Genome Characterization of Mammalian Orthoreovirus and Porcine Epidemic Diarrhea Virus Isolated from the Same Fattening Pig
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Cell
2.3. Detection of Viral DNA/RNA from the Samples
2.4. Virus Isolation
2.5. Electron Microscopy Assay
2.6. Amplification of the Complete Genome
2.7. Sequencing and Phylogenetic Analysis
3. Results
3.1. Virus Isolation and Identification
3.2. Sequence Analysis of MRV Isolate
3.3. Sequence Analysis of PEDV Isolate
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jiao, Z.; Liang, J.; Yang, Y.; Li, Y.; Yan, Z.; Hu, G.; Gu, C.; Hu, X.; Cheng, G.; Peng, G.; et al. Coinfection of porcine deltacoronavirus and porcine epidemic diarrhea virus altered viral tropism in gastrointestinal tract in a piglet model. Virology 2021, 558, 119–125. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.P.; Yang, Z.; Lin, W.D.; Wang, W.Y.; Yang, J.; Jin, W.J.; Qin, A.J. The rate of co-infection for piglet diarrhea viruses in China and the genetic characterization of porcine epidemic diarrhea virus and porcine kobuvirus. Acta Virol. 2016, 60, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Wang, C.; Shi, H.; Qiu, H.; Liu, S.; Chen, X.; Zhang, Z.; Feng, L. Molecular epidemiology of porcine epidemic diarrhea virus in China. Arch. Virol. 2010, 155, 1471–1476. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-J.; Kim, H.-K.; Song, D.-S.; Moon, H.-J.; Park, B.-K. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field isolates in Korea. Arch. Virol. 2011, 156, 577–585. [Google Scholar] [CrossRef]
- Duy, D.T.; Nguyen, T.T.; Puranaveja, S.; Thanawongnuwech, R. Genetic characterization of porcine epidemic diarrhea virus PEDV isolates from southern vietnam during 2009–2010 outbreaks. Thai. J. Vet. Med. 2011, 41, 55–64. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, Q.; Zhang, L.; Zhou, P.; Yang, J.; Fang, Y.; Dong, Z.; Zhao, D.; Li, W.; Feng, J.; et al. A newly isolated Chinese virulent genotype GIIb porcine epidemic diarrhea virus strain: Biological characteristics, pathogenicity and immune protective effects as an inactivated vaccine candidate. Virus Res. 2019, 259, 18–27. [Google Scholar] [CrossRef]
- Yang, D.; Su, M.J.; Li, C.Q.; Zhang, B.; Qi, S.S.; Sun, D.B.; Yin, B.S. Isolation and characterization of a variant subgroup GII-a porcine epidemic diarrhea virus strain in China. Microb. Pathog. 2020, 140, 103922. [Google Scholar] [CrossRef]
- Li, C.; Lu, H.; Geng, C.; Yang, K.; Liu, W.; Liu, Z.; Yuan, F.; Gao, T.; Wang, S.; Wen, P.; et al. Epidemic and Evolutionary Characteristics of Swine Enteric Viruses in South-Central China from 2018 to 2021. Viruses 2022, 14, 1420. [Google Scholar] [CrossRef]
- Zhao, F.; Ma, X.; Yang, J.; Wei, Z.; Li, J.; Jiang, Y.; Cui, W.; Shan, Z.; Tang, L. Investigation of Transmission and Evolution of PEDV Variants and Co-Infections in Northeast China from 2011 to 2022. Animals 2024, 14, 2168. [Google Scholar] [CrossRef]
