Rapid and Visually Specific Detection of Sarcocystis miescheriana and Sarcocystis suihominis Infections in Domestic Pigs (Sus scrofa domesticus) Using Loop-Mediated Isothermal Amplification
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Sarcocyst Isolation
2.2. Morphological Characterization and DNA Extraction
2.3. PCR Amplification
2.4. LAMP Primer Design and Reaction Optimization
2.4.1. Primer Design and Reaction Setup
2.4.2. Temperature and Time Optimization
2.4.3. LAMP Specificity and Sensitivity Assay
3. Results
3.1. Morphological Observations and Molecular Characterization
3.2. Optimization of LAMP Assay Temperature and Time
3.3. Specificity of LAMP Assay
3.4. Sensitivity of LAMP Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| LAMP | Loop-mediated isothermal amplification |
| cox1 | Cytochrome c oxidase subunit I gene |
| UV | Ultraviolet |
References
- Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2016; pp. 185–193. [Google Scholar]
- Huang, Z.; Ye, Y.; Zhang, H.; Deng, S.; Tao, J.; Hu, J.; Yang, Y. Morphological and molecular characterizations of Sarcocystis miescheri and Sarcocystis suihominis in domestic pigs (Sus scrofa) in China. Parasitol. Res. 2019, 118, 3491–3496. [Google Scholar] [CrossRef] [PubMed]
- Helman, E.; Dellarupe, A.; Steffen, K.D.; Bernstein, M.; Moré, G. Morphological and molecular characterization of Sarcocystis spp. in pigs (Sus scrofa domestica) from Argentina. Parasitol. Int. 2024, 100, 102859. [Google Scholar] [CrossRef] [PubMed]
- Golubkov, V.I.; Rybaltovskii, D.V.; Kislyakova, Z.I. The source of infection for swine Sarcocystis. Veterinarya 1974, 11, 85–87. (In Russian) [Google Scholar]
- Reiner, G.; Hepp, S.; Hertrampf, B.; Kliemt, D.; Mackenstedt, U.; Daugschies, A.; Zahner, H. Genetic resistance to Sarcocystis miescheriana in pigs following experimental infection. Vet. Parasitol. 2007, 145, 2–10. [Google Scholar] [CrossRef] [PubMed]
- Barrows, P.L.; Prestwood, A.K.; Green, C.E. Experimental Sarcocystis suicanis infections: Disease in growing pigs. Am. J. Vet. Res. 1982, 43, 1409–1412. [Google Scholar] [CrossRef] [PubMed]
- Piekarski, G.; Heydorn, A.O.; Aryeetey, M.E.; Hartlapp, J.H.; Kimmig, P. Clinical, parasitological and serological investigations in sarcosporidiosis (Sarcocystis suihominis) of man (author’s transl). Immun. Infekt. 1978, 6, 153–159. (In German) [Google Scholar] [PubMed]
- Li, Y.; Lian, Z. Study on man-pig cyclic infection of Sarcocystis suihominis found in Yunnan province, China. Acta Zool. Sin. 1986, 32, 329–334. (In Chinese) [Google Scholar]
- Gjerde, B. Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene. Inter. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [PubMed]
- Nzelu, C.O.; Kato, H.; Peters, N.C. Loop-mediated isothermal amplification (LAMP): An advanced molecular point-of-care technique for the detection of Leishmania infection. PLoS Negl. Trop. Dis. 2019, 13, e0007698. [Google Scholar] [CrossRef] [PubMed]
- Obande, G.A.; Banga Singh, K.K. Current and future perspectives on isothermal nucleic acid amplification technologies for diagnosing infections. Infect. Drug Resist. 2020, 13, 455–483. [Google Scholar] [CrossRef] [PubMed]
- Gjerde, B. Sarcocystis species in red deer revisited: With a re-description of two known species as Sarcocystis elongata n. sp. and Sarcocystis truncata n. Sp. based on mitochondrial cox1 sequences. Parasitology 2014, 141, 441–452. [Google Scholar] [CrossRef] [PubMed]
- da Rosa, G.; Roman, I.J.; Gressler, L.T.; Cargnelutti, J.F.; Vogel, F.S.F. Molecular identification of Sarcocystis species in wild boar (Sus scrofa) and pigs (Sus scrofa domesticus) in Brazil. Vet. Parasitol. Reg. Stud. Rep. 2024, 50, 101020. [Google Scholar] [CrossRef] [PubMed]
- Imre, K.; Sala, C.; Morar, A.; Imre, M.; Ciontu, C.; Chisăliță, I.; Dudu, A.; Matei, M.; Dărăbuș, G. Occurrence and first molecular characterization of Sarcocystis spp. in wild boars (Sus scrofa) and domestic pigs (Sus scrofa domesticus) in Romania: Public health significance of the isolates. Acta. Trop. 2017, 167, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Zainalabidin, F.A.; Noorazmi, M.S.; Bakri, W.N.; Sathaya, G.; Ismail, M.I. Prevalence of muscular sarcosporidiosis in slaughtered domestic Pigs in Perak, Peninsular Malaysia. Trop. Life. Sci. Res. 2017, 28, 161–166. [Google Scholar] [CrossRef] [PubMed]
- Pacifico, L.; Rubiola, S.; Buono, F.; Sgadari, M.; D’Alessio, N.; Scarcelli, S.; Sgroi, G.; Buglione, M.; Chiesa, F.; Restucci, B.; et al. Molecular differentiation of Sarcocystis miescheriana and Sarcocystis suihominis using a new multiplex PCR targeting the mtDNA cox1 gene in wild boars in southern Italy. Res. Vet. Sci. 2023, 164, 105039. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Fan, P.; Zhou, S.; Zhang, L. Loop-mediated isothermal amplification (LAMP): A novel rapid detection platform for pathogens. Microb. Pathog. 2017, 107, 54–61. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Zