Parentage Verification and Segregation Distortion Patterns of Microsatellite Markers in Olive Flounder (Paralichthys olivaceus) Full-Sib Families
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Fish Families
2.2. Genotyping of Microsatellite DNA
2.3. Analysis of Null Allele Frequency, Parentage, and Probability of Non-Exclusion
2.4. Analysis of Segregation Patterns
3. Results
3.1. Microsatellite Genotype Profiles
3.2. Parent–Progeny Matching and Unexpected Offspring Genotypes
3.3. Parental Exclusion Assignment Analysis
3.4. Segregation Pattern and Segregation Distortion Values
4. Discussion
4.1. Genotyping Rates and Null Alleles
4.2. Occurrence of Unexpected Genotypes in P2 Progeny
4.3. Performance of Parentage Markers
4.4. Segregation Distortion and Potential Mechanisms
4.5. Limitations and Further Considerations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vieira, M.L.C.; Santini, L.; Diniz, A.L.; Muhoz, C.F. Microsatellite markers: What they mean and why they are so useful. Genet. Mol. Biol. 2016, 39, 312–328. [Google Scholar] [CrossRef] [PubMed]
- Wenne, R. Microsatellites as molecular markers with applications in exploitation and conservation of aquatic animal populations. Genes 2023, 14, 808. [Google Scholar] [CrossRef] [PubMed]
- Abdul-Muneer, P.M. Application of microsatellite markers in conservation genetics and fisheries management: Recent advances in population structure analysis and conservation strategies. Genet. Res. Int. 2014, 2014, 691759. [Google Scholar] [CrossRef] [PubMed]
- Estoup, A.; Presa, P.; Krieg, F.; Vaiman, D.; Guyomard, R. (CT)n and (GT)n microsatellites: A new class of genetic markers for Salmo trutta L. (brown trout). Heredity 1993, 71, 488–496. [Google Scholar] [CrossRef]
- Chistiakov, D.A.; Hellemans, B.; Volckaert, F.A.M. Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture 2006, 255, 1–29. [Google Scholar] [CrossRef]
- Lei, Y.; Zhou, Y.; Price, M.; Song, Z. Genome-wide characterization of microsatellite DNA in fishes: Survey and analysis of their abundance and frequency in genome-specific regions. BMC Genom. 2021, 22, 421. [Google Scholar] [CrossRef] [PubMed]
- Slettan, A.; Olsaker, I.; Lie, O. Segregation studies and linkage analysis of Atlantic salmon microsatellites using haploid genetics. Heredity 1997, 78, 620–627. [Google Scholar] [CrossRef]
- Fu, Q.; Meng, X.; Luan, S.; Chen, B.; Cao, J.; Li, X.; Kong, J. Segregation distortion: High genetic load suggested by a Chinese shrimp family under high-intensity selection. Sci. Rep. 2020, 10, 21820. [Google Scholar] [CrossRef] [PubMed]
- Friocourt, G.; Perrin, A.; Saunders, P.A.; Nikalayevich, E.; Voisset, C.; Coutton, C.; Martinez, G.; Morel, F. Bypassing Mendel’s first law: Transmission ratio distortion in mammals. Int. J. Mol. Sci. 2023, 24, 1600. [Google Scholar] [CrossRef]
