Next Article in Journal
Malted Barley as a Potential Feed Supplementation for the Reduction of Enteric Methane Emissions, Rumen Digestibility, and Microbiome Community Changes in Laboratory Conditions
Previous Article in Journal
Animal Cruelty in New York City: Cruelty Cases Presented to the ASPCA in Partnership with the NYPD 2013–2022
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

miR-192-2 Regulates the Proliferation and Apoptosis of Ovarian Granulosa Cells by Targeting IGFBP2 in Zhedong White Geese

1
College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, China
2
Animal Husbandry Institute, Heilongjiang Academy of Agricultural Sciences, Harbin 150086, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(5), 663; https://doi.org/10.3390/ani15050663
Submission received: 19 January 2025 / Revised: 19 February 2025 / Accepted: 24 February 2025 / Published: 25 February 2025
(This article belongs to the Section Animal Physiology)

Abstract

Simple Summary

The proliferation and apoptosis of ovarian granulosa cells (GC) is critical for egg-laying performance. In geese, follicular atrophy is accompanied by follicular GC apoptosis during brooding stages. MicroRNAs are involved in follicular development, atrophy, ovulation, and degeneration. Our previous high-throughput sequencing study of goose ovaries from laying and brooding geese revealed that miR-192-2 may be involved in follicle cell proliferation and apoptosis. The aim of this study was to explore the effects of miR-192-2 and its target gene IGFBP2 on the proliferation and apoptosis of follicular granulosa cells in Zhedong white geese. The results showed that after miR-192-2 overexpression, the expressions of PCNA, CDK2, CCND1, CCND2, and Bcl-2 were significantly decreased, and the expressions of Caspase3, Caspase8, and Caspase9 were significantly increased. While the expressions of PCNA, CDK2, CCND1, CCND2, and Bcl-2 were significantly decreased after the downregulation of IGFBP2 expression, the expressions of Caspase3, Caspase8, and Caspase9 were significantly increased. In conclusion, miR-192-2 inhibited proliferation and promoted apoptosis of follicular GC by targeting IGFBP2 in Zhedong White geese. Therefore, it is possible to explore inhibiting the expression of miR-192-2 in production to alter the brooding behavior of Zhedong White Geese, thereby improving egg production and economic returns for producers.

Abstract

The proliferation and apoptosis of ovarian granulosa cells (GC) is critical for follicular development and ovulation, especially for egg-laying performance in female birds. In geese, follicular atrophy is accompanied by follicular GC apoptosis during brooding stages. MicroRNAs are involved in follicular development, atrophy, ovulation, and degeneration. Our previous high-throughput sequencing study of ovaries from laying and brooding geese revealed that miR-192-2 may be involved in follicle growth and development, as well as follicle cell proliferation and apoptosis in geese. To further investigate the effect of miR-192-2 on GC in geese, we screened the target gene of miR-192-2 (IGFBP2) and constructed a miR-192-2 overexpression and interference vector, synthesized a small interfering RNA for IGFBP2. The results showed that after miR-192-2 overexpression, the mRNA and protein expression of proliferation-related genes (PCNA, CDK2, CCND1, and CCND2) were significantly decreased, the mRNA and protein expression of apoptosis-related genes (Caspase3, Caspase8, and Caspase9) were significantly increased, and the mRNA and protein expression of anti-apoptosis gene Bcl-2 were significantly decreased. While the mRNA and protein expressions of PCNA, CDK2, CCND1, and CCND2 were significantly decreased after the downregulation of IGFBP2 expression, the mRNA and protein expressions of Caspase3, Caspase8, and Caspase9 were significantly increased, and the mRNA and protein expression of Bcl-2 was significantly decreased. In conclusion, miR-192-2 inhibited proliferation and promoted apoptosis of follicular GC by targeting IGFBP2 in Zhedong White geese. Apoptosis of GC leads to follicular atresia, which in turn leads to brooding behavior in female geese. Therefore, it is possible to explore inhibiting the expression of miR-192-2 in production to alter the brooding behavior of Zhedong White Geese, thereby improving egg production and economic returns for producers.

1. Introduction

Follicular development is a key physiological process in the reproductive system of female animals [1]. During the reproductive cycle of poultry, there are a large number of primordial follicles in the ovary, but only a few follicles undergo selective development to eventually mature and ovulate, while the other unselected follicles gradually shrink and degenerate in a process known as follicular atrophy [2]. Granulosa cells (GC) are the essential cells that make up the follicle [3], and GC differentiation, proliferation, and apoptosis are closely linked to primordial follicle activation, follicular growth, and follicular expulsion and atrophy [4,5]. In developing follicles, the number of apoptotic GC accounts for 10% of the total number of GC before follicular atrophy [6]. The apoptosis of GC is regulated primarily by their autocrine paracrine secretion pattern, but also by combinations of several cytokines, hormones, and growth factors [7]. The apoptosis of GC is also the main cause of ovarian atrophy, which leads to brooding behavior in the female goose [8].
miRNAs are endogenous single-stranded non-coding RNAs of approximately 20–24 nt in length [9]. miRNAs contain structures complementary to target genes and enable the transcriptional or post-transcriptional regulation of target genes, thereby regulating gene expression and various biological processes [10]. miRNAs play extremely important roles in various stages of follicular development [11], such as the regulation of follicular growth, follicular atresia, dominant follicle formation, and ovulation, as well as the regulation of the proliferation and apoptosis of GC [12]. miR-192-2 is a member of the miR-192 family, which has been implicated in many studies as a potential prognostic and diagnostic biomarker and even as a therapeutic target for a variety of cancers [13]. According to a recent report, miR-192 (enriched in hepatic stellate cells) associated with hepatocellular carcinoma can inhibit hepatic stellate cell activation by directly targeting Rictor in the AKT/mTORC2 pathway [14]. There was also evidence that miR-192 can regulate the proliferation or apoptosis of porcine uterine epithelial cells by directly targeting and inhibiting the expression of CSK and YY1 genes [15]. Another study showed that the overexpression of miR-192 inhibited the proliferation of hepatocellular carcinoma cells and promoted apoptosis [16]. According to two other studies, miR-192 was identified as a prognostic marker for ovarian tumor samples [17]. Moreover, the damage of granulosa cells induced by oxidative stress can be reduced by the downregulation of miR-192 in pigs [18]. These studies suggested that miR-192 may play a role in ovarian development in animals, as well as influencing cell proliferation and apoptosis. However, the potential regulatory mechanisms of miR-192-2 in GC proliferation and apoptosis are unknown.
Insulin-like growth factor-binding protein 2 (IGFBP2) is a member of the family of insulin-like growth factor-binding proteins, which are highly conserved in many complex life processes [19,20,21]. Previous studies had shown that IGFBP2 was associated with ovarian cancer and overexpressed in malignant ovarian tissue as well as in the serum and cystic fluid of ovarian cancer patients, suggesting that IGFBP2 plays an important role in ovarian cancer biology [22]. In ovarian cancer cells, COL11A1 had been shown to regulate the TGF-β3 activation of cancer-associated fibroblasts through the NF-κB/IGFBP2 axis [23]. Although IGFBP2 is involved in many cellular processes, its role in the mechanism of ovarian GC requires further investigation. As mentioned earlier, miR-192 and IGFBP2 both have specific functions in animal ovaries, but is there a connection between them? If there is a connection, how is it regulated between them? These are the topics that this study aims to investigate.
In geese, the specific function of miR-192-2 in GC is unknown. Therefore, this study is to investigate the potential function of miR-192-2 in goose GC and its undiscovered regulatory mechanisms. It may provide new insights from a microRNA perspective on mitigating brooding behavior and improving egg production in geese.

