Effect of Centrifuged Chicken Egg Yolk on the Cryopreservation of Boar Semen
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.1.1. Major Reagents
2.1.2. Major Instruments and Equipment
2.2. Extender Preparation
2.3. Semen Processing
2.4. Semen Freezing and Thawing
2.5. Sperm Quality Assessment
2.5.1. Sperm Motility Parameters
2.5.2. Acrosome Integrity
2.5.3. Plasma Membrane Integrity
2.5.4. Oxidative Stress Markers
2.5.5. Sperm Apoptosis Rate
2.5.6. Total RNA Extraction from Sperm
2.5.7. Reverse Transcription and qRT-PCR
2.6. Statistical Analysis
3. Results
3.1. Particle Size of Egg Yolk After Centrifugation
3.2. Effects of Centrifuged Egg Yolk on Post-Thaw Boar Sperm Motility Parameters
3.3. Effects of Centrifuged Egg Yolk on Post-Thaw Boar Sperm Morphology
3.4. Effect of Centrifuged Egg Yolk on Antioxidant Enzyme Content in Post-Thaw Boar Sperm
3.5. Effects of Centrifuged Egg Yolk on Post-Thaw Boar Sperm Apoptosis Rate
3.6. Effects of Centrifuged Egg Yolk on Post-Thaw Boar Sperm Apoptosis-Related Gene Expression
4. Discussion
4.1. Effect of Centrifugal Treatment of Chicken Yolk Dilution on Particle Diameter
4.2. Effect of Centrifugal Treatment of Chicken Egg Yolk on the Motility Parameters of Frozen and Thawed Porcine Spermatozoa
4.3. Effect of Centrifugal Treatment of Chicken Yolk on the Morphology of Frozen and Thawed Porcine Spermatozoa
4.4. Effect of Centrifugal Treatment of Chicken Egg Yolk on Antioxidant Capacity of Frozen and Thawed Porcine Spermatozoa
4.5. Effect of Centrifugal Treatment of Chicken Egg Yolk on the Rate of Apoptosis in Frozen–Thawed Porcine Spermatozoa
4.6. Effect of Centrifugal Treatment of Chicken Yolk on Apoptotic Gene Expression in Freeze–Thawed Porcine Spermatozoa
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Correction Statement
References
- Didion, B.A.; Braun, G.D.; Duggan, M.V. Field fertility of frozen boar semen: A retrospective report comprising over 2600 AI services spanning a four year period. Anim. Reprod. Sci. 2013, 137, 189–196. [Google Scholar] [CrossRef] [PubMed]
- Bang, S.; Tanga, B.M.; Fang, X.; Seong, G.; Saadeldin, I.M.; Qamar, A.Y.; Lee, S.; Kim, K.J.; Park, Y.J.; Nabeel, A. Cryopreservation of Pig Semen Using a Quercetin-Supplemented Freezing Extender. Life 2022, 12, 1155. [Google Scholar] [CrossRef] [PubMed]
- Aboagla, E.M.; Terada, T. Effects of egg yolk during the freezing step of cryopreservation on the viability of goat spermatozoa. Theriogenology 2004, 62, 1160–1172. [Google Scholar] [CrossRef] [PubMed]
- Bergeron, A.; Manjunath, P. New insights towards understanding the mechanisms of sperm protection by egg yolk and milk. Mol. Reprod. Dev. 2006, 73, 1338–1344. [Google Scholar] [CrossRef] [PubMed]
- Anzar, M.; Rajapaksha, K.; Boswall, L. Egg yolk-free cryopreservation of bull semen. PLoS ONE 2019, 14, e0223977. [Google Scholar] [CrossRef] [PubMed]
- Sicchieri, F.; Silva, A.B.; Santana, V.P.; Vasconcelos, M.; Ferriani, R.A.; Vireque, A.A.; Dos, R.R. Phosphatidylcholine and L-acetyl-carnitine-based freezing medium can replace egg yolk and preserves human sperm function. Transl. Androl. Urol. 2021, 10, 397–407. [Google Scholar] [CrossRef] [PubMed]
- Sharafi, M.; Borghei-Rad, S.M.; Hezavehei, M.; Shahverdi, A.; Benson, J.D. Cryopreservation of semen in domestic animals: A review of current challenges, applications, and prospective strategies. Animals 2022, 12, 3271. [Google Scholar] [CrossRef]