- Castro, J.; Bouza, C.; Presa, P.; Pino-Querido, A.; Riaza, A.; Ferreiro, I.; Sanchez, L.; Martinez, P. Potential sources of error in parentage assignment of turbot (Scophthalmus maximus) using microsatellite loci. Aquaculture 2004, 242, 119–135. [Google Scholar] [CrossRef]
- Sekino, M.; Hara, M.; Taniguchi, N. Loss of microsatellite and mitochondrial DNA variation in hatchery strains of Japanese flounder Paralichthys olivaceus. Aquaculture 2002, 213, 101–122. [Google Scholar] [CrossRef]
- Castano-Sanchez, C.; Fuji, K.; Ozaki, A.; Hasegawa, O.; Sakamoto, T.; Morishima, K.; Nakayama, I.; Fujiwara, A.; Masaoka, T.; Okamoto, H.; et al. A second generation genetic linkage map of Japanese flounder (Paralichthys olivaceus). BMC Genom. 2010, 11, 554. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Yang, R.; Liu, Y.; Sun, Z. Estimation of heritability for growth-related traits in Paralichthys olivaceus using a microsatellite-based pedigree. J. World Aquacult. Soc. 2018, 48, 412–419. [Google Scholar] [CrossRef]
- Selkoe, K.A.; Toonen, R.J. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecol. Lett. 2006, 9, 615–629. [Google Scholar] [CrossRef]
- Putman, A.I.; Carbone, I. Challenges in analysis and interpretation of microsatellite data for population genetic studies. Ecol. Evol. 2014, 4, 4399–4428. [Google Scholar] [CrossRef]
- Kim, W.J.; Shin, E.H.; Kong, H.J.; Nam, B.H.; Kim, Y.O.; Jung, H.; An, C.M. Development of polymorphic microsatellite markers suitable for genetic linkage mapping of olive flounder, Paralichthys olivaceus. Fish. Aquat. Sci. 2013, 16, 303–309. [Google Scholar] [CrossRef]
- Ozaki, A.; Okamoto, H.; Yamada, T.; Matuyama, T.; Sakai, T.; Fuji, K.; Sakamoto, T.; Okamoto, N.; Yoshida, K.; Hatori, K.; et al. Linkage analysis of resistance to Streptococcus iniae infection in Japanese flounder (Paralichthys olivaceus). Aquaculture 2010, 308, S62–S67. [Google Scholar] [CrossRef]
- Song, W.; Pang, P.; Niu, Y.; Gao, F.; Zhao, Y.; Zhang, J.; Sun, J.; Shao, C.; Liao, X.; Wang, L.; et al. Construction of high-density genetic linkage maps and mapping of growth-related quantitative trait loci in the Japanese flounder (Paralichthys olivaceus). PLoS ONE 2012, 7, e50404. [Google Scholar]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Jamieson, A.; Taylor, C.S. Comparisons of three probability formulae for parentage exclusion. Anim. Genet. 1997, 28, 397–400. [Google Scholar] [CrossRef] [PubMed]
- Lorieux, M.; Goffinet, B.; Perrier, X.; Gonzalez de Leon, D.; Lanaud, C. Maximum-likelihood models for mapping genetic markers showing segregation distortion. 1. Backcross populations. Theor. Appl. Genet. 1995, 90, 73–80. [Google Scholar] [CrossRef]
- Dakin, E.E.; Avise, J.C. Microsatellite null alleles in parentage analysis. Heredity 2004, 93, 504–509. [Google Scholar] [CrossRef]