- Qin, P.; Li, H.; Wang, J.-W.; Wang, B.; Xie, R.-H.; Xu, H.; Zhao, L.-Y.; Li, L.; Pan, Y.; Song, Y.; et al. Genetic and pathogenic characterization of a novel reassortant mammalian orthoreovirus 3 (MRV3) from a diarrheic piglet and seroepidemiological survey of MRV3 in diarrheic pigs from east China. Vet. Microbiol. 2017, 208, 126–136. [Google Scholar] [CrossRef]
- Li, W.; Li, H.; Liu, Y.; Pan, Y.; Deng, F.; Song, Y.; Tang, X.; He, Q. New Variants of Porcine Epidemic Diarrhea Virus, China, 2011. Emerg. Infect. Dis. 2012, 18, 1350–1353. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Yang, Y.; Zhao, J.; Geng, N.; Liu, K.; Zhao, Y.; Wang, F.; Liu, S.; Li, N.; Meng, F.; et al. Molecular epidemiological survey of porcine epidemic diarrhea in some areas of Shandong and genetic evolutionary analysis of S gene. Front. Vet. Sci. 2022, 9, 1015717. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Wang, G.; Liu, X.; Wu, W.; Yu, T.; Zhang, W.; Liu, X.; Cheng, G.; Wei, L.; Ni, L.; et al. Establishment and application of a quadruplex real-time RT-qPCR assay for differentiation of TGEV, PEDV, PDCoV, and PoRVA. Microb. Pathog. 2024, 191, 106646. [Google Scholar] [CrossRef] [PubMed]
- Hou, W.; Fan, M.; Zhu, Z.; Li, X. Establishment and Application of a Triplex Real-Time RT-PCR Assay for Differentiation of PEDV, PoRV, and PDCoV. Viruses 2023, 15, 1238. [Google Scholar] [CrossRef]
- Narvaez, S.A.; Harrell, T.L.; Oluwayinka, O.; Sellers, H.S.; Khalid, Z.; Hauck, R.; Chowdhury, E.U.; Conrad, S.J. Optimizing the Conditions for Whole-Genome Sequencing of Avian Reoviruses. Viruses 2023, 15, 1938. [Google Scholar] [CrossRef]
- Cui, T. Isolation and Identification of Porcine Rotavirus Sichuan Strain. Master’s Thesis, Sichuan Agricultural University, Yaan, China, 2014. [Google Scholar]
- Qiao, P. Detection, Isolation and Identification of Porcine Rotavirus Infection in Some Areas of China from 2015 to 2016. Master’s Thesis, Heilongjiang Bayi Agricultural University, Daqing, China, 2019. [Google Scholar]
- Li, Y. Isolation and Identification of Pseudorabies Virus and Molecular Characterization of Its Main Virlunce Genes in Anhui. Master’s Thesis, Anhui Agricultural University, Hefei, China, 2019. [Google Scholar]
- Yuan, D.; Yan, Z.; Li, M.; Wang, Y.; Su, M.; Sun, D. Isolation and Characterization of a Porcine Transmissible Gastroenteritis Coronavirus in Northeast China. Front. Vet. Sci. 2021, 8, 611721. [Google Scholar] [CrossRef]
- Xin, S. Isolation, Identification and Genetic EvolutionAnalysis of PEDV from Hebei Province. Master’s Thesis, Hebei Normal University of Science & Technology, Qinhuangdao, China, 2019. [Google Scholar]
- Yu, J.M.; Xu, Z.Q.; Li, B.W.; Zhang, Q.; Cui, S.X.; Jin, M.; Duan, Z.J. Analysis and characterization of the complete genome of a member of a new species of kobuvirus associated with swine. Arch. Virol. 2011, 156, 747–751. [Google Scholar] [CrossRef]