- Tarig, A.A.; Wahid, H.; Rosnina, Y.; Yimer, N.; Goh, Y.M.; Baiee, F.H.; Khumran, A.M.; Salman, H.; Ebrahimi, M. Effect of different concentrations of egg yolk and virgin coconut oil in Tris-based extenders on chilled and frozen-thawed bull semen. Anim. Reprod. Sci. 2017, 182, 21–27. [Google Scholar] [CrossRef]
- Wang, J.-Y.; He, M.-X.; Zhang, S.-S.; Dai, J.-J.; Sun, L.-W.; Wu, C.-F.; Zhang, D.-J. Effect of high pressure homogenization (HPH) on quality of boar cryopreservation semen. Chin. Vet. Sci. 2021, 51, 932–938. [Google Scholar] [CrossRef]
- Marco-Jiménez, F.; Puchades, S.; Mocé, E.; Viudes-de-Cartro, M.P.; Vicente, J.S.; Rodriguez, M. Use of powdered egg yolk vs fresh egg yolk for the cryopreservation of ovine semen. Reprod. Domest. Anim. 2004, 39, 438–441. [Google Scholar] [CrossRef]
- Garde, J.J.; Del, O.A.; Soler, A.J.; Espeso, G.; Gomendio, M.; Roldan, E.R. Effect of egg yolk, cryoprotectant, and various sugars on semen cryopreservation in endangered Cuvier’s gazelle (Gazella cuvieri). Anim. Reprod. Sci. 2008, 108, 384–401. [Google Scholar] [CrossRef] [PubMed]
- Saha, A.; Asaduzzaman, M.; Bari, F.Y. Cryopreservation techniques for ram sperm. Vet. Med. Int. 2022, 2022, 7378379. [Google Scholar] [CrossRef] [PubMed]
- Gou, C.-Y.; Dou, H.-D.; Guan, M.-K.; Liu, M.-M.; Zhang, G.-L. The study on the effect of scutellaria baicalensis polysaccharides on the cryopreservation of landrace pig semen. China Anim. Husb. Vet. Med. 2024, 60, 274–278. [Google Scholar]
- Brum, A.M.; Thomas, A.D.; Sabeur, K.; Ball, B.A. Evaluation of Coomassie blue staining of the acrosome of equine and canine spermatozoa. Am. J. Vet. Res. 2006, 67, 358–362. [Google Scholar] [CrossRef] [PubMed]
- Oladimeji, B.M.; Gebhardt, R. Physical characteristics of egg yolk granules and effect on their functionality. Foods 2023, 12, 2531. [Google Scholar] [CrossRef]
- Laca, A.; Paredes, B.; Rendueles, M.; Díaz, M. Egg yolk plasma: Separation, characteristics and future prospects. LWT—Food Sci. Technol. 2015, 62, 7–10. [Google Scholar] [CrossRef]
- Bahmani, S.; Eslami, M.; Farrokhi-Ardabili, F.; Imani, M.; Batavani, R. Evaluation of chicken egg yolk plasma and low-density lipoprotein alone or enriched with ewe or cow skim milk in tris–citric acid-based diluent for cryostorage of ram semen. Biopreserv. Biobank. 2022, 21, 346–354. [Google Scholar] [CrossRef]
- Belala, R.; Briand-Amirat, L.; Martinot, A.; Thorin, C.; Michaud, S.; Desherces, S.; Youngs, C.R.; Bencharif, D. A comparison of liquid and lyophilized egg yolk plasma to low density lipoproteins for freezing of canine spermatozoa. Reprod. Domest. Anim. 2019, 54, 1131–1138. [Google Scholar] [CrossRef] [PubMed]
- González, D.; Rojas, M.; Rojano, B.; Restrepo, G. Low-density lipoproteins, resveratrol and quercetin as alternative additives to improve boar semen cooling. Reprod. Domest. Anim. 2023, 58, 1420–1427. [Google Scholar] [CrossRef]
- Ariantie, O.S.; Amrozi, A.; Yusuf, T.L.; Rochman, N.T.; Purwantara, B. The production of freeze-dried egg yolk powder and its effect on the quality of garut ram liquid semen. J. Kedokt. Hewan 2021, 15, 37–46. [Google Scholar] [CrossRef]