2. Materials and Methods

2.1. Experimental Animals

The experimental animals were provided by Zhejiang Xiangshan Wenjie White Goose Co., Ltd. (Xiangshan, Zhejiang, China) The geese were 18-month-old female geese with similar body weight. They were treated with the same feeding conditions, free water feeding, natural light, and ventilation. Twenty female geese were selected from each of the laying and brooding periods. The present study was conducted under the approval of the Institutional Animal Care and Use Committee of Northeast Agricultural University (approval number: SRM-06, approval date: 1 January 2018) and in accordance with the laboratory animal guidelines for ethical review of animal welfare (GB/T 35 892-2018) [24].

2.2. GC Isolation and Culture

Passage cells were from female goose ovarian primary granulosa cells. After the experimental animals were killed by cervical dislocation, the surface envelope of the ovary, the surrounding connective tissue, and the adipose tissue mass were removed with forceps, and GC were collected according to Gilbert’s method [25]. GC were obtained by digestion with 0.1% collagenase (Sigma, Aldrich, St. Louis, MO, USA). GC were incubated in Dulbecco’s modified Eagle’s medium/F12 (DMEM/F12, Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA) and 1% streptomycin and penicillin mixture (Gibco, Carlsbad, CA, USA) at 37 °C and 5 °C, respectively. The total number of cells cultured in the medium dish was 3 × 105. GC were cultured in 12-well plates until they were 70–80% confluent (3 × 104 cells/well) with 3 technical replicates per group.

2.3. Transient Transfection, RNA Isolation, and RT-qPCR

miR-192-2 mimic, miR-192-2 inhibitor, miRNA mimic negative control (mimic NC), and miRNA inhibitor negative control (inhibitor NC) were purchased from Qingdao Biotechnology Co. (Qingdao, China) Goose IGFBP2 siRNA and siRNA negative control were synthesized by GenePharma (GenePharma, Shanghai, China). Wild type (WT) and mutant (MT) IGFBP2 3′UTR with miR-192-2 binding sites were synthesized and inserted into the 3′ region of the firefly luciferase gene, a pmirGLO dual luciferase reporter vector containing the Renilla luciferase gene cassette, for a dual luciferase reporter gene assay (Promega, Madison, WI, USA). These small oligonucleotides were transfected into cells at different concentrations using Lipofectamine 2000 reagent, and GC and 293T were inoculated into DMEM/F12 (DMEM/F12, Hyclone, Logan, UT, USA) medium in 12-well and 96-well plates, respectively, with 10% bovine serum (Gibco, Carlsbad, CA, USA) and 1% antibiotics (Gibco, Carlsbad, CA, USA), and 1% antibiotics (1% penicillin and 1% streptomycin mixture, Gibco, Carlsbad, CA, USA). When the cells reached 70–80% concentration, different concentrations of miRNA were transfected into the cells. We performed a gradient screening of miR-192-2 mimics and miR-192-2 inhibitors at concentrations ranging from (20 nM, 30 nM, 50 nM, 100 nM, and 200 nM), respectively. We tested and screened the most suitable concentrations for transfection experiments. The optimal expressions of miR-192-2 mimic and miR-192-2 inhibitor were reached at 50 nM and 100 nM, respectively. All experiments were replicated three times. After transfected cells were cultured, total RNA was isolated using TRIzol reagent (Takara, Shiga, Japan), and reverse transcription was performed using TransScriptVR One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China). The RT-qPCR reaction system was 10 μL, including 1 μL cDNA, 0.5 μL forward and reverse primers, 5 μL TB Green TM Premix (Takara, Shiga, Japan), and 3 μL DNase/rase-free deionized water (Tiangen, Beijing, China). The β-actin and U6 genes were selected as internal reference genes. Primer information is shown in Table 1 and Table 2. The relative expression of the RT-qPCR data was analyzed using the 2−∆∆Ct method.

2.4. Western Blot Analysis

Proteins were extracted from goose ovarian GC 48 h after transfection. The protein concentration was determined using a BCA protein concentration assay kit (SW101, Seven Countries, China), and after the concentration was standardized, 5 × SDS supersampling buffer (Beyotime, Shanghai, China) was added, boiled, and stored at −20 °C. Water bath for 5 min. Proteins were separated by 10% sodium dodecyl sulfate PAGE gel electrophoresis and transferred to a PVDF membrane (Beyotime, Shanghai, China). Skimmed milk 5% (diluted with TBST) was added for 2 h and then incubated with primary antibody at 4 °C overnight. The strips were washed three times with TBST for 8 min each, and the anti-rabbit secondary antibody was incubated for 2 h. The strips were washed three times with TBST for 8 min each. The strips were detected using a molecular imaging system (SmartchemiTM Image Analysis System, Beijing Shengchuang Science and Technology Co., Ltd., Beijing, China). The strips were analyzed using Image J software (v1.8.0 NIH, Bethesda, MD, USA), and the peak plots were used to get the area value for each peak with three technical replicates per group.

2.5. Flow Cytometry

Cell suspensions were digested with 0.25% trypsin-EDTA and stained with an Annexin V/PI Apoptosis Detection Kit (Nantong Beiten Biotechnology, Nantong, Jiangsu, China) according to the instructions to detect apoptotic levels. Apoptotic cells were quantified using a BD Accuri C6 flow cytometer (Thermo Scientific, Waltham, MA, USA), and data were analyzed using FlowJo software (v10.8.1), and the sum of early and late apoptotic subpopulations was then calculated as the apoptosis rate.

2.6. Dual Luciferase Assay

The predicted target genes of goose miR-192-2 regulating the proliferation and apoptosis of GC were analyzed by miRDB (http://mirdb.org/, accessed on 1 October 2023) and TargetScan (https://www.targetscan.org/vert_80, accessed on 1 October 2023) and their crosstalk with DEGs. Human Embryonic Kidney 293T cells were maintained in DMEM/F12 medium (Hyclone, Logan, UT, USA) supplemented with 10% neonatal bovine serum (Gibco, Carlsbad, CA, USA), 100 μg/mL streptomycin, and 100 IU/mL penicillin. Cells were incubated at 37 °C saturated humidity, 5% CO2, and the medium was changed every 24 h. Then, 293T cells in 48-well plates were co-transfected with plasmids (wild-type or mutant pmiRGLO-3′UTR-IGFBP2) (2 µg) and miR-192-2 mimic or mimic-nc (2 µL), and luciferase activity was detected using a dual luciferase reporter assay system (Beyotime, Shanghai, China). Relative luciferase activity was determined by normalizing the luciferase activity of fireflies to that of kidney cells.

2.7. EdU Assay

A Cell-LightTM EdU Apollo VitroKit (RiboBio, Guangzhou, China) was used for the GC proliferation assay. The EdU incorporation rate was calculated as the ratio of the number of EdU incorporated cells to the number of Hoechst 33,342 stained cells according to the following formula. A minimum of 500 cells were counted in each group.
EdU   incorporation   rate = EdU   incorporated   cells Hoechst   33 , 342   stained   cells

2.8. CCK-8 Assay

Cell activity in GC was detected using a Cell Counting Kit-8 assay (CCK-8 kit, Houston, TX, USA). The collected primary GC of goose follicles were cultured in 96-well plates and 100 µL of cell suspension was added to each well. The absorbance of the cells at 450 nm was measured using an enzyme marker at the end of transfection and the data were recorded.