- Luo, Y.Y.; Fei, L.; Yue, H.; Li, S.Y.; Ma, H.Q.; Tang, C. Prevalence and genomic characteristics of a novel reassortment mammalian orthoreovirus type 2 in diarrhea piglets in Sichuan, China. Infect. Genet. Evol. 2020, 85, 104420. [Google Scholar] [CrossRef]
- Pérez, M.J.; Rodríguez, L.A.; Nieto, T.P. The acetylcholinesterase ichthyotoxin is a common component in the extracellular products of Vibrionaceae strains. J. Appl. Microbiol. 1998, 84, 47–52. [Google Scholar] [CrossRef]
- Kumar, S.; Tamura, K.; Nei, M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 2004, 5, 150–163. [Google Scholar] [CrossRef]
- Zhu, T.J.; Du, S.S.; Gao, D.M.; Pei, Z.H.; Guo, Y.B.; Shao, H.Z.; Wang, H.J.; Wang, K.; Hu, G.X. Isolation and identification of a variant subtype G 2b porcine epidemic diarrhea virus and S gene sequence characteristic. Infect. Genet. Evol. 2019, 71, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Chappell, J.D.; Gunn, V.L.; Wetzel, J.D.; Baer, G.S.; Dermody, T.S. Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1. J. Virol. 1997, 71, 1834–1841. [Google Scholar] [CrossRef] [PubMed]
- Zheng, D.; Wang, X.; Ju, N.; Wang, Z.; Sui, L.; Wang, L.; Qiao, X.; Cui, W.; Jiang, Y.; Zhou, H.; et al. Immune Responses in Pregnant Sows Induced by Recombinant Lactobacillus johnsonii Expressing the COE Protein of Porcine Epidemic Diarrhea Virus Provide Protection for Piglets against PEDV Infection. Viruses 2021, 14, 7. [Google Scholar] [CrossRef] [PubMed]
- Subramaniam, S.; Yugo, D.M.; Heffron, C.L.; Rogers, A.J.; Sooryanarain, H.; LeRoith, T.; Overend, C.; Cao, D.; Meng, X.J. Vaccination of sows with a dendritic cell-targeted porcine epidemic diarrhea virus S1 protein-based candidate vaccine reduced viral shedding but exacerbated gross pathological lesions in suckling neonatal piglets. J. Gen. Virol. 2018, 99, 230–239. [Google Scholar] [CrossRef] [PubMed]
- Li, C.H.; Li, W.T.; de Esesarte, E.L.; Guo, H.B.; van den Elzen, P.; Aarts, E.; van den Born, E.; Rottier, P.J.M.; Bosch, B.J. Cell Attachment Domains of the Porcine Epidemic Diarrhea Virus Spike Protein Are Key Targets of Neutralizing Antibodies. J. Virol. 2017, 91, e00273-17. [Google Scholar] [CrossRef]
- Okda, F.A.; Lawson, S.; Singrey, A.; Nelson, J.; Hain, K.S.; Joshi, L.R.; Christopher-Hennings, J.; Nelson, E.A.; Diel, D.G. The S2 glycoprotein subunit of porcine epidemic diarrhea virus contains immunodominant neutralizing epitopes. Virology 2017, 509, 185–194. [Google Scholar] [CrossRef]
- Ye, D.; Ji, Z.; Shi, H.; Chen, J.; Shi, D.; Cao, L.; Liu, J.; Li, M.; Dong, H.; Jing, Z.; et al. Molecular characterization of an emerging reassortant mammalian orthoreovirus in China. Arch. Virol. 2020, 165, 2367–2372. [Google Scholar] [CrossRef]