- Rico, C.; Cuesta, J.A.; Drake, P.; Macpherson, E.; Bernatchez, L.; Marie, A.D. Null alleles are ubiquitous at microsatellite loci in the Wedge Clam (Donax trunculus). PeerJ 2017, 5, e3188. [Google Scholar] [CrossRef]
- Jahnke, G.; Smidla, J.; Deak, T.; Olah, R.; Szoke, B.A.; Sardy, D.A.N. The SSR null allele problem, and its consequences in pedigree reconstruction and population genetic studies in viticulture. Horticulturae 2022, 8, 658. [Google Scholar] [CrossRef]
- Jones, A.G.; Stockwell, C.A.; Walker, D.; Avise, J.C. The molecular basis of a microsatellite null allele from the white sands pupfish. J. Hered. 1998, 89, 339–342. [Google Scholar] [CrossRef][Green Version]
- Castro, J.; Pino, A.; Hermida, M.; Bouza, C.; Riaza, A.; Ferreiro, I.; Sanchez, L.; Martinez, P. A microsatellite marker tool for parentage analysis in Senegal sole (Solea senegalensis): Genotyping errors, null alleles and conformance to theoretical assumptions. Aquaculture 2006, 261, 1194–1203. [Google Scholar] [CrossRef]
- Carlsson, J. Effects of microsatellite null alleles on assignment testing. J. Hered. 2008, 99, 616–623. [Google Scholar] [CrossRef] [PubMed]
- Oddou-Muratorio, S.; Vendramin, G.G.; Buiteveld, J.; Fady, B. Population estimators or progeny tests: What is the best method to assess null allele frequencies at SSR loci? Conserv. Genet. 2008, 10, 1343–1347. [Google Scholar] [CrossRef]
- Dabrowski, M.J.; Bornelov, S.; Kruczyk, M.; Baltzer, N.; Komorowski, J. ‘True’ null allele detection in microsatellite loci: A comparison of methods, assessment of difficulties and survey of possible improvements. Mol. Ecol. Resour. 2015, 15, 477–488. [Google Scholar] [CrossRef]
- Ellegren, H. Microsatellite mutations in the germline: Implications for evolutionary inference. Trends Genet. 2000, 16, 551–558. [Google Scholar] [CrossRef] [PubMed]
- Panagiotopoulou, H.; Austin, J.D.; Zalewska, K.; Gonciarz, M.; Czarnogorska, K.; Gawor, J.; Weglenski, P.; Popovic, D. Microsatellite mutation rate in Atlantic Sturgeon (Acipenser oxyrinchus). J. Hered. 2017, 108, 686–692. [Google Scholar] [CrossRef]
- Jones, A.G.; Ardren, W.R. Methods of parentage analysis in natural populations. Mol. Ecol. 2003, 12, 2511–2523. [Google Scholar] [CrossRef]
- Wang, J. Computationally efficient sibship and parentage assignment from multilocus marker data. Genetics 2012, 191, 183–194. [Google Scholar] [CrossRef] [PubMed]
- Van de Casteele, T.; Galbusera, T.; Matthysen, E. A comparison of microsatellite-based pairwise relatedness estimators. Mol. Ecol. 2001, 10, 1539–1549. [Google Scholar] [CrossRef]
- Harrison, H.B.; Saenz-Agudelo, P.; Planes, S.; Jones, G.P.; Berumen, M.L. Relative accuracy of three common methods of parentage analysis in natural populations. Mol. Ecol. 2013, 22, 1158–1170. [Google Scholar] [CrossRef]
- Sonesson, A.K.; Meuwissen, T.H.E. Testing strategies for genomic selection in aquaculture breeding programs. Genet. Sel. Evol. 2009, 41, 37. [Google Scholar] [CrossRef] [PubMed]