2.9. Statistical Analysis

All results were expressed as mean ± SEM. Western blot results were analyzed using Image J software. Experimental data were analyzed using SPSS 20.0 software, using ANOVA and Dunnett’s test or Tukey’s multiple comparisons, and plotted using GraphPad Prism 8 software.

3. Result

3.1. miR-192-2 Inhibits Proliferation of Ovarian Follicular Cells

To investigate the role of miR-192-2 in the proliferation of primary GC in goose follicles, we transfected the miR-192-2 mimic and miR-192-2 inhibitor into GC, respectively, and performed qRT-PCR assays to detect the relative expression of the mRNA of PCNA, CDK2, CCND1, and CCND2 in GC, CCK-8, and EdU assays to detect the proliferation status of GC, and a WB assay to detect the relative protein expression of the proliferation-related gene in GC. The expression of CDK2, PCNA, CCND1, and CCND2 mRNA markedly reduced in response to the overexpression of miR-192-2 (Figure 1A,B) (p < 0.01). The CCK-8 assay revealed a significant decrease in the OD value of cells at 12, 24, 36, and 48 h following the expression of miR-192-2 (Figure 1C) (p < 0.01). Furthermore, the EdU assay revealed a substantial decrease in the number of positive goose follicle GC following miR-192-2 overexpression (Figure 1D,E) (p < 0.01). Additionally, the expression of CDK2 and PCNA proteins markedly reduced after miR-192-2 overexpression (Figure 1F,G) (p < 0.01). It was determined that the proliferative state of GC was significantly enhanced after the inhibition of miR-192-2 expression. The expression of CDK2, PCNA, CCND1, and CCND2 mRNA markedly elevated in response to the inhibition of miR-192-2 expression (Figure 2A,B) (p < 0.01). The CCK-8 assay revealed a significant increase in the OD value of the cells after 24, 36, and 48 h of miR-192-2 expression inhibition (Figure 2C) (p < 0.05). The EdU assay demonstrated a substantial increase in the number of positive GC following miR-192-2 expression inhibition (Figure 2D,E) (p < 0.01). Furthermore, the expression of CDK2 and PCNA proteins markedly elevated following miR-192-2 inhibition (Figure 2F,G) (p < 0.01). In summary, these results demonstrated the inhibitory effect of miR-192-2 on the proliferation of GC in goose follicles.

3.2. miR-192-2 Promotes Apoptosis in Primary Granulosa Cells of Ovarian Follicles

In this study, we also investigated the effect of miR-192-2 on GC apoptosis after the transfection of the miR-192-2 inhibitor and miR-192-2 mimic in GC. Among them, we mainly used the qRT-PCR assay to detect the relative expression of mRNA of apoptosis-related genes in GC, a flow cytometry assay was used to detect the number of apoptotic GC, and a WB assay was used to detect the relative expression of the protein of apoptosis-related genes in GC.
The present study revealed that the mRNA expression and protein expression of Caspase3, Caspase8, and Caspase9 were significantly increased after the expression of miR-192-2 (p < 0.01). Concurrently, the mRNA expression and protein expression of the anti-apoptotic gene Bcl-2 were significantly decreased (Figure 3A–C) (p < 0.01). Furthermore, the results of the flow cytometry assay demonstrated that the number of apoptotic cells was significantly increased after the expression of miR-192-2 (Figure 3G,H) (p < 0.05). Conversely, the apoptotic tendency of GC was significantly attenuated after the inhibition of miR-192-2 expression. The mRNA and protein expression of Caspase3, Caspase8, and Caspase9 were markedly reduced upon the inhibition of miR-192-2 expression (p < 0.01). Conversely, the mRNA and protein expression of the anti-apoptotic gene Bcl-2 were both considerably increased (p < 0. 05) (Figure 3D–F) (p < 0.01); the results of the flow cytometry assay showed that the number of apoptotic cells was significantly reduced after the inhibition of miR-192-2 expression (Figure 3I,J) (p < 0.01). Taken together, these results demonstrated miR-192-2 can promote apoptosis in goose follicular GC.

3.3. miR192-2 Targets IGFBP2 Gene

Insulin-like growth factor-binding protein II (IGFBP2) is a member of the insulin-like growth factor-binding proteins family and plays a key role in cell growth, differentiation, apoptosis, and metabolic regulation. Our previous high-throughput sequencing study of ovaries from laying and brooding geese revealed that miR-192-2 was differentially expressed in the two types of ovaries and subsequently predicted the target genes of miR-192-2, and we had published one paper on the subject [26]. We then searched for all the target genes of miR-192-2 using Miranda and TargetScan. Combining the predictions of the two bioinformatics websites to compare and evaluate target genes with which they may have a close target relationship, there were 16 common target genes (ARFGEF1, BHLHE22, CCNT2, DYRK3, EREG, FRMD4B, IGFBP2, LPAR4, MSN, NIPAL1, PDP1, PKP4, RAB2A, RB1, WDR44, and ZEB2) in the results predicted by the two bioinformatics websites, including IGFBP2 (Figure 4C). Among all of the candidate genes, IGFBP2 was involved in animal ovarian function and had a highly conserved miR-192-2 binding site in its 3′-UTR. Therefore, we performed qRT-PCR assays for miR-192-2 and IGFBP2 in laying and brooding follicles and found that the expression of miR-192-2 in laying follicles was significantly lower than that in brooding follicles, whereas the expression pattern of IGFBP2 was the opposite to that of miR-192-2 (Figure 4A,B) (p < 0.01). In conclusion, IGFBP2 may be a target gene of goose miR-192-2. As indicated by the website-predicted miR-192-2 binding site with IGFBP2, the site will be designed using a mutation sequence. The results of the dual luciferase assay demonstrated that the binding of miR-192-2 with the wild type of IGFBP2 resulted in a decrease in dual luciferase activity. However, the luciferase activity of the two IGFBP2-3′UTR-MUT co-transfected groups showed no significant change, suggesting that this site is the binding site (Figure 4D). Taken together, the results of this study suggest a targeting relationship between miR-192-2 and IGFBP2. However, the expressions of IGFBP2 mRNA and protein in GC were also analyzed after transfection with miR-192-2 inhibitor and miR-192-2 mimic. The results demonstrated that both the mRNA and protein expressions of IGFBP2 were significantly elevated after the inhibition of miR-192-2 expression (p < 0.01), while both the mRNA and protein expressions of IGFBP2 were significantly reduced after the overexpression of miR-192-2 (Figure 4E–H) (p < 0.01). Taken together, these results suggest a target relationship between miR-192-2 and IGFBP2.

