Impact of Ultraviolet Radiation on Skin and Blood Melanin Traits in Xichou Black-Boned Chicken: A Transcriptomic and Metabolomic Study
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Grouping
2.2. Measurement of Growth Performance
2.3. Melanin Content Measurement
2.4. Determination of Melanin Content in Blood
2.5. Slaughter and Tissue Sample Collection
2.6. Extraction of Total RNA from Pectoral Skin Tissue and Transcriptome Sequencing
2.7. Validation of Target Gene Expression by RT-qPCR
2.8. Metabolite Sample Processing and LC-MS Analysis
2.9. Transcriptomic and Metabolomic Data Analysis and Integrated Analysis
2.9.1. Transcriptomic Data Analysis
2.9.2. Metabolomic Data Analysis
2.9.3. Integrated Analysis
3. Results
3.1. Growth Performance, Blood Melanin Content, and Melanin Degree of Xichou Black-Boned Chickens
3.1.1. Effects of UV Exposure Duration on Growth Performance and Survival Rate
3.1.2. Melanin Content in Blood at 45 Days of Age
3.1.3. Measurement Results of Skin Hue (L Value) in Breast and Leg at 22 and 45 Days of Age
3.2. Transcriptomic Results and Analysis
3.2.1. Screening of Differentially Expressed Genes in the Chest Skin Tissue of Xichou Black-Boned Chickens
3.2.2. GO Enrichment Analysis of Differentially Expressed Genes in the Chest Skin Tissue of Xichou Black-Boned Chickens
3.2.3. KEGG Enrichment Analysis of Differentially Expressed Genes in the Chest Skin Tissue of Xichou Black-Boned Chickens
3.2.4. Validation of Candidate Gene Expression by Fluorescence Quantitative PCR
3.3. Metabolomic Results
3.3.1. Results of Differential Metabolite Screening
3.3.2. Pathway Enrichment Analysis of Differential Metabolites
3.4. Joint Analysis of Transcriptome and Metabolome
3.4.1. Correlation Coefficient Matrix Heatmap and Hierarchical Clustering Heatmap
3.4.2. Enrichment Analysis of Signaling Pathways for Differential Genes and Metabolites
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, Y.; Wang, S.F.; Chen, T.L.; Li, Z.X. Research Status of Solar Ultraviolet Radiation and Its Biological Effects on the Qinghai-Tibet Plateau. Sci. Technol. Eng. 2022, 22, 1321–1328. [Google Scholar]
- He, Q.Y.; Li, W.Q.; Li, Y.T.; Hang, X. Photo-toxicity effects and mechanisms of ultraviolet radiation on human skin. Asian J. Ecotoxicol. 2024, 19, 55–74. [Google Scholar]
- D’Orazio, J.; Jarrett, S.; Amaro-Ortiz, A.; Scott, T. Ultraviolet radiation and the skin. Int. J. Mol. Sci. 2013, 14, 12222–12248. [Google Scholar] [CrossRef] [PubMed]
- Nishigori, C.; Yamano, N.; Kunisada, M.; Nishiaki-Sawada, A.; Ohashi, H.; Igarashi, T. Biological impact of shorter wavelength ultraviolet radiation-C. Photochem. Photobiol. 2023, 99, 335–343. [Google Scholar] [CrossRef]
- Morganroth, P.A.; Lim, H.W.; Burnett, C.T. Ultraviolet radiation and the skin: An in-depth review. Am. J. Lifestyle Med. 2013, 7, 168–181. [Google Scholar] [CrossRef]
- Lai, J.H.; Yang, Y.; Lu, S.X.; Wang, X.X.; Chen, Q.; Wang, S.; Li, M.L. Effects of Ultraviolet and Green Light Illuminations During Incubation on Embryo and Post-Hatch Growth in Chahua Chickens. Chin. Poult. 2024, 46, 67–72. [Google Scholar]
- Li, M.L.; Dong, X.X.; Gu, Z.B.; Lan, G.X.; Wang, X.W. Effects of medium wavelength ultraviolet radiation on quail growth and development. Anim. Husb. Vet. Med. 2015, 40, 62–65. [Google Scholar]