- Divar, M.R.; Mogheiseh, A.; Mohammadi, F.; Mavalizadeh, L. Effects of extender filtration and egg yolk concentration on canine semen cryopreservation. Reprod. Domest. Anim. 2022, 58, 272–287. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Li, Q.; Li, G.; Jiang, Z.; Bu, S.; Yang, H.; Wang, L. The cryoprotective effect of trehalose supplementation on boar spermatozoa quality. Anim. Reprod. Sci. 2008, 119, 166. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Ye, H.; Shao, Y.; Wu, S.; Yu, J.; Ji, C.; Wang, S.; Zeng, S. The effects of egg yolk concentration and particle size on donkey semen preservation. J. Equine Vet. Sci. 2018, 65, 19–24. [Google Scholar] [CrossRef]
- Simons, J.; Fauci, L. A model for the acrosome reaction in mammalian sperm. Bull. Math. Biol. 2018, 80, 2481–2501. [Google Scholar] [CrossRef]
- Islam, M.M.; Umehara, T.; Tsujita, N.; Koyago, M.; Shimada, M. Treatment with cholesterol just after thawing maintains the fertility of bull sperm. Mol. Hum. Reprod. 2023, 29, gaad031. [Google Scholar] [CrossRef] [PubMed]
- Min, C.G.; Ma, X.; Wang, Y.C. The effects of repeated freezing and thawing on bovine sperm morphometry and function. Cryobiology 2024, 115, 104892. [Google Scholar] [CrossRef]
- Almbro, M.; Dowling, D.K.; Simmons, L.W. Effects of vitamin E and beta-carotene on sperm competitiveness. Ecol. Lett. 2011, 14, 891–895. [Google Scholar] [CrossRef]
- Alahmar, A.T. Role of Oxidative Stress in Male Infertility: An Updated Review. J. Hum. Reprod. Sci. 2019, 12, 4–18. [Google Scholar] [CrossRef]
- Rodríguez, M.Á.; Álvarez, M.; Anel-López, L.; Martínez-Rodríguez, C.; Pastor, F.M.; Borragán, S.; Anel, L.; de Paz, P. The antioxidant effects of soybean lecithin- or low-density lipoprotein-based extenders for the cryopreservation of brown-bear (Ursus arctos) spermatozoa. Reprod. Fertil. Dev. 2013, 25, 1185. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; He, X.; Harlina, P.W.; Wang, J.; Geng, F. Research Note: Comparison of water-soluble metabolites in egg yolk, yolk granules, and yolk plasma based on quantitative metabolomic analysis. Poult. Sci. 2023, 102, 103161. [Google Scholar] [CrossRef] [PubMed]
- Dalal, J.; Chandolia, R.K.; Pawaria, S.; Kumar, A.; Kumar, D.; Selokar, N.L.; Adnot, J.; Yadav, P.S.; Kumar, P. Low-density lipoproteins protect sperm during cryopreservation in buffalo: Unraveling mechanism of action. Mol. Reprod. Dev. 2020, 87, 1231–1244. [Google Scholar] [CrossRef] [PubMed]
- Schäfer-Somi, S.; Binder, C.; Burak, J.; Papadopoulos, N.; Ilas, J.; Boersma, A.; Aurich, C. Using egg yolk in a TRIS-Equex STM paste extender for freezing of dog semen is superior to egg yolk plasma, also after addition of lecithin and catalase. Cryobiology. 2021, 100, 63–71. [Google Scholar] [CrossRef]
- Villaverde, A.I.S.B.; Netherton, J.; Baker, M.A. From past to present: The link between reactive oxygen species in sperm and male infertility. Antioxidants 2019, 8, 616. [Google Scholar] [CrossRef]
- Moussa, M.; Martinet, V.; Trimeche, A.; Tainturier, D.; Anton, M. Low density lipoproteins extracted from hen egg yolk by an easy method: Cryoprotective effect on frozen–thawed bull semen. Theriogenology 2002, 57, 1695–1706. [Google Scholar] [CrossRef]
- Wang, J.-Y.; Dai, J.-J.; Zhang, S.-H.; Sun, L.-W.; Wu, C.-F.; Zhang, D.-F. Effects of High Pressure Homogeneous Egg Yolk on Apopotsis of Boar Sperm CryoPresservation. Acta Vet. Zootech. Sin. 2021, 52, 2190–2199. [Google Scholar]
- Ligocka, Z.; Partyka, A.; Bonarska-Kujawa, D.; Mucha, A.; Niżański, W. Addition of low concentration of cholesterol-loaded cyclodextrin (CLC) has a positive effect on cryopreserved canine spermatozoa evaluated by andrological and biophysical methods. BMC Vet. Res. 2024, 20, 7. [Google Scholar] [CrossRef] [PubMed]