- Yan, X.; Sheng, J.; Zhang, C.; Li, N.; Yi, L.; Zhao, Z.; Feng, Y.; Tu, C.; He, B. Detection and Characterization of a Reassortant Mammalian Orthoreovirus Isolated from Bats in Xinjiang, China. Viruses 2022, 14, 1897. [Google Scholar] [CrossRef]
- Yamamoto, S.P.; Motooka, D.; Egawa, K.; Kaida, A.; Hirai, Y.; Kubo, H.; Motomura, K.; Nakamura, S.; Iritani, N. Novel human reovirus isolated from children and its long-term circulation with reassortments. Sci. Rep. 2020, 10, 963. [Google Scholar] [CrossRef]
- Cavicchio, L.; Tassoni, L.; Zamperin, G.; Campalto, M.; Carrino, M.; Leopardi, S.; Benedictis, P.; Beato, M.S. Unexpected Genetic Diversity of Two Novel Swine MRVs in Italy. Viruses 2020, 12, 574. [Google Scholar] [CrossRef]
- Fukase, Y.; Minami, F.; Masuda, T.; Oi, T.; Takemae, H.; Ishida, H.; Murakami, H.; Aihara, N.; Shiga, T.; Kamiie, J.; et al. Genetic diversity, reassortment, and recombination of mammalian orthoreoviruses from Japanese porcine fecal samples. Arch. Virol. 2022, 167, 2643–2652. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Zhang, J.; Deng, X.; Ye, Y.; Liao, M.; Fan, H. Complete Genome Sequence of a Highly Prevalent Isolate of Porcine Epidemic Diarrhea Virus in South China. J. Virol. 2012, 86, 9551. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, H.; Sun, L.; Wang, X.; Xiao, M.; Zeng, L.; Wang, H.; Yang, H.; Lin, F.; Wang, C.; Qin, L.; et al. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus strains circulating in China from 2020 to 2021. BMC Vet. Res. 2022, 18, 392. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Tian, L.; Liu, Y.; Sun, Y.; Li, Z.; Cai, X.; Meng, Q.; Qiao, J. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus in Xinjiang, China, from 2020 to 2022. Arch. Virol. 2024, 169, 96. [Google Scholar] [CrossRef]
- Lin, F.; Zhang, H.; Li, L.; Yang, Y.; Zou, X.; Chen, J.; Tang, X. PEDV: Insights and Advances into Types, Function, Structure, and Receptor Recognition. Viruses 2022, 14, 1744. [Google Scholar] [CrossRef]
- Guo, Y.; Sui, L.; Kong, D.; Liu, D.; Gao, Y.; Jiang, Y.; Cui, W.; Li, J.; Li, Y.; Wang, L. Porcine epidemic diarrhea virus strain CH/HLJ/18 isolated in China: Characterization and phylogenetic analysis. Virol. J. 2024, 21, 28. [Google Scholar] [CrossRef]
- Shi, W.; Jia, S.; Zhao, H.; Yin, J.; Wang, X.; Yu, M.; Ma, S.; Wu, Y.; Chen, Y.; Fan, W.; et al. Novel Approach for Isolation and Identification of Porcine Epidemic Diarrhea Virus (PEDV) Strain NJ Using Porcine Intestinal Epithelial Cells. Viruses 2017, 9, 19. [Google Scholar] [CrossRef]
- Kusanagi, K.; Kuwahara, H.; Katoh, T.; Nunoya, T.; Ishikawa, Y.; Samejima, T.; Tajima, M. Isolation and serial propagation of porcine epidemic diarrhea virus in cell cultures and partial characterization of the isolate. J. Vet. Med. Sci. 1992, 54, 313–318. [Google Scholar] [CrossRef]
- Hofmann, M.; Wyler, R. Propagation of the virus of porcine epidemic diarrhea in cell culture. J. Clin. Microbiol. 1988, 26, 2235–2239. [Google Scholar] [CrossRef]