3.4. IGFBP2 Promotes the Proliferation of Primary GC in Ovarian Follicles

To investigate the role of IGFBP2 in GC proliferation, we performed a qRT-PCR assay to detect the relative mRNA expression of proliferation-related genes in GC and CCK-8, an EdU assay to detect the proliferation status of GC, and a WB assay to detect the relative protein expression of proliferation-related genes in GC after the downregulation of IGFBP2 expression in goose follicle primary GC. As demonstrated in Figure 5, the mRNA expression of CDK2, PCNA, CCND1, and CCND2 (Figure 5A,G) and the protein expression of CDK2 and PCNA were markedly reduced (Figure 5C,D) following the downregulation of IGFBP2 expression in GC (p < 0. 01); the CCK-8 assay results demonstrated that the OD value of GC after the downregulation of IGFBP2 expression was significantly reduced (Figure 5B) (p < 0.05); the EdU assay results showed that the number of positive GC was significantly reduced after the downregulation of IGFBP2 expression (Figure 5E,F) (p < 0.01). These findings collectively indicated that IGFBP2 exerted a promoting effect on the proliferation of goose follicular GC.

3.5. IGFBP2 Inhibits Apoptosis in Goose Follicular GC

To explore the role of IGFBP2 in GC apoptosis, we performed a qRT-PCR assay to detect the relative expression of mRNA of apoptosis-related genes in GC, a flow cytometry assay to detect the number of apoptotic GC, and a WB assay to detect the relative expression of proteins of apoptosis-related genes in GC after the downregulation of IGFBP2 expression in goose follicle GC. As demonstrated in Figure 6, the downregulation of IGFBP2 in GC resulted in a substantial increase in the mRNA and protein expression of Caspase3, Caspase8, and Caspase9 (p < 0.05). Conversely, the mRNA and protein expressions of the anti-apoptotic gene Bcl-2 were markedly reduced (Figure 5A,D,E) (p < 0.05). The results of the flow cytometry assay revealed a substantial increase in the number of apoptotic GC following the downregulation of IGFBP2 expression in GC (Figure 5B,C) (p < 0.05). These results collectively demonstrated the inhibitory effect of IGFBP2 on apoptosis in goose follicle GC.

4. Discussion

Growing evidence suggests that miRNAs are closely linked to the connection between the ovaries and GC [27]. GC are important somatic cells in the follicle [2], supporting follicular development by secreting hormones, but an imbalance in the internal homeostasis of the follicle leads to GC apoptosis, resulting in follicular atresia [28]. In avian species, follicular atresia is the main cause of reduced reproductive performance in laying birds. Therefore, the proliferation and apoptosis of GC are closely related to the laying performance of birds. It has been shown that the miR-192 family has emerged as a key miRNA in various cancers [13]. However, there is relatively little research on its expression in bird ovarian tissue. Our previous high-throughput sequencing study on the ovaries of laying and brooding geese revealed that miR-192-2 was differentially expressed in the two types of ovaries, suggesting that miR-192-2 may be involved in the growth and development of goose follicles, as well as in the proliferation and apoptosis of follicular cells.
The proliferation and differentiation of GC affect primordial follicle initiation and growth and regulate the development of growing follicles through a receptor-mediated pathway. CDK2, PCNA, CCND1, and CCND2 have been reported as marker genes for cell proliferation [29,30]. miRNAs are involved in the regulation of cell proliferation, and it was found that LINC00477 inhibited the proliferation of ovarian GC by targeting miR-128 [31]. miRNAs have been identified as critical regulators of cell proliferation. In a seminal study, Tu et al. demonstrated that the miR-10 family members function as suppressors of ovarian GC proliferation in human, mouse, and rat ovaries [32]. Our experimental results showed that overexpression of miR-192-2 inhibited goose follicle GC proliferation and promoted apoptosis. This was consistent with another study in which grape seed proanthocyanidin B2 was used to downregulate miR-192 to inhibit the Caspase3 apoptotic signaling pathway, thereby preventing damage to porcine follicular GC [18]. Similarly, our experimental results showed that overexpression of miR-192-2 led to a significant reduction in cell viability at all times, a significant reduction in the number of positive goose follicle GC, a significant reduction in the mRNA expression of cell proliferation-related genes (CDK2, PCNA, CCND1, and CCND2), and a significant reduction in the protein expression of CDK2 and PCNA. However, the proliferative state of GC was significantly improved after miR-192-2 inhibition, and the mRNA expression of CDK2, PCNA, CCND1, and CCND2 was significantly increased, and the protein expression of CDK2 and PCNA was significantly increased. The results were consistent with those of CCK-8 and EdU, suggesting that miR-192-2 inhibited the proliferation of primary GC in goose follicles.
It has been shown that miRNA is involved in a variety of biological processes, including cell growth, cell death, and cell migration. miR-6881-3p is involved in reducing ovarian reserve function by regulating granulosa cell apoptosis through targeting SMAD4 [33]. The downregulation of miR-221-3p may be involved in the pathogenesis of diminished ovarian reserve by promoting apoptosis of GC and upregulating FOXO1 expression [34]. The present study demonstrated that the expression of miR-192-2 led to a significant increase in the mRNA and protein expression of apoptosis-related genes, including Caspase3, Caspase8, and Caspase9. Conversely, the mRNA and protein expression of the anti-apoptotic gene Bcl-2 were significantly reduced. Furthermore, the results of the flow cytometry assay indicated that the number of apoptotic cells was significantly increased by the expression of miR-192-2. In summary, the results of the present study demonstrated that the expression of miR-192-2 significantly increased the number of apoptotic cells. The apoptotic tendency of GC was significantly attenuated when miR-192-2 expression was inhibited, suggesting that miR-192-2 promoted apoptosis in primary GC of goose follicles.
To explore the key target genes of miR-192-2 affecting the developmental process of GC, we used bioinformatics software to find and focus on IGFBP2. In this experiment, as shown by the qRT-PCR assay and the dual luciferase results, it was demonstrated that IGFBP2 was a direct target gene of miR-192-2. In addition, we also verified the regulation of IGFBP2 expression by miR-192-2 at the mRNA and protein levels, and the results indicated a target relationship between miR-192-2 and IGFBP2.
The regulation mechanism of IGFBP2 expression is a complex multifactorial process [35]. It has an important role in regulating growth factor activity, participating in growth and development, and influencing lipid generation [36]. In addition, IGFBP2 has been associated with a variety of diseases [37]. IGFBP2 plays an important role in medulloblastoma proliferation, migration, signal transduction, and activation of transcription protein activity and epithelial-to-mesenchymal transition marker levels [38]. Effect of IGFBP2 on proliferation, apoptosis, and P4 secretion in chicken follicular GC [39]. It has been suggested that IGFBP may regulate trophoblast cell proliferation through the PI3K-Akt signaling pathway, thereby affecting pregnancy outcome in pregnancy 2 [40]. Wang et al. showed that miR-34b-5p could mediate myoblast proliferation and differentiation by targeting IGFBP2 [41]. To investigate the role of IGFBP2 in GC proliferation and apoptosis, we examined the mRNA and protein expression of proliferation-related and apoptosis-related genes in GC after downregulating the expression of IGFBP2 in primary GC of goose follicles. When the expression of IGFBP2 was downregulated, the mRNA and protein expression of proliferation-related genes decreased in GC, whereas the mRNA expression and protein expression of apoptosis-related genes (Caspase3, Caspase8, and Caspase9) significantly increased, whereas the expression of mRNA and the protein of the anti-apoptosis gene Bcl-2 significantly decreased. The results of the CCK-8 assay found that the OD value of GC was significantly reduced after downregulation of IGFBP2 expression, and the results of the EdU assay showed that the number of positive GC was significantly reduced after downregulation of IGFBP2 expression. The results of the flow cytometry assay also showed a significant increase in the number of apoptotic cells after miR-192-2 overexpression. These results demonstrated the promotional effect of IGFBP2 on the proliferation and inhibitory effect on apoptosis in goose follicular GC.