- Said, T.M.; Gaglani, A.; Agarwal, A. Implication of apoptosis in sperm cryoinjury. Reprod. Biomed. 2010, 21, 456–462. [Google Scholar] [CrossRef]
- Ozimic, S.; Ban-Frangez, H.; Stimpfel, M. Sperm cryopreservation today: Approaches, efficiency, and pitfalls. Curr. Issues Mol. Biol. 2023, 45, 4716–4734. [Google Scholar] [CrossRef]
- Hai, E.; Li, B.; Zhang, J.; Zhang, J. Sperm freezing damage: The role of regulated cell death. Cell Death Discov. 2024, 10, 239. [Google Scholar] [CrossRef] [PubMed]
- John, M.G.; Acton, E.; Murray, B.J.; Fonseca, F. Freezing injury: The special case of the sperm cell. Cryobiology 2012, 64, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Hu, S.; Tuerdi, M.; Yu, X.; Zhang, H.; Zhou, Y.; Cao, J.; Da, S.V.I.J.; Zhou, J. Initiator and executioner caspases in salivary gland apoptosis of Rhipicephalus haemaphysaloides. Parasit. Vectors 2020, 13, 288. [Google Scholar] [CrossRef]
- Jeong, Y.J.; Kim, M.K.; Song, H.J.; Kang, E.J.; Ock, S.A.; Kumar, B.M.; Balasubramanian, S.; Rho, G.J. Effect of alpha-tocopherol supplementation during boar semen cryopreservation on sperm characteristics and expression of apoptosis related genes. Cryobiology 2009, 58, 181–189. [Google Scholar] [CrossRef]





| Primer ID | Primer Sequence (5′–3′) | Product Length |
|---|---|---|
| GAPDH-F | TTCCACGGCACAGTCAAGGC | 150 bp |
| GAPDH-R | CATGGTCGTGAAGACACCAG | |
| CAT-F | TGCCCATACTTCCCGTCC | 172 bp |
| CAT-R | GGTCCAGGTTACCGTCAG | |
| TNF-a-F | ATTCAGGGATGTGTGGCCTG | 120 bp |
| TNF-a-R | CCAGATGTCCCAGGTTGCAT | |
| P53-F | GAACAGsCTTTGAGGTGCGTG | 175 bp |
| P53-R | GCCATCCAGTGGCTTCTTCT | |
| Caspase-9-F | AACTTCTGCCATGAGTCGGG | 142 bp |
| Caspase-9-R | CCAAAGCCTGGACCATTTGC | |
| Bax-F | GCCGAAATGTTTGCTGACGG | 146 bp |
| Bax-R | CGAAGGAAGTCCAGCGTCCA | |
| Bcl-2-F | GGCAACCCATCCTGGCACCT | 134 bp |
| Bcl-2-R | AACTCATCGCCCGCCTCCCT |
| Mobility Parameter | CG | EG | p-Value |
|---|---|---|---|
| Sperm viability, % | 37.51 ± 0.91 b | 42.17 ± 1.46 a | 0.00 |
| Progressive motility, % | 30.09 ± 2.00 b | 34.46 ± 1.40 a | 0.00 |
| VSL, μm/s | 22.01 ± 1.59 b | 27.21 ± 1.48 a | 0.00 |
| VCL, μm/s | 44.72 ± 2.12 b | 50.34 ± 3.14 a | 0.00 |
| VAP, μm/s | 36.92 ± 3.60 | 39.35 ± 2.43 | 0.11 |
| LIN, % | 53.90 ± 3.73 | 54.24 ± 4.63 | 0.86 |
| STR, % | 59.91 ± 4.64 b | 69.34 ± 5.37 a | 0.00 |
| WOB, % | 82.44 ± 5.27 | 78.33 ± 5.28 | 0.11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, F.; Zhang, B.; Liu, H.; Fan, H.; Xie, R.; Li, J.; Hu, Q.; Ruan, C. Effect of Centrifuged Chicken Egg Yolk on the Cryopreservation of Boar Semen. Animals 2025, 15, 599. https://doi.org/10.3390/ani15040599
Chang F, Zhang B, Liu H, Fan H, Xie R, Li J, Hu Q, Ruan C. Effect of Centrifuged Chicken Egg Yolk on the Cryopreservation of Boar Semen. Animals. 2025; 15(4):599. https://doi.org/10.3390/ani15040599
Chicago/Turabian StyleChang, Fuqiang, Biyu Zhang, Haidong Liu, Henglei Fan, Rui Xie, Jing Li, Qianqian Hu, and Chongmei Ruan. 2025. "Effect of Centrifuged Chicken Egg Yolk on the Cryopreservation of Boar Semen" Animals 15, no. 4: 599. https://doi.org/10.3390/ani15040599
APA StyleChang, F., Zhang, B., Liu, H., Fan, H., Xie, R., Li, J., Hu, Q., & Ruan, C. (2025). Effect of Centrifuged Chicken Egg Yolk on the Cryopreservation of Boar Semen. Animals, 15(4), 599. https://doi.org/10.3390/ani15040599