- Li, M.L.; Wang, Y.; Li, Y.Y.; Cheng, G. Preliminary Study on the Effects of Ultraviolet Radiation on Egg-laying Performances of Quail. J. Anim. Husb. Vet. Med. 2009, 28, 16–18. [Google Scholar]
- Li, M.; Gao, Y.; Lan, G.; Gu, Z. Effects of ultraviolet-B radiation on immunity and carcass characteristics in quail. J. Appl. Poult. Res. 2014, 23, 429–436. [Google Scholar] [CrossRef]
- Cordero, R.J.B.; Casadevall, A. Melanin. Curr. Biol. 2020, 30, R142–R143. [Google Scholar] [CrossRef]
- Bento-Lopes, L.; Cabaço, L.C.; Charneca, J.; Neto, M.V.; Seabra, M.C.; Barral, D.C. Melanin’s journey from melanocytes to keratinocytes: Uncovering the molecular mechanisms of melanin transfer and processing. Int. J. Mol. Sci. 2023, 24, 11289. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.Y.; Guo, Y.; Wu, W.J.; Man, M.Q.; Tu, Y.; He, L. UVB-induced secretion of IL-1β promotes melanogenesis by upregulating TYR/TRP-1 expression in vitro. BioMed Res. Int. 2022, 2022, 8230646. [Google Scholar] [CrossRef] [PubMed]
- Enkhtaivan, E.; Kim, H.J.; Kim, B.; Byun, H.J.; Yu, L.; Nguyen, T.M.; Nguyen, T.H.; Do, P.A.; Kim, E.J.; Kim, K.S.; et al. Loss of EMP2 inhibits melanogenesis of MNT1 melanoma cells via regulation of TRP-2. Biomol. Ther. 2022, 30, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.; Lee, S.Y.; Park, J.Y.; Jung, S.; Jo, C.; Nam, K.C. Comparison of Functional Compounds and Micronutrients of Chicken Breast Meat by Breeds. Food Sci Anim Resour. 2019, 39, 632–642. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Chumngoen, W.; Tan, F.J. Relationships between Descriptive Sensory Attributes and Physicochemical Analysis of Broiler and Taiwan Native Chicken Breast Meat. Asian-Australas. J. Anim. Sci. 2015, 28, 1028–1037. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Tu, Y.J.; Luan, D.Q.; Shan, Y.J.; Ju, X.; Liu, Y.; Ji, G.; Zhang, M.; Zou, J.; Shu, T. Differential Analysis of Volatile Organic Compounds in Muscle of Three Black Bone Chicken Breeds. Livest. Ecol. 2023, 44, 36–41. [Google Scholar]
- Yang, C.H.; Liang, S.M.; Ge, C.R.; Xiao, Z. Extraction and identification of umami peptides in Silkie chicken meat. Chin. Condiments 2024, 49, 10–15+46. [Google Scholar]
- Huang, D.P.; Li, D.P.; Yuan, F.; Lin, C.; Li, H.; Su, S. Genetic Diversity of Mitochondrial DNA D-loop Region of Xichou Black-bone Chicken. J. Yunnan Agric. Univ. 2010, 25, 373–376. [Google Scholar] [CrossRef]
- Kang, J.J. Establishment of Evaluation Criteria for Black Character of Xichou Black-Bone Chicken and Study on Transcriptome of Chicken Comb Black Degree. Master’s Thesis, Yunnan Agricultural University, Kunming, China, 2023. [Google Scholar] [CrossRef]
- Yang, Y.; Xu, W.; Hou, P.; Liu, G.; Liu, W.; Wang, Y.; Zhao, R.; Ming, B.; Xie, R.; Wang, K.; et al. Improving maize grain yield by matching maize growth and solar radiation. Sci. Rep. 2019, 9, 3635. [Google Scholar] [CrossRef]
- Rai, N.; Morales, L.O.; Aphalo, P.J. Perception of solar UV radiation by plants: Photoreceptors and mechanisms. Plant Physiol. 2021, 186, 1382–1396. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Thévenot, E.A.; Roux, A.; Xu, Y.; Ezan, E.; Junot, C. Analysis of the human adult urinary metabolome variations with age, body mass index, and gender by implementing a comprehensive workflow for univariate and OPLS statistical analyses. J. Proteome Res. 2015, 14, 3322–3335. [Google Scholar] [CrossRef] [PubMed]