5. Conclusions

miR-192-2 inhibited proliferation and promoted apoptosis of goose follicular GC. There was a target relationship between miR-192-2 and IGFBP2. IGFBP2 promoted the proliferation and inhibited the apoptosis in goose follicular GC.

Author Contributions

S.W. made contribution to writing-original draft, visualization, conceptualization, and formal analysis. C.Z. helped to perform data curation, project administration, and supervision. Y.P. made contribution to formal analysis, software, and data curation. Z.Z. made contribution to Investigation, project administration, and formal analysis. Y.Z. made contribution to methodology, investigation, and visualization. S.Y. made contribution to resources, conceptualization, and visualization. X.Z. contributed to funding acquisition and project administration. H.H. contributed to validation, writing-review and editing, conceptualization, and formal analysis. All authors have read and agreed to the published version of the manuscript.

Funding

This research was founded by the National Modern Waterfowl Industry Technology System Special Project (No. CARS-42-24).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University (protocol code: SRM-06 and date of approval: 1 January 2018).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Perring, T.M.; Elliott, B.; Reed, D.A.; Grodowitz, M.J. Female Reproductive System Morphology and the Development of a Physiological Age-Grading System for Bagrada hilaris (Hemiptera: Pentatomidae). J. Insect Sci. 2019, 19, 15. [Google Scholar] [CrossRef]
  2. Han, S.; Wang, J.; Cui, C.; Yu, C.; Zhang, Y.; Li, D.; Ma, M.; Du, H.; Jiang, X.; Zhu, Q.; et al. Fibromodulin is involved in autophagy and apoptosis of granulosa cells affecting the follicular atresia in chicken. Poult. Sci. 2022, 101, 101524. [Google Scholar] [CrossRef] [PubMed]
  3. Li, M.; Liang, W.; Zhu, C.; Qin, S. Smad4 mediates Bmf involvement in sheep granulosa cell apoptosis. Gene 2022, 817, 146231. [Google Scholar] [CrossRef] [PubMed]
  4. Bezerra, M.É.S.; Gouveia, B.B.; Barberino, R.S.; Menezes, V.G.; Macedo, T.J.; Cavalcante, A.Y.; Monte, A.P.O.; Santos, J.M.S.; Matos, M.H.T. Resveratrol promotes in vitro activation of ovine primordial follicles by reducing DNA damage and enhancing granulosa cell proliferation via phosphatidylinositol 3-kinase pathway. Reprod. Domest. Anim. 2018, 53, 1298–1305. [Google Scholar] [CrossRef] [PubMed]
  5. Khristi, V.; Chakravarthi, V.P.; Singh, P.; Ghosh, S.; Pramanik, A.; Ratri, A.; Borosha, S.; Roby, K.F.; Wolfe, M.W.; Karim Rumi, M.A. ESR2 regulates granulosa cell genes essential for follicle maturation and ovulation. Mol. Cell. Endocrinol. 2018, 474, 214–226. [Google Scholar] [CrossRef]
  6. Wang, L.; Chen, Y.; Wu, S.; Wang, L.; Tan, F.; Li, F. PIM2-mediated phosphorylation contributes to granulosa cell survival via resisting apoptosis during folliculogenesis. Clin. Transl. Med. 2021, 11, e359. [Google Scholar] [CrossRef]
  7. Wang, C.; Sun, H.; Davis, J.S.; Wang, X.; Huo, L.; Sun, N.; Huang, Q.; Lv, X.; Wang, C.; He, C.; et al. FHL2 deficiency impairs follicular development and fertility by attenuating EGF/EGFR/YAP signaling in ovarian granulosa cells. Cell Death Dis. 2023, 14, 239. [Google Scholar] [CrossRef]
  8. Cui, Z.; Liu, L.; Kwame Amevor, F.; Zhu, Q.; Wang, Y.; Li, D.; Shu, G.; Tian, Y.; Zhao, X. High Expression of miR-204 in Chicken Atrophic Ovaries Promotes Granulosa Cell Apoptosis and Inhibits Autophagy. Front. Cell Dev. Biol. 2020, 8, 580072. [Google Scholar] [CrossRef]
  9. Wahid, F.; Shehzad, A.; Khan, T.; Kim, Y.Y. MicroRNAs: Synthesis, mechanism, function, and recent clinical trials. Biochim. Biophys. Acta 2010, 1803, 1231–1243. [Google Scholar] [CrossRef]
  10. Hutvágner, G.; Zamore, P.D. A microRNA in a Multiple-Turnover RNAi Enzyme Complex. Science 2002, 297, 2056–2060. [Google Scholar] [CrossRef]
  11. Zhang, B.; Chen, L.; Feng, G.; Xiang, W.; Zhang, K.; Chu, M.; Wang, P. MicroRNA Mediating Networks in Granulosa Cells Associated with Ovarian Follicular Development. BioMed Res. Int. 2017, 2017, 4585213. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, W.; Teng, J.; Han, X.; Zhang, S.; Zhang, Q.; Tang, H. miR-458b-5p regulates ovarian granulosa cells proliferation through Wnt/β-catenin signaling pathway by targeting catenin beta-1. Anim. Biosci. 2021, 34, 957–966. [Google Scholar] [CrossRef] [PubMed]
  13. Mishan, M.A.; Tabari, M.A.K.; Parnian, J.; Fallahi, J.; Mahrooz, A.; Bagheri, A. Functional mechanisms of miR-192 family in cancer. Genes Chromosomes Cancer 2020, 59, 722–735. [Google Scholar] [CrossRef] [PubMed]
  14. Kang, H.; Luo, J.; Wang, C.; Hong, Y.; Ye, M.; Ding, Y.; Zhao, Q.; Chang, Y. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor. Open Med. 2023, 18, 20230879. [Google Scholar] [CrossRef]
  15. Li, Q.; Gao, R.; Chen, Y.; Xie, S.; Sun, X.; Gong, H.; He, F.; Sun, Y.; Lu, S.; Chen, X.; et al. Identification of miR-192 target genes in porcine endometrial epithelial cells based on miRNA pull-down. Mol. Biol. Rep. 2023, 50, 4273–4284. [Google Scholar] [CrossRef]
  16. Yang, Q.; Zhuge, X.; Lin, W.; Yu, W.; Zhu, Y.; Shi, C.; Shi, Z. Hydrogel-based miR-192 delivery inhibits the development of hepatocellular carcinoma by suppressing the GSK3β/Wnt/β-catenin pathway. Neoplasma 2023, 70, 555–565. [Google Scholar] [CrossRef]
  17. Erceylan, Ö.F.; SavaŞ, A.; Göv, E. Targeting the tumor stroma: Integrative analysis reveal GATA2 and TORYAIP1 as novel prognostic targets in breast and ovarian cancer. Turk. J. Biol. 2021, 45, 127–137. [Google Scholar] [CrossRef]
  18. Zhang, J.; Ren, Q.; Chen, J.; Lv, L.; Wang, J.; Shen, M.; Xing, B.; Wang, X. Downregulation of miR-192 Alleviates Oxidative Stress-Induced Porcine Granulosa Cell Injury by Directly Targeting Acvr2a. Cells 2022, 11, 2362. [Google Scholar] [CrossRef]
  19. Ding, H.; Wu, T. Insulin-Like Growth Factor Binding Proteins in Autoimmune Diseases. Front. Endocrinol. 2018, 9, 499. [Google Scholar] [CrossRef]
