- Caruso, R.; Lo, B.C.; Núñez, G. Host-microbiota interactions in inflammatory bowel disease. Nat. Rev. Immunol. 2020, 20, 411–426. [Google Scholar] [CrossRef]
- Tratenšek, A.; Locatelli, I.; Grabnar, I.; Drobne, D.; Vovk, T. Oxidative stress-related biomarkers as promising indicators of inflammatory bowel disease activity: A systematic review and meta-analysis. Redox Biol. 2024, 77, 103380. [Google Scholar] [CrossRef] [PubMed]
- Neurath, M.F. Strategies for targeting cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2024, 24, 559–576. [Google Scholar] [CrossRef]
- Adak, A.; Khan, M.R. An insight into gut microbiota and its functionalities. Cell. Mol. Life Sci. 2019, 76, 473–493. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Chang, K.; Chen, J.; Zhao, X.; Gao, S. Dietary sodium butyrate supplementation attenuates intestinal inflammatory response and improves gut microbiota composition in largemouth bass (Micropterus salmoides) fed with a high soybean meal diet. Fish Physiol. Biochem. 2021, 47, 1805–1819. [Google Scholar] [CrossRef]
- Kelly, D.; Conway, S.; Aminov, R. Commensal gut bacteria: Mechanisms of immune modulation. Trends Immunol. 2005, 26, 326–333. [Google Scholar] [CrossRef] [PubMed]
- Rimoldi, S.; Di Rosa, A.R.; Oteri, M.; Chiofalo, B.; Hasan, I.; Saroglia, M.; Terova, G. The impact of diets containing hermetia illucens meal on the growth, intestinal health, and microbiota of gilthead seabream (Sparus aurata). Fish Physiol. Biochem. 2024, 50, 1003–1024. [Google Scholar] [CrossRef] [PubMed]
- Deng, D.; Mu, Z.; Lv, X.; Jiang, X.; Zhou, J.; Guo, H.; Zhang, W.; Wang, B.; Lu, Y.; Wu, J.; et al. Pathogenicity of Plesiomonas shigelloides and Citrobacter freundii isolated from the endangered Chinese sturgeon (Acipenser sinensis). Microb. Pathog. 2022, 173, 105818. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gu, S.; Lv, W.; Chen, J.; Xue, M.; Liu, S.; Mao, J.; Chen, G. Genomic and transcriptomic profiling of a highly virulent Plesiomonas shigelloides strain: Insights into pathogenicity and host immune response. Microorganisms 2025, 13, 2168. [Google Scholar] [CrossRef]
- Nie, W.; Xie, X.; Wang, Y.; Zhu, S. Unraveling the causation of flatulence on silver pomfret after starvation aquaculture involved in intestinal microbiota structure, enzyme, and histology. Aquaculture 2025, 596, 741822. [Google Scholar] [CrossRef]
- Xu, J.; Wang, F.; Hu, C.; Lai, J.; Xie, S.; Yu, K.; Jiang, F. Dietary high plant protein and high lipid impaired the intestine health of grouper by disrupting oxidative stress, immune response, and protein metabolism. Aquac. Rep. 2024, 39, 102389. [Google Scholar] [CrossRef]
- Melchionna, R.; Trono, P.; Tocci, A.; Nisticò, P. Actin cytoskeleton and regulation of TGFβ signaling: Exploring their links. Biomolecules 2021, 11, 336. [Google Scholar] [CrossRef]
- Tang, D.D.; Gerlach, B.D. The roles and regulation of the actin cytoskeleton, intermediate filaments and microtubules in smooth muscle cell migration. Respir. Res. 2017, 18, 54. [Google Scholar] [CrossRef]
- Nüse, B.; Holland, T.; Rauh, M.; Gerlach, R.G.; Mattner, J. Larginine metabolism as pivotal interface of mutual host–microbe interactions in the gut. Gut Microbes 2023, 15, 2222961. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.H.; Kim, H. The Roles of glutamine in the intestine and its implication in intestinal diseases. Int. J. Mol. Sci. 2017, 18, 1051. [Google Scholar] [CrossRef]
- Selmi, H.; Walker, A.; Balas, L.; Lucio, M.; Klotz, M.; Jeridi, A.; Burrichter, A.G.; Conti, D.; Chaffringeon, L.; Beinsteiner, B.; et al. Ornithine lipids from Akkermansia muciniphila are dynamically modulated in colitis and shape macrophage inflammatory responses. Gut Microbes 2025, 17, 2601376. [Google Scholar] [CrossRef]
- Lv, D.; Cao, X.; Zhong, L.; Dong, Y.; Xu, Z.; Rong, Y.; Xu, H.; Wang, Z.; Yang, H.; Yin, R.; et al. Targeting phenylpyruvate restrains excessive NLRP3 inflammasome activation and pathological inflammation in diabetic wound healing. Cell Rep. Med. 2023, 4, 101129. [Google Scholar] [CrossRef]
- Shende, V.V.; Bauman, K.D.; Moore, B.S. The shikimate pathway: Gateway to metabolic diversity. Nat. Prod. Rep. 2024, 41, 604–648. [Google Scholar] [CrossRef]