- An, B.Y.; Chen, M.S. Effects of ultraviolet radiation on livestock and poultry in animal husbandry production. Chin. Poult. Breed. 2018, 14, 38. [Google Scholar]
- Wang, H.G.; Shi, B.L.; Shi, G.H. Effects of ultraviolet radiation on growth performance and skeletal development in broiler chickens. Chin. J. Anim. Husb. 2010, 46, 58–60. [Google Scholar]
- Gromkowska-Kepka, K.J.; Puścion-Jakubik, A.; Markiewicz-Zukowska, R.; Socha, K. The impact of ultraviolet radiation on skin photoaging—Review of in vitro studies. J. Cosmet. Dermatol. 2021, 20, 3427–3431. [Google Scholar] [CrossRef]
- Salminen, A.; Kaarniranta, K.; Kauppinen, A. Photoaging: UV radiation-induced inflammation and immunosuppression accelerate the aging process in the skin. Inflamm. Res. 2022, 71, 817–831. [Google Scholar] [CrossRef]
- Vats, K.; Kruglov, O.; Mizes, A.; Samovich, S.N.; Amoscato, A.A.; Tyurin, V.A.; Tyurina, Y.Y.; Kagan, V.E.; Bunimovich, Y.L. Keratinocyte death by ferroptosis initiates skin inflammation after UVB exposure. Redox Biol. 2021, 47, 102143. [Google Scholar] [CrossRef]
- Teng, Y.; Yu, Y.; Li, S.; Huang, Y.; Xu, D.; Tao, X.; Fan, Y. Ultraviolet radiation and basal cell carcinoma: An environmental perspective. Front. Public Health 2021, 9, 666528. [Google Scholar] [CrossRef]
- Vergneau-Grosset, C.; Péron, F. Effect of ultraviolet radiation on vertebrate animals: Update from ethological and medical perspectives. Photochem. Photobiol. Sci. 2020, 19, 752–762. [Google Scholar] [CrossRef]
- Shin, J.; Lee, H.; Kim, H. Association between exposure to ambient air pollution and age-related cataract: A nationwide population-based retrospective cohort study. Int. J. Environ. Res. Public Health 2020, 17, 9231. [Google Scholar] [CrossRef]
- Wang, J.; Li, Q.M. Epidemiology and clinical analysis of macular phototoxic injury. Chin. J. Laser Med. 2021, 30, 48. [Google Scholar]
- Saßmannshausen, M.; Ach, T. Impact of ultraviolet radiation on the retina. Ophthalmologe 2022, 119, 240–247. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.Y. A preliminary study on the inhibitory effect of transcriptionfactor PBX1 on UVB-induced melanogenesis inmelanocytes and its mechanisms. Master’s Thesis, Jilin University, Changchun, China, 2024. [Google Scholar]
- Tu, Y.J.; Luan, D.Q.; Zhang, M.; Ju, X.; Liu, Y.; Shan, Y.; Ji, G.; Zou, J.; Shu, T.; Zhao, W. Genotyping of ALDH7A1 and EDNRB2 Genes and Their Association with Skin Blackness in Black-bone Chickens. Chin. J. Anim. Husb. Vet. Med. 2024, 51, 2923–2932. [Google Scholar] [CrossRef]
- Pan, K.; Li, G.H.; Zhu, N.H.; Qu, M.; Song, X. Comparative determination of melanin content in Taihe Silkie chickens at different growth stages. Feed Ind. 2011, 32, 15–17. [Google Scholar]
- Zi, X.; Ge, X.; Zhu, Y.; Liu, Y.; Sun, D.; Li, Z.; Liu, M.; You, Z.; Wang, B.; Kang, J.; et al. Transcriptome Profile Analysis Identifies Candidate Genes for the Melanin Pigmentation of Skin in Tengchong Snow Chickens. Vet. Sci. 2023, 10, 341. [Google Scholar] [CrossRef]
- Pan, X.H.; Chen, Z.L.; Huang, L.N. Melanocytes and melanin synthesis and regulation. Adv. Physiol. Sci. 1998, 2, 85–87. [Google Scholar]
- Ando, H.; Funasaka, Y.; Oka, M.; Ohashi, A.; Furumura, M.; Matsunaga, J.; Matsunaga, N.; Hearing, V.J.; Ichihashi, M. Possible involvement of proteolytic degradation of tyrosinase in the regulatory effect of fatty acids on melanogenesis. J. Lipid Res. 1999, 40, 1312–1316. [Google Scholar] [CrossRef]