- Sun, D.B.; Feng, L.; Shi, H.Y.; Chen, J.F.; Cui, X.C.; Chen, H.Y.; Liu, S.W.; Tong, Y.E.; Wang, Y.F.; Tong, G.Z. Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet. Microbiol. 2008, 131, 73–81. [Google Scholar] [CrossRef]
- Park, S.; Kim, S.; Song, D.; Park, B. Novel Porcine Epidemic Diarrhea Virus Variant with Large Genomic Deletion, South Korea. Emerg. Infect. Dis. 2014, 20, 2089–2092. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.M.; Saif, L.J.; Marthaler, D.; Wang, Q.H. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016, 226, 20–39. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.B.; Pan, Y.F.; Wang, D.D.; Tian, X.Y.; Song, Y.H.; Cao, Y.C. Identification and pathogenicity of a variant porcine epidemic diarrhea virus field strain with reduced virulence. Virol. J. 2015, 12, 88. [Google Scholar] [CrossRef]
Primer | Sequence (5′–3′) | Size (bp) |
---|---|---|
PDCoV F | 5′-TTTCAGGTGCTCAAAGCTCA-3′ | 447 [16] |
PDCoV R | 5′-GTTAACAGATTGAGATCTTGG-3′ | |
PoRVA-F | 5′-GGCTTTAAAAGAGAGAAT-3′ | 1067 [17] |
PoRVA-R | 5′-GGTCACATCATACAATTC-3′ | |
PRV-F | 5′-CCGTGTTCTTTGTGGCGGTG-3′ | 421 [18] |
PRV-R | 5′-ACCTCCTCGCCGAAGGCGTCGAAG-3′ | |
TGEV-F | 5′-CTTGGTAGTGGTGCTA-3′ | 529 [19] |
TGEV-R | 5′-CTATCTGGTCGCCATCTTC-3′ | |
PEDV-F | 5′-TTGCAAGTGGCGCTGTGATT-3′ | |
PEDV-R1 | 5′-GCCGACAACAATATCTTTTCCA-3′ | 747 [20] |
PEDV-R2 | 5′-GACACCCTGGTTTTCACCAA-3′ | 442 |
PKV-F | 5′-TGGACGACCAGCTCTTCCTTAAACAC-3′ | 495 [21] |
PKV-R | 5′-AGTGCAAGTGCAAGTCTGGGTTGCAGCC-3′ | |
MRV-S1-F | 5′-GGGTCAACGCGTCGATGC-3′ | 1087 |
MRV-S1-R | 5′-TCAACCGAGACAGGGATA-3′ |
Primer Pairs | Upstream Primer (5′–3′) | Downstream Primer (5′–3′) | Location, bp |
---|---|---|---|
PEDV-1 | ATGTGGACACTTTTGGTA | ACTCAAAACCTGACATCGTG | 513–2406 |
PEDV-2 | ACATTACGGCCCATGAAC | AAGGAACACTAAAAATTC | 2330–4538 |
PEDV-3 | CAGAAGTGCTCAAATGAT | ATTACCAACTTCAATTGC | 4322–7060 |
PEDV-4 | GCCTTAAGCGCGTTCCTG | ACGTGTCGTTGTGATTAG | 6885–9240 |
PEDV-5 | TATTCAGGCAGTGCTTCA | GCCTTACCTTCTCCAACTATG | 9150–11,947 |
PEDV-6 | CTGAGTCCCTGTCATGGC | AAACTTAGTAGTACCAAT | 11,808–14,340 |
PEDV-7 | ATAAGTGGCAAAGAACGT | CATACGGCTGGCAACATA | 14,217–16,950 |
PEDV-8 | CAGATAGCAAGCAGTGTT | CCACATTTTACAATCGAC | 16,770–19,673 |
PEDV-9 | CTAGTAATGATAGCACGT | AGGTTTGTAGAGGAAATG | 19,498–22,090 |
PEDV-10 | ACGTTTCTGGTTTTTGGA | ATGCAGCAGAACACTAGT | 21,933–24,678 |
PEDV-11 | CAGAGTCTCTCCGTAATA | ATTCTGAATTACCGCG | 24,498–26,905 |
PEDV-12 | ACCCACTAACTTGGGTGT | TTTTTTTTTGTGTATCCA | 26,690–28,043 |
MRV2-SD/2020 | Strain | Similarity (nt/aa) % | Serotype | Host | Country | GenBank |
---|---|---|---|---|---|---|
L1 | CH/GX/PReoV/ 2435/2018 | 92.32/88.4 | MRV-2 | pig | CHN | MZ298655 |
L2 | SHR-A | 95.08/97.8 | MRV-1 | pig | CHN | JX415467 |
L3 | 96 RNA | 97.83/99.2 | MRV-2 | pig | Japan | LC533916 |
M1 | 96 RNA | 97/98 | MRV-2 | pig | Japan | LC533917 |