- Bezault, E.; Rognon, X.; Clota, F.; Gharbi, K.; Baroiller, J.F.; Chevassus, B. Analysis of the meiotic segregation in intergeneric hybrids of tilapias. Int. J. Evol. Biol. 2012, 2012, 817562. [Google Scholar] [CrossRef] [PubMed]
- Nunez, M.A.B.; Nuckolls, N.L.; Zanders, S.E. Genetic villains: Killer meiotic drivers. Trends Genet. 2018, 34, 424–433. [Google Scholar] [CrossRef]
- Larracuente, A.M.; Presgraves, D.C. The selfish segregation distorter gene complex of Drosophila melanogaster. Genetics 2012, 192, 33–53. [Google Scholar] [CrossRef] [PubMed]
- Lindholm, A.K.; Dyer, K.A.; Firman, R.C.; Fishman, L.; Forstmeier, W.; Holman, L.; Johannesson, H.; Knief, U.; Kokko, H.; Larracuente, A.M.; et al. The ecology and evolutionary dynamics of meiotic drive. Trends Ecol. Evol. 2016, 31, 315–326. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.H.; Kim, J.H.; Kim, H.C.; Noh, J.K.; Lee, J.H.; Kim, K.K. Segregation distortion at a microsatellite marker in the olive flounder, Paralichthys olivaceus. J. Environ. Biol. 2008, 29, 555–557. [Google Scholar] [PubMed]
- Palti, Y.; Shirak, A.; Cnaani, A.; Hulata, G.; Avtalion, R.R.; Ron, M. Detection of genes with deleterious alleles in an inbred line of tilapia (Oreochromis aureus). Aquaculture 2002, 206, 151–164. [Google Scholar] [CrossRef]
- Zhao, J.; Han, D.; Shi, K.; Wang, L.; Gao, J.; Yang, R. Influence of epistatic segregation distortion loci on genetic marker linkages in Japanese flounder. Genomics 2018, 110, 59–66. [Google Scholar] [CrossRef] [PubMed]





| Locus | Repeat Motif | Forward Primer | Reverse Primer |
|---|---|---|---|
| POLOC1 * | AC | CTCAGGCTCCACATCCCAACA | TCGTAATCAGCCCCCATCTCTGTA |
| POLOC2 | TG | AAGTGAGGCTCGGGAGTTTG | GTTTCTAAACAGCTCAGGTCGTCGTT |
| POLOC3 | TG | ACAGAAACACACGTTAAAGCGT | GTTTCTTCGTCTCAACAGCAGCTTGT |
| POLOC4 | TATC | AGACATCTGCCCATGTTGGT | GTTTCTCACTAACCCGTAACAGGTGCT |
| POLOC5 | TC | AGCTGACCTGAATGCACGAA | GTTTCTCTCCAGACAAGGTGGCTCAA |
| POLOC6 | CA | ATGAAAACCACCAAGAATCCC | GGCGCATTTGGTAGTTTGTT |
| POLOC7 | GT | ACTGCATGCATAACCAACAGTGTGT | GGCTGAATTATTTGGAGCAGAAGGT |
| POLOC8 | AC | TCATCCCATTAAAGCATAGCG | ATCTCACAGCATCACTTGATGG |
| POLOC9 | TGC | GTTGCAGTTCTTTGTGCAGACC | TCGATGTGCGCCAGAGGA |
| POLOC10 | GCA | GGTACAATCCTCGGCAGTGTTC | TGAAACTCAAGCTGTTGCTGG |
| POLOC11 | AGC | TGTTTGCACAGCACCATGC | TGAGGTACACACCGAGCAC |
| POLOC12 | GCA | AGATTGTAGTTCGAGGTTCGTCC | TGAATCTGCTTTCCCAAGCATG |
| POLOC13 | AGA | TGCTGCTCTACGCTCCAG | ACGTTGATGAAGTTCTTTCCGAGC |
| POLOC14 | CA | ACAATAGGATGCAGCTGCCT | AAGCGCAAATTGTTATTCCG |
| POLOC15 | CA | GAGAGACAGAAGGTCGTCAACGGTA | ACAAAGACCACGATGCAAAGTGAC |
| Type | Mother | Father | Progeny | No. of Alleles | Expected Ratio | No. of Loci Following Each Segregation Type in Each Family | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P1 | P2 | P3 | P4 | P5 | P6 | P7 | |||||||||