- Shan, T.Z.; Wang, Y.Z.; Li, M. Cloning of Lipoprotein Lipase(LPL)Gene of Swine and the Difference of LPL Gene Expression at Different Avoirdupois Stages. J. Agric. Biotechnol. 2006, 14, 151–155. [Google Scholar]
- Li, X.M. Identification of LPL Gene Enhancer and itsFunction in Fat. Master’s Thesis, Sichuan Agricultural University, Yaan, China, 2023. [Google Scholar] [CrossRef]
- Wheless, A.; Gunn, K.H.; Neher, S.B. Macromolecular interactions of lipoprotein lipase (LPL). Subcell. Biochem. 2024, 104, 139–179. [Google Scholar] [CrossRef]
- Wu, S.A.; Kersten, S.; Qi, L. Lipoprotein lipase and its regulators: An unfolding story. Trends Endocrinol. Metab. 2021, 32, 48–61. [Google Scholar] [CrossRef]
- Wang, S.; Qiu, L.; Song, H.; Dang, N. NPS-2143 (hydrochloride) inhibits melanoma cancer cell proliferation and induces autophagy and apoptosis. Med. Sci. 2018, 34, 87–93. [Google Scholar] [CrossRef] [PubMed]
- Du, B.X. EGCG and ECG modulate apoptosis and autophagyin human melanoma cells via thePI3K/AKT/mTOR pathway. Master’s Thesis, Jiangnan University, Wuxi, China, 2022. [Google Scholar]
- Ando, H.; Watabe, H.; Valencia, J.C.; Yasumoto, K.I.; Furumura, M.; Funasaka, Y.; Oka, M.; Ichihashi, M.; Hearing, V.J. Fatty acids regulate pigmentation via proteasomal degradation of tyrosinase: A new aspect of ubiquitin-proteasome function. J. Biol. Chem. 2004, 279, 15427–15433. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y. Study the efficiency of the α-linolenic acidabsorption and bioconversion into long chainpolyunsaturated fatty acids in vivo and in vitro. Master’s Thesis, Jiangnan University, Wuxi, China, 2016. [Google Scholar]
- Zhang, X. Study on the Metabolism and Function of Tryptophan Mediated by IL4I1. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2020. [Google Scholar] [CrossRef]
- Zheng, J.X.; Chen, W.N.; Yang, L.; Yue, J.; Wang, Z. Discussion on the influence of amino acids on melanin deposition in Silkie chickens. Jiangxi Feed. 2019, 6, 3–4. [Google Scholar]
- Almeida Scalvino, S.; Chapelle, A.; Hajem, N.; Lati, E.; Gasser, P.; Choulot, J.C.; Michel, L.; Hocquaux, M.; Loing, E.; Attia, J.; et al. Efficacy of an agonist of α-MSH, the palmitoyl tetrapeptide-20, in hair pigmentation. Int. J. Cosmet. Sci. 2018, 40, 516–524. [Google Scholar] [CrossRef]










| Gene Name | Primer Sequence (5′-3′) | Annealing Temperature (°C) |
|---|---|---|
| LPL | F:TGGACATTGGTGACCTGCTTATG | 55 |
| R:TCGCCTGACTTCACTCTGACTCTC | ||
| HSP90AA1 | F:CGCGTTTGCTGATTCTGTGA | 55 |
| R:GGTTGGTCCTGTGTTTGCAC | ||
| APOA1 | F:CTTGACCTGAAGCTGGCTGA | 57 |
| R:CTCCTTCAGCTCCTCCTCCA | ||
| FZD3 | F:ATTCCTCCTCCCTGGGACTC | 55 |
| R:GCTAAGCTGAGGTCTAGGCG | ||
| RXFP1 | F:CCCTTGGGCTACTTTCCCTG | 60 |
| R:GCCCTCCAAGAGGGATTTGAG |
| Group | Average Body Weight (g) | Mortality (No. of Chickens) | Survivors (No. of Chickens) | Mortality Rate (%) |
|---|---|---|---|---|
| 0 h | 556.8 ± 51.0 b | 5 | 55 | 8.3 |
| 1 h | 569.8 ± 72.5 | 5 | 55 | 8.3 |
| 3 h | 572.6 ± 71.9 | 4 | 56 | 6.7 |
| 6 h | 592.9 ± 74.6 a | 14 | 46 | 23.3 |
| Group | Chi-Square Contribution |
|---|---|
| 0 h | 0.571 |
| 1 h | 0.571 |
| 3 h | 1.286 |
| 6 h | 7.000 |
| Total | 10.672 |
| Group | Melanin Content (μg mL⁻1) |
|---|---|
| 0 h | 1.18 ± 0.09 |
| 1 h | 1.21 ± 0.09 |
| 3 h | 1.19 ± 0.08 |