M2 | GXLB0237 | 97/98.6 | MRV-3 | pig | CHN | PP228850 |
M3 | 117 | 98/98 | MRV-2 | pig | Japan | LC533929 |
S1 | 117 | 90.6/91.5 | MRV-2 | pig | Japan | LC533930 |
S2 | 117 | 97.96/99.1 | MRV-2 | pig | Japan | LC533931 |
S3 | Osaka1994 | 97.73/99.2 | MRV-2 | human | Japan | LC476903 |
S4 | 117 | 96.81/98.2 | MRV-2 | pig | Japan | LC533933 |
Strains | Accession Number | Amino Acid Residues | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
73 | 82 | 191 | 200 | 218 | 274 | 302 | 347 | 440 | ||
302Ⅰ | EU049603 | N | I | N | Q | G | L | F | V | T |
302Ⅱ | EU049604 | N | I | N | Q | G | L | F | V | T |
TRALAU2004 | JX204737 | N | I | N | Q | R | L | F | V | T |
RpMRV-YN2012 | KM087111 | N | I | N | Q | G | L | F | V | T |
MRV-2 | LC121909 | N | I | N | Q | G | L | F | V | T |
WIV7 | KT444538 | N | I | N | Q | G | L | F | V | T |
Tou5 | GU196315 | N | I | N | Q | G | L | F | V | T |
WIV3 | KT444578 | S | I | N | Q | G | L | F | V | T |
CMR-HP | MH933775 | N | I | N | R | G | L | F | V | T |
Osala | LC476901 | N | I | N | Q | G | L | F | V | T |
WIV5 | KT444548 | N | I | N | Q | G | L | F | V | T |
SI-MRV05 | MG457114 | N | I | N | Q | G | L | F | V | T |
47Ma06 | KX384852 | N | I | N | Q | G | L | F | V | T |
66848 | MN233092 | N | I | N | R | G | L | P | V | T |
PReov/2435 | MZ298661 | N | I | N | Q | G | L | T | V | T |
96 | LC533920 | N | I | N | Q | G | L | T | V | T |
117 | LC533930 | N | I | N | Q | G | L | A | V | T |
BYD1 | DQ312301 | N | I | N | Q | G | L | F | V | T |
BYL | EU049606 | N | I | N | Q | G | L | F | V | T |
729 | JN799419 | N | I | N | Q | G | S | Y | V | T |
T2Neth84 | AY862138 | N | I | N | Q | G | S | Y | V | T |
SI-MRV07 | MG999582 | N | L | T | T | G | L | F | V | T |
MRV2-SD/2020 | PP951616 | D | V | D | K | S | I | L | I | M |
Strain Name | Countries | Genotype (%) | Time | Accession No. | Full Length |
---|---|---|---|---|---|
SM98 | South Korea | G1 96.4 | 1998 | GU937797.1 | 27,994 |
SD-M | China | G1 97 | 2012 | JX560761.1 | 27,953 |
CH-S | China | G1 97.1 | 1986 | JN547228.1 | 28,026 |
JS2008 | China | G1 97.1 | 2008 | KC109141.1 | 27,953 |
CV777 | Switzerland | G1 96.6 | 1978 | AF252511.1 | 28,033 |
KC189944.1 | China | G1 96.9 | 2012 | KC189944.1 | 27,953 |
LZC | China | G1 96.4 | 2006 | EF185992.1 | 28,042 |
Virulent DR13 | South Korea | G1 97.4 | 1999 | JQ023161.1 | 28,029 |
JSX-2014 | China | G2a 98.9 | 2014 | MH056658.1 | 28,015 |
CH-ZMDZY-11 | China | G2a 98.9 | 2011 | KC196276.1 | 28,038 |
CH-FJZZ-9-2012 | China | G2a 98.6 | 2012 | KC140102.1 | 28,038 |
BJ-2011 | China | G2a 98.9 | 2011 | JN825712.1 | 28,038 |
IA1 | USA | G2a 99 | 2013 | KF468753.1 | 28,038 |
GD-A | China | G2b 98 | 2012 | JX112709.1 | 28,035 |
USA-IA-2013-49379 | USA | G2b 98.9 | 2013 | KM975736.1 | 28,038 |
HBQHD1 | China | G2b 98.7 | 2018 | MK606368.1 | 28,038 |
CH-GDGZ-9-2012 | China | G2b 97.7 | 2013 | KF384500.1 | 28,035 |