  20. Slater, T.; Haywood, N.J.; Matthews, C.; Cheema, H.; Wheatcroft, S.B. Insulin-like growth factor binding proteins and angiogenesis: From cancer to cardiovascular disease. Cytokine Growth Factor Rev. 2019, 46, 28–35. [Google Scholar] [CrossRef]
  21. Khan, S.; Lu, X.; Huang, Q.; Tang, J.; Weng, J.; Yang, Z.; Lv, M.; Xu, X.; Xia, F.; Zhang, M.; et al. IGFBP2 Plays an Essential Role in Cognitive Development during Early Life. Adv. Sci. 2019, 6, 1901152. [Google Scholar] [CrossRef] [PubMed]
  22. Lee, E.J.; Mircean, C.; Shmulevich, I.; Wang, H.; Liu, J.; Niemisto, A.; Kavanagh, J.J.; Lee, J.H.; Zhang, W. Insulin-like growth factor binding protein 2 promotes ovarian cancer cell invasion. Mol. Cancer 2005, 4, 7. [Google Scholar] [CrossRef] [PubMed]
  23. Wu, Y.H.; Huang, Y.F.; Chang, T.H.; Chen, C.C.; Wu, P.Y.; Huang, S.C.; Chou, C.Y. COL11A1 activates cancer-associated fibroblasts by modulating TGF-β3 through the NF-κB/IGFBP2 axis in ovarian cancer cells. Oncogene 2021, 40, 4503–4519. [Google Scholar] [CrossRef] [PubMed]
  24. GB/T 35 892-2018; Laboratory Animal—Guideline for Ethical Review of Animal Welfare. National Standard of the People’s Republic of China: Beijing, China, 2018.
  25. Gilbert, A.B.; Evans, A.J.; Perry, M.M.; Davidson, M.H. A method for separating the granulosa cells, the basal lamina and the theca of the preovulatory ovarian follicle of the domestic fowl (Gallus domesticus). J. Reprod. Fertil. 1977, 50, 179–181. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, Y.; Wang, S.; Zang, Z.; Li, B.; Liu, G.; Huang, H.; Zhao, X. Molecular and transcriptomic analysis of the ovary during laying and brooding stages in Zhedong white geese (Anser cygnoides domesticus). Br. Poult. Sci. 2024, 65, 631–644. [Google Scholar] [CrossRef]
  27. Zhang, J.; Xu, Y.; Liu, H.; Pan, Z. MicroRNAs in ovarian follicular atresia and granulosa cell apoptosis. Reprod. Biol. Endocrinol. 2019, 17, 9. [Google Scholar] [CrossRef]
  28. Mai, Q.C.; Mo, Z.Q.; He, J.; Gou, Q.; Shi, F.; Zhuang, W.H.; Xu, R.D.; Li, W.K.; Zhou, Z.J.; Chen, X.M. MiR-129-2 weakens proliferation and promotes apoptosis of liver cancer cells by suppressing the Wnt signaling pathway. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 6665–6673. [Google Scholar] [CrossRef]
  29. Xu, Y.; Wang, S.; Cao, X.; Yuan, Z.; Getachew, T.; Mwacharo, J.M.; Haile, A.; Lv, X.; Sun, W. The Effect of EGR1 on the Proliferation of Dermal Papilla Cells. Genes 2022, 13, 1242. [Google Scholar] [CrossRef]
  30. Zhang, J.; Gan, Y.; Li, H.; Yin, J.; He, X.; Lin, L.; Xu, S.; Fang, Z.; Kim, B.W.; Gao, L.; et al. Inhibition of the CDK2 and Cyclin A complex leads to autophagic degradation of CDK2 in cancer cells. Nat. Commun. 2022, 13, 2835. [Google Scholar] [CrossRef]
  31. Gao, H.; Jiang, J.; Shi, Y.; Chen, J.; Zhao, L.; Wang, C. The LINC00477/miR-128 axis promotes the progression of polycystic ovary syndrome by regulating ovarian granulosa cell proliferation and apoptosis. Reprod. Biol. Endocrinol. 2021, 19, 29. [Google Scholar] [CrossRef]
  32. Tu, J.; Yang, Y.; Albert Cheung, H.-H.; Chen, Z.-J.; Chan, W.-Y. Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. Sci. Rep. 2017, 7, 41304. [Google Scholar] [CrossRef]
  33. Ju, W.; Zhao, S.; Wu, H.; Yu, Y.; Li, Y.; Liu, D.; Lian, F.; Xiang, S. miR-6881-3p contributes to diminished ovarian reserve by regulating granulosa cell apoptosis by targeting SMAD4. Reprod. Biol. Endocrinol. 2024, 22, 17. [Google Scholar] [CrossRef] [PubMed]
  34. Wei, C.; Xiang, S.; Yu, Y.; Song, J.; Zheng, M.; Lian, F. miR-221-3p regulates apoptosis of ovarian granulosa cells via targeting FOXO1 in older women with diminished ovarian reserve (DOR). Mol. Reprod. Dev. 2021, 88, 251–260. [Google Scholar] [CrossRef] [PubMed]
  35. Park, S.H.; Kim, K.W.; Kim, J.C. The Role of Insulin-Like Growth Factor Binding Protein 2 (IGFBP2) in the Regulation of Corneal Fibroblast Differentiation. Investig. Ophthalmol. Vis. Sci. 2015, 56, 7293–7302. [Google Scholar] [CrossRef]
  36. Li, F.; Xing, Y.; Zhang, J.; Mu, J.; Ge, J.; Zhao, M.; Liu, L.; Gong, D.; Geng, T. Goose Hepatic IGFBP2 Is Regulated by Nutritional Status and Participates in Energy Metabolism Mainly through the Cytokine-Cytokine Receptor Pathway. Animals 2023, 13, 2336. [Google Scholar] [CrossRef]
  37. Li, T.; Forbes, M.E.; Fuller, G.N.; Li, J.; Yang, X.; Zhang, W. IGFBP2: Integrative hub of developmental and oncogenic signaling network. Oncogene 2020, 39, 2243–2257. [Google Scholar] [CrossRef]
  38. Kunhiraman, H.; McSwain, L.; Shahab, S.W.; Gershon, T.R.; MacDonald, T.J.; Kenney, A.M. IGFBP2 promotes proliferation and cell migration through STAT3 signaling in Sonic hedgehog medulloblastoma. Acta Neuropathol. Commun. 2023, 11, 62. [Google Scholar] [CrossRef]
  39. Hu, L.; Li, D.; Wei, Q.; Kang, L.; Sun, Y.; Jiang, Y. Characterization of a novel IGFBP-2 transcript in the ovarian granulosa cells of chicken follicles: mRNA expression, function and effect of reproductive hormones and IGF1. Poult. Sci. 2024, 103, 104501. [Google Scholar] [CrossRef]
  40. Ji, L.; Jiao, Z.; Zhang, L.; Shi, J.; Wan, Q.; Qian, C.; Wang, H.; Cao, X.; Shen, B.; Jiang, L. Role of increased IGFBP2 in trophoblast cell proliferation and recurrent spontaneous abortion development: A pilot study. Physiol. Rep. 2024, 12, e15939. [Google Scholar] [CrossRef]
  41. Wang, Z.; Zhang, X.; Li, Z.; Abdalla, B.A.; Chen, Y.; Nie, Q. MiR-34b-5p Mediates the Proliferation and Differentiation of Myoblasts by Targeting IGFBP2. Cells 2019, 8, 360. [Google Scholar] [CrossRef]