| Type I | AA | AA | AA | 1 | 1:0 | 2 | 1 | - | 1 | 2 | 2 | 2 | |||
| AA | BB | AB | 2 | 1:0 | - | - | - | 1 | - | 1 | - | ||||
| Type II | AA | AB | AA | AB | 2 | 1:1 | 2 | 2 | 2 | 3 | 1 | 4 | 3 | ||
| AB | AA | AA | AB | 2 | 1:1 | 1 | 1 | - | - | 2 | 1 | 2 | |||
| AB | BB | AB | BB | 2 | 1:1 | - | 1 | 1 | - | 1 | - | - | |||
| AA | BC | AB | AC | 3 | 1:1 | 2 | 1 | 2 | 1 | - | - | - | |||
| AB | CC | AC | BC | 3 | 1:1 | 1 | 3 | 1 | - | 1 | 1 | 2 | |||
| Type III | AB | AB | AA | AB | BB | 2 | 1:2:1 | 1 | - | 1 | 1 | 6 | 1 | - | |
| Type IV | AB | AC | AA | AB | AC | BC | 3 | 1:1:1:1 | 3 | 1 | 2 | 2 | 1 | 1 | 4 |
| AB | BC | AB | AC | BC | BB | 3 | 1:1:1:1 | 1 | 2 | 5 | 3 | 1 | 2 | 2 | |
| AB | CD | AC | AD | BC | BD | 4 | 1:1:1:1 | 2 | 3 | 1 | 3 | - | 2 | - | |
| Family Group | Locus (Marker) | Segregation Type | No. of Progeny Tested | Expected Genotype and Ratio | Observed Number | SDV | G-Test p | p | p |
|---|---|---|---|---|---|---|---|---|---|
| P1 | POLOC9 | Type III | 37 | 1(AA):2(Aa):1(aa) = 9.3:18.5:9.3 | 3:23:11 | 2.824 | 0.029 | 0.063 | 0.059 |
| P3 | POLOC3 | Type III | 30 | 1(AA):2(Aa):1(aa) = 7.5:15:7.5 | 15:11:4 | 5.100 | 0.011 | 0.005 | 0.006 |
| P3 | POLOC13 | Type IV | 30 | 1(AB):1(AC):1(BC):1(BB) = 7.5:7.5:7.5:7.5 | 2:9:7:12 | 2.662 | 0.040 | N/A | 0.070 |
| P4 | POLOC12 | Type III | 30 | 1(AA):2(Aa):1(aa) = 7.5:15:7.5 | 8:8:14 | 4.467 | 0.015 | 0.121 | 0.011 |
| P5 | POLOC11 | Type III | 36 | 1(AA):2(Aa):1(aa) = 9:18:9 | 4:15:17 | 5.194 | 0.008 | 0.002 | 0.006 |
| P5 | POLOC14 | Type IV | 36 | 1(AA):1(AB):1(AC):1(BC) = 9:9:9:9 | 9:6:16:5 | 3.179 | 0.053 | N/A | 0.042 |
| P6 | POLOC13 | Type IV | 34 | 1(AC):1(AD):1(BC):1(BD) = 8.5:8.5:8.5:8.5 | 13:12:4:5 | 2.921 | 0.046 | N/A | 0.054 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gwon, S.; Kim, E.; Lee, W.; Han, J.; Nam, Y. Parentage Verification and Segregation Distortion Patterns of Microsatellite Markers in Olive Flounder (Paralichthys olivaceus) Full-Sib Families. Animals 2025, 15, 176. https://doi.org/10.3390/ani15020176
Gwon S, Kim E, Lee W, Han J, Nam Y. Parentage Verification and Segregation Distortion Patterns of Microsatellite Markers in Olive Flounder (Paralichthys olivaceus) Full-Sib Families. Animals. 2025; 15(2):176. https://doi.org/10.3390/ani15020176
Chicago/Turabian StyleGwon, Songhyun, Eunjeong Kim, Wonse Lee, Jisung Han, and Yoonkwon Nam. 2025. "Parentage Verification and Segregation Distortion Patterns of Microsatellite Markers in Olive Flounder (Paralichthys olivaceus) Full-Sib Families" Animals 15, no. 2: 176. https://doi.org/10.3390/ani15020176
APA StyleGwon, S., Kim, E., Lee, W., Han, J., & Nam, Y. (2025). Parentage Verification and Segregation Distortion Patterns of Microsatellite Markers in Olive Flounder (Paralichthys olivaceus) Full-Sib Families. Animals, 15(2), 176. https://doi.org/10.3390/ani15020176