AJ1102 | China | G2b 98.4 | 2011 | JX188454.1 | 28,044 |
JS-A | China | G2b 97.9 | 2019 | MH748550.1 | 28,045 |
ZJCZ4 | China | G2b 98 | 2011 | JX524137.1 | 28,038 |
IT-A | Italy | S-INDEL 98.5 | 2017 | KY111278.1 | 28,041 |
OH851 | USA | S-INDEL 98.7 | 2014 | KJ399978.1 | 28,029 |
GER-L00933-K22 | Germany | S-INDEL 98.7 | 2018 | LT898446.1 | 28,029 |
USA-2014IL-20697 | USA | S-INDEL 98.6 | 2017 | KT591944.1 | 28,025 |
FR-001-2014 | France | S-INDEL 98.7 | 2014 | KR011756.1 | 28,024 |
ZL29 | China | S-INDEL 98.6 | 2016 | KU847996.1 | 27,989 |
Strains | Accession Number | Amino Acid Residues | Genotype | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
517 | 521 | 523 | 527 | 549 | 594 | 605 | 612 | 635 | 663 | 766 | 966 | |||
GD-A | JX112709.1 | A | H | G | I | S | S | E | F | V | S | S | L | G2b |
GDGZ | KF384500 | A | H | G | I | S | S | E | F | V | S | S | L | G2b |
AJ1102 | JX188454.1 | A | H | G | I | S | S | E | F | V | S | S | L | G2b |
ZJCZ4 | JX524137.1 | A | H | G | I | S | S | E | F | V | S | S | L | G2b |
HBQHD1 | MK606368.1 | S | S | G | I | S | S | E | F | V | S | S | L | G2b |
IA | KM975736.1 | S | H | G | I | S | S | E | F | V | S | S | L | G2b |
JS-A | MH748550.1 | A | H | G | I | S | S | E | F | V | S | S | L | G2b |
FJZZ | KC140102.1 | A | H | G | I | S | S | E | F | V | S | S | L | G2a |
JSX2014 | MH056658.1 | S | H | G | I | S | S | E | F | V | S | S | L | G2a |
ZMDZY | KC196276.1 | S | R | G | T | S | S | E | F | V | S | S | L | G2a |
IAI | KF468753.1 | S | H | G | I | S | S | E | F | V | S | S | L | G2a |
BJ-2011 | JN825712.1 | S | L | G | I | S | S | E | F | V | S | S | L | G2a |
CV777 | AF252511.1 | A | L | S | V | T | G | A | L | I | S | Y | L | G1 |
PEDV-SD/2020 | PP958821 | S | H | G | I | S | S | E | F | V | T | S | M | G2a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Zhao, J.; Li, J.; Xiri, Y.; Liu, Z.; Zhao, Q.; Sun, Y. Genome Characterization of Mammalian Orthoreovirus and Porcine Epidemic Diarrhea Virus Isolated from the Same Fattening Pig. Animals 2025, 15, 156. https://doi.org/10.3390/ani15020156
Li X, Zhao J, Li J, Xiri Y, Liu Z, Zhao Q, Sun Y. Genome Characterization of Mammalian Orthoreovirus and Porcine Epidemic Diarrhea Virus Isolated from the Same Fattening Pig. Animals. 2025; 15(2):156. https://doi.org/10.3390/ani15020156
Chicago/Turabian StyleLi, Xiaoxuan, Jiakai Zhao, Jingjie Li, Yangzong Xiri, Zhixiang Liu, Qin Zhao, and Yani Sun. 2025. "Genome Characterization of Mammalian Orthoreovirus and Porcine Epidemic Diarrhea Virus Isolated from the Same Fattening Pig" Animals 15, no. 2: 156. https://doi.org/10.3390/ani15020156
APA StyleLi, X., Zhao, J., Li, J., Xiri, Y., Liu, Z., Zhao, Q., & Sun, Y. (2025). Genome Characterization of Mammalian Orthoreovirus and Porcine Epidemic Diarrhea Virus Isolated from the Same Fattening Pig. Animals, 15(2), 156. https://doi.org/10.3390/ani15020156