Figure 1. miR-192-2 mimic regulates the proliferation of goose follicle granulosa cells. (A) After transfection with miR-192-2 mimics or negative controls (mimic NC), miR-192-2 expression in granulosa cells was monitored by qRT-PCR. (B) mRNA expression of CDK2, PCNA, CCND1, and CCND2 in granulosa cells transfected with a miR-192-2 mimic or mimic negative controls. (C) Granulosa cells were transfected with miR-192-2 mimic or mimic negative controls. Cell growth curves were determined using CCK-8. (D,E) The proportion of cells in a proliferative state was determined after transfection of miR-192-2 mimic or mimic negative controls into granulosa cells using EdU (Scale bar = 50 μm). (F,G) Protein expression of CDK2 and PCNA in granulosa cells was detected by WB after transfection of miR-192-2 mimic or mimic negative controls into granulosa cells. Data are expressed as mean ± SEM (n = 3). ** p < 0.01.
Figure 1. miR-192-2 mimic regulates the proliferation of goose follicle granulosa cells. (A) After transfection with miR-192-2 mimics or negative controls (mimic NC), miR-192-2 expression in granulosa cells was monitored by qRT-PCR. (B) mRNA expression of CDK2, PCNA, CCND1, and CCND2 in granulosa cells transfected with a miR-192-2 mimic or mimic negative controls. (C) Granulosa cells were transfected with miR-192-2 mimic or mimic negative controls. Cell growth curves were determined using CCK-8. (D,E) The proportion of cells in a proliferative state was determined after transfection of miR-192-2 mimic or mimic negative controls into granulosa cells using EdU (Scale bar = 50 μm). (F,G) Protein expression of CDK2 and PCNA in granulosa cells was detected by WB after transfection of miR-192-2 mimic or mimic negative controls into granulosa cells. Data are expressed as mean ± SEM (n = 3). ** p < 0.01.
Animals 15 00663 g001
Figure 2. miR-192-2 inhibitor regulates the proliferation of goose follicle granulosa cells. (A) The expression of miR-192-2 in granulosa cells was detected by qRT-PCR after miR-192-2 inhibitor or negative control (inhibitor NC) was transfected into granulosa cells. (B) mRNA expression of CDK2, PCNA, CCND1, and CCND2 in granulosa cells transfected with miR-192-2 inhibitor or inhibitor negative control. (C) Cell growth curves as measured using the CCK-8 assay following transfection with a miR-192-2 inhibitor or inhibitor negative control in granulosa cells. (D,E) The proportion of cells in a proliferative state was determined after transfection of granulosa cells with the miR-192-2 inhibitor or inhibitor negative control using EdU (Scale bar = 50 μm). (F,G) Abundance of proteins of CDK2 and PCNA in granulosa cells transfected with miR-192-2 inhibitor or inhibitor negative control as determined by use of Western blot analysis. Data are expressed as mean ± SEM (n = 3). ** p < 0.01.
Figure 2. miR-192-2 inhibitor regulates the proliferation of goose follicle granulosa cells. (A) The expression of miR-192-2 in granulosa cells was detected by qRT-PCR after miR-192-2 inhibitor or negative control (inhibitor NC) was transfected into granulosa cells. (B) mRNA expression of CDK2, PCNA, CCND1, and CCND2 in granulosa cells transfected with miR-192-2 inhibitor or inhibitor negative control. (C) Cell growth curves as measured using the CCK-8 assay following transfection with a miR-192-2 inhibitor or inhibitor negative control in granulosa cells. (D,E) The proportion of cells in a proliferative state was determined after transfection of granulosa cells with the miR-192-2 inhibitor or inhibitor negative control using EdU (Scale bar = 50 μm). (F,G) Abundance of proteins of CDK2 and PCNA in granulosa cells transfected with miR-192-2 inhibitor or inhibitor negative control as determined by use of Western blot analysis. Data are expressed as mean ± SEM (n = 3). ** p < 0.01.
Animals 15 00663 g002
Figure 3. miR-192-2 regulates apoptosis of goose follicle granulosa cells. (A,D) mRNA expression of Caspase3, Caspase8, Caspase9, and Bcl-2 in GC transfected with a miR-192-2 mimic, inhibitor, or negative control (inhibitor NC). (B,C,E,F) Abundance of proteins of Caspase3, Caspase8, Caspase9, and Bcl-2 in granulosa cells transfected with miR-192-2 mimic, inhibitor, or inhibitor negative control as determined by use of Western blot analysis. (GJ) Scatter gram and rate of apoptosis in granulosa cells transfected with miR-192-2 inhibitor or miR-192-2 mimics were analyzed using flow cytometry following staining with annexin V and PI. Data are expressed as mean ± SEM (n = 3). ** p < 0.01.
Figure 3. miR-192-2 regulates apoptosis of goose follicle granulosa cells. (A,D) mRNA expression of Caspase3, Caspase8, Caspase9, and Bcl-2 in GC transfected with a miR-192-2 mimic, inhibitor, or negative control (inhibitor NC). (B,C,E,F) Abundance of proteins of Caspase3, Caspase8, Caspase9, and Bcl-2 in granulosa cells transfected with miR-192-2 mimic, inhibitor, or inhibitor negative control as determined by use of Western blot analysis. (GJ) Scatter gram and rate of apoptosis in granulosa cells transfected with miR-192-2 inhibitor or miR-192-2 mimics were analyzed using flow cytometry following staining with annexin V and PI. Data are expressed as mean ± SEM (n = 3). ** p < 0.01.
Animals 15 00663 g003aAnimals 15 00663 g003b
Figure 4. IGFBP2 is a target gene of miR-192-2. (A,B) Expression of miR-192-2 and IGFBP2 in the ovaries of geese at the laying period and brooding period. (C) Predicted target genes of miR-192-2 using TargetScan and miRDB. (D) IGFBP2-3′-UTR wild, mutant dual luciferase vectors and miR-192-2 mimic, miR-192-2 negative control, were co-transfected into 193T cells, and relative luciferase activity was determined after 48 h. (E,F) IGFBP2 mRNA expression after transfection of miR-192-2 mimic, inhibitor, or negative control (inhibitor NC) into granulosa cells. (G,H) Protein expression of IGFBP2 after transfection of miR-192-2 mimic, inhibitor or inhibitor NC into granulosa cells. Data are expressed as mean ± SEM (n = 3). ** p < 0.01; *** p < 0.001.