| 6 h | 1.19 ± 0.10 |
| Group | 22 Days of Age (Breast Skin L Value) | 22 Days of Age (Leg Skin L Value) | 45 Days of Age (Breast Skin L Value) | 45 Days of Age (Leg Skin L Value) |
|---|---|---|---|---|
| 0 h | 44.3 ± 2.4 A | 46.4 ± 2.6 A | 57.1 ± 2.4 A | 56.7 ± 2.2 A |
| 1 h | 42.5 ± 2.6 B | 40.7 ± 2.2 D | 47.0 ± 1.7 D | 47.4 ± 2.3 D |
| 3 h | 42.9 ± 2.0 B | 42.8 ± 2.6 C | 53.2 ± 2.3 C | 53.8 ± 2.2 C |
| 6 h | 44.2 ± 1.9 A | 44.0 ± 1.7 B | 55.7 ± 2.2 B | 55.2 ± 2.6 B |
| GO ID | GO Term Description |
|---|---|
| GO:0004386 | helicase activity |
| GO:0016251 | RNA polymerase II general transcription initiation factor activity |
| GO:0000987 | cis-regulatory region sequence-specific DNA binding |
| GO:0061659 | ubiquitin-like protein ligase activity |
| GO:0140098 | catalytic activity, acting on RNA |
| GO:0008134 | transcription factor binding |
| GO:0051219 | phosphoprotein binding |
| GO:0061630 | ubiquitin protein ligase activity |
| GO:0008353 | RNA polymerase II CTD heptapeptide repeat kinase activity |
| GO:0004467 | long-chain fatty acid-CoA ligase activity |
| GO:0035198 | miRNA binding |
| GO:0042974 | retinoic acid receptor binding |
| GO:0001882 | nucleoside binding |
| GO:0005347 | ATP transmembrane transporter activity |
| GO:0016788 | hydrolase activity, acting on ester bonds |
| GO:0005546 | phosphatidylinositol-4,5-bisphosphate binding |
| GO:0042162 | telomeric DNA binding |
| GO:0004693 | cyclin-dependent protein serine/threonine kinase activity |
| GO:0042578 | phosphoric ester hydrolase activity |
| GO:0070577 | lysine-acetylated histone binding |
| Metabolite Category | Number |
|---|---|
| Carboxylic acids and derivatives | 44 |
| Fatty Acyls | 44 |
| Organooxygen compounds | 26 |
| Steroids and steroid derivatives | 25 |
| Prenol lipids | 24 |
| Benzene and substituted derivatives | 10 |
| Quinolines and derivatives | 8 |
| Flavonoids | 7 |
| Glycerophospholipids | 7 |
| Sphingolipids | 7 |
| Diazines | 6 |
| Organonitrogen compounds | 6 |
| Coumarins and derivatives | 4 |
| Purine nucleotides | 4 |
| Unsaturated hydrocarbons | 4 |
| Macrolides and analogues | 3 |
| Pyrimidine nucleosides | 3 |
| Benzofurans | 2 |
| Benzoxazines | 2 |
| Diarylheptanoids | 2 |
| Total | 238 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Tian, Z.; Li, H.; Tan, L.; Zhang, Y.; Ge, C.; Wang, K. Impact of Ultraviolet Radiation on Skin and Blood Melanin Traits in Xichou Black-Boned Chicken: A Transcriptomic and Metabolomic Study. Animals 2025, 15, 141. https://doi.org/10.3390/ani15020141
Li X, Tian Z, Li H, Tan L, Zhang Y, Ge C, Wang K. Impact of Ultraviolet Radiation on Skin and Blood Melanin Traits in Xichou Black-Boned Chicken: A Transcriptomic and Metabolomic Study. Animals. 2025; 15(2):141. https://doi.org/10.3390/ani15020141
Chicago/Turabian StyleLi, Xinlu, Zhongxiao Tian, Haojie Li, Lei Tan, Yong Zhang, Changrong Ge, and Kun Wang. 2025. "Impact of Ultraviolet Radiation on Skin and Blood Melanin Traits in Xichou Black-Boned Chicken: A Transcriptomic and Metabolomic Study" Animals 15, no. 2: 141. https://doi.org/10.3390/ani15020141
APA StyleLi, X., Tian, Z., Li, H., Tan, L., Zhang, Y., Ge, C., & Wang, K. (2025). Impact of Ultraviolet Radiation on Skin and Blood Melanin Traits in Xichou Black-Boned Chicken: A Transcriptomic and Metabolomic Study. Animals, 15(2), 141. https://doi.org/10.3390/ani15020141