- Zheng, L.; Zhao, Y.; Dong, H.; Su, G.; Zhao, M. Structure-activity relationship of antioxidant dipeptides: Dominant role of Tyr, Trp, Cys and Met Residues. J. Funct. Foods 2016, 21, 485–496. [Google Scholar] [CrossRef]
- Bravo Iniguez, A.; Sun, Q.; Cui, Q.; Du, M.; Zhu, M.J. Cannabidiol enhances mitochondrial metabolism and antioxidant defenses in human intestinal epithelial Caco-2 cells. Nutrients 2024, 16, 3843. [Google Scholar] [CrossRef]
- Luheshi, N.M.; Giles, J.A.; Lopez-Castejon, G.; Brough, D. Sphingosine regulates the NLRP3-inflammasome and IL-1β release from macrophages. Eur. J. Immunol. 2012, 42, 716–725. [Google Scholar] [CrossRef]
- Harrison, P.J.; Dunn, T.M.; Campopiano, D.J. Sphingolipid biosynthesis in man and microbes. Nat. Prod. Rep. 2018, 35, 921–954. [Google Scholar] [CrossRef]
- He, L.; Ding, Y.; Zhou, X.; Li, T.; Yin, Y. Serine signaling governs metabolic homeostasis and health. Trends Endocrinol. Metab. TEM 2023, 34, 361–372. [Google Scholar] [CrossRef]
- Adeva-Andany, M.; Souto-Adeva, G.; Ameneiros-Rodríguez, E.; Fernández-Fernández, C.; Donapetry-García, C.; Domínguez-Montero, A. Insulin Resistance and Glycine Metabolism in Humans. Amino Acids 2018, 50, 11–27. [Google Scholar] [CrossRef]
- Miousse, I.R.; Ewing, L.E.; Skinner, C.M.; Pathak, R.; Garg, S.; Kutanzi, K.R.; Melnyk, S.; Hauer–Jensen, M.; Koturbash, I. Methionine dietary supplementation potentiates ionizing radiation–induced gastrointestinal syndrome. Am. J. Physiol. Gastrointest. Liver Physiol. 2020, 318, G439–G450. [Google Scholar] [CrossRef] [PubMed]
- Bauchart-Thevret, C.; Stoll, B.; Burrin, D.G. Intestinal Metabolism of Sulfur Amino Acids. Nutr. Res. Rev. 2009, 22, 175–187. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.N.; Zhao, Y.L.; Jiang, L.; Yan, J.K. Changes in the intestinal expression of drug metabolism–related genes in a piglet model of parenteral nutrition. Nutr. Metab. 2022, 19, 18. [Google Scholar] [CrossRef] [PubMed]









| Ingredients, % | |
|---|---|
| White fishmeal | 32.6 |
| Brown fishmeal | 35 |
| α-starch | 25 |
| Expanded soybeans | 2 |
| Yeast powder | 2 |
| Choline chloride | 0.5 |
| Betaine | 1 |
| Ca(H2PO4)2 | 0.5 |
| Mineral premix a | 1 |
| Vitamin premix b | 0.4 |
| Total | 100 |
| Proximate analysis %, dry weight | |
| Crude protein | 47.87 |
| Crude lipid | 5.17 |
| Crude ash | 12.98 |
| Moisture | 6.22 |
| Genes | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Accession No. |
|---|---|---|---|
| tnf-α | CCAGACCAGAGCCAAGAAGG | AGGTATGGCCCGTGTCTTTG | MT861110 |
| ifn-γ | AATGACAAATGACGTGAATAGG | TTCAGCATGTCCGACAGG | MT861111 |
| il-10 | CCAGAGACGACCTGTTGCTT | AACGCGTCATCTCCCCATTT | XM064306058 |
| tgf-β | CTGGTGTTCTGGGAAATCGC | ATGACCCTCAGCGCCTCAC | XM064301364 |
| nf-κb | GAGCAACGACACCACCAAGA | TGCTTACAGTCCTTGCCGAC | XM064335268 |
| gapdh | ATTGGTCGTCTTGTGACCCG | GTCCGTGGGTGGAGTCATAC | XM064310421 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Xu, Y.; Chen, R.; Hu, X.; Yan, Y.; Yang, J.; Zhai, S. Sanguinarine Alleviates the Adverse Effects of Excessive Dietary Histamine on Growth and Intestinal and Hepatic Health in Juvenile American Eels (Anguilla rostrata). Animals 2026, 16, 1556. https://doi.org/10.3390/ani16101556
Xu Y, Chen R, Hu X, Yan Y, Yang J, Zhai S. Sanguinarine Alleviates the Adverse Effects of Excessive Dietary Histamine on Growth and Intestinal and Hepatic Health in Juvenile American Eels (Anguilla rostrata). Animals. 2026; 16(10):1556. https://doi.org/10.3390/ani16101556
Chicago/Turabian StyleXu, Yichuang, Runan Chen, Xinyu Hu, Yuqin Yan, Jinyue Yang, and Shaowei Zhai. 2026. "Sanguinarine Alleviates the Adverse Effects of Excessive Dietary Histamine on Growth and Intestinal and Hepatic Health in Juvenile American Eels (Anguilla rostrata)" Animals 16, no. 10: 1556. https://doi.org/10.3390/ani16101556
APA StyleXu, Y., Chen, R., Hu, X., Yan, Y., Yang, J., & Zhai, S. (2026). Sanguinarine Alleviates the Adverse Effects of Excessive Dietary Histamine on Growth and Intestinal and Hepatic Health in Juvenile American Eels (Anguilla rostrata). Animals, 16(10), 1556. https://doi.org/10.3390/ani16101556