Figure 4. IGFBP2 is a target gene of miR-192-2. (A,B) Expression of miR-192-2 and IGFBP2 in the ovaries of geese at the laying period and brooding period. (C) Predicted target genes of miR-192-2 using TargetScan and miRDB. (D) IGFBP2-3′-UTR wild, mutant dual luciferase vectors and miR-192-2 mimic, miR-192-2 negative control, were co-transfected into 193T cells, and relative luciferase activity was determined after 48 h. (E,F) IGFBP2 mRNA expression after transfection of miR-192-2 mimic, inhibitor, or negative control (inhibitor NC) into granulosa cells. (G,H) Protein expression of IGFBP2 after transfection of miR-192-2 mimic, inhibitor or inhibitor NC into granulosa cells. Data are expressed as mean ± SEM (n = 3). ** p < 0.01; *** p < 0.001.
Animals 15 00663 g004
Figure 5. IGFBP2 promotes granulosa cell proliferation in goose follicles. (A) The mRNA expression of IGFBP2 was detected after transfection of si-IGFBP2 or negative control (si-NC) into granulosa cells. (B) Cell growth curves were determined using CCK-8 after transfection of si-IGFBP2 or si-negative control into granulosa cells. (C,D) Protein expression of CDK2 and PCNA was detected after transfection of si-IGFBP2 or si-negative control into granulosa cells. (E,F) The proportion of cells in a proliferative state was determined after transfection of si-IGFBP2 or si-negative control into granulosa cells using EdU (Scale bar = 50 μm). (G) The mRNA expression of CDK2, PCNA, CCND1, and CCND2 was detected after transfecting granulosa cells with si-IGFBP2 or si-negative control. Data are expressed as mean ± SEM (n = 3). * p < 0.05, ** p < 0.01.
Figure 5. IGFBP2 promotes granulosa cell proliferation in goose follicles. (A) The mRNA expression of IGFBP2 was detected after transfection of si-IGFBP2 or negative control (si-NC) into granulosa cells. (B) Cell growth curves were determined using CCK-8 after transfection of si-IGFBP2 or si-negative control into granulosa cells. (C,D) Protein expression of CDK2 and PCNA was detected after transfection of si-IGFBP2 or si-negative control into granulosa cells. (E,F) The proportion of cells in a proliferative state was determined after transfection of si-IGFBP2 or si-negative control into granulosa cells using EdU (Scale bar = 50 μm). (G) The mRNA expression of CDK2, PCNA, CCND1, and CCND2 was detected after transfecting granulosa cells with si-IGFBP2 or si-negative control. Data are expressed as mean ± SEM (n = 3). * p < 0.05, ** p < 0.01.
Animals 15 00663 g005
Figure 6. IGFBP2 inhibits apoptosis in goose follicular granulosa cells. (A) The mRNA expressions of Bcl-2, Caspase3, Caspase8, and Caspase9 were determined after the transfection of the interfering vector and small interfering RNA for the synthesis of IGFBP2 (si-IGFBP2) or negative control (si-NC) into GC. (B,C) Scatter gram and rate of apoptosis in granulosa cells transfected with si-IGFBP2 or si-negative control as analyzed using flow cytometry following staining with annexin V and PI. (D,E) Abundance of proteins of Caspase3, Caspase8, Caspase9, and Bcl-2 in granulosa cells transfected with si-IGFBP2 or si-negative control as determined by the use of Western blot analysis. Data are presented as mean ± SEM (n = 3). ** p < 0.01.
Figure 6. IGFBP2 inhibits apoptosis in goose follicular granulosa cells. (A) The mRNA expressions of Bcl-2, Caspase3, Caspase8, and Caspase9 were determined after the transfection of the interfering vector and small interfering RNA for the synthesis of IGFBP2 (si-IGFBP2) or negative control (si-NC) into GC. (B,C) Scatter gram and rate of apoptosis in granulosa cells transfected with si-IGFBP2 or si-negative control as analyzed using flow cytometry following staining with annexin V and PI. (D,E) Abundance of proteins of Caspase3, Caspase8, Caspase9, and Bcl-2 in granulosa cells transfected with si-IGFBP2 or si-negative control as determined by the use of Western blot analysis. Data are presented as mean ± SEM (n = 3). ** p < 0.01.
Animals 15 00663 g006
Table 1. Oligonucleotide sequences used in this study.
Table 1. Oligonucleotide sequences used in this study.
NameSequence (5′-3′)
miR-192-2 mimicAUGACCUAUGAAUUGACAGAC
CUGUCAAUUCAUAGGUCAUUU
miR-192-2 inhibitorGUCUGUCAAUUCAUAGGUCAU
si-IGFBP2UGAAGGAGCUGGCGGUUAUtt
mimic NCUUGUACUACACAAAAGUACUG
inhibitor NCCAGUACUUUUGUGUAGUACAA
Table 2. Primers used in this study.
Table 2. Primers used in this study.
GenePrimer Sequence (5′-3′)Size (bp)
CDK2F: CCAGAACCTCCTCATCAAC171
R: CAGATGTCCACAGCAGTC
PCNAF: GAGACCTCAGCCACATTGGT173
R: AGTCAGCTGGACTGGCTCAT
CCND1F: CAGAAGTGCGAAGAGGAAGT188
R: CTGATGGAGTTGTCGGTGTA
CCND2F: CCCACTCGAAAGTGCCATCT186
R: TGCTGCAAGGTTCCACTTCA
Caspase3F: TGGCCCTCTTGAACTGAAAG106
R: TCCACTGTCTGCTTCAATACC
Caspase8F: AGCTGTAATGCAGGGGTTCT197
R: GGCCTCACGATCCTTCTGAC
Caspase9F: TCCCGGGCTGTTTCAACTT270
R: CCTCATCTTGCAGCTTGTGC
Bcl-2F: ATCGTCGCCTTCTTCGAGTT150
R: ATCCCATCCTCCGTTGTCCT
IGFBP2F: AGCGGCAGATGGGCAAAGT184
R: GGGGATGTGGAGGGAGTAGAGG
GAPDHF: TCCTCCACCTTTGATGCG146
R: GTGCCTGGCTCACTCCTT
U6F: GGGCCATGCTAATCTTCTCTGTA
R: CAGGTCCAGTTTTTTTTTTTTTT
miR-192-2F: GCGCGATGACCTATGAATTG
R: AGTGCAGGGTCCGAGGTATT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, S.; Zeng, C.; Pan, Y.; Zang, Z.; Zhang, Y.; Yue, S.; Zhao, X.; Huang, H. miR-192-2 Regulates the Proliferation and Apoptosis of Ovarian Granulosa Cells by Targeting IGFBP2 in Zhedong White Geese. Animals 2025, 15, 663. https://doi.org/10.3390/ani15050663

AMA Style

Wang S, Zeng C, Pan Y, Zang Z, Zhang Y, Yue S, Zhao X, Huang H. miR-192-2 Regulates the Proliferation and Apoptosis of Ovarian Granulosa Cells by Targeting IGFBP2 in Zhedong White Geese. Animals. 2025; 15(5):663. https://doi.org/10.3390/ani15050663

Chicago/Turabian Style

Wang, Size, Chuicheng Zeng, Yue Pan, Zhengyu Zang, Yuanliang Zhang, Shan Yue, Xiuhua Zhao, and He Huang. 2025. "miR-192-2 Regulates the Proliferation and Apoptosis of Ovarian Granulosa Cells by Targeting IGFBP2 in Zhedong White Geese" Animals 15, no. 5: 663. https://doi.org/10.3390/ani15050663

APA Style

Wang, S., Zeng, C., Pan, Y., Zang, Z., Zhang, Y., Yue, S., Zhao, X., & Huang, H. (2025). miR-192-2 Regulates the Proliferation and Apoptosis of Ovarian Granulosa Cells by Targeting IGFBP2 in Zhedong White Geese. Animals, 15(5), 663. https://doi.org/10.3390/ani15050663

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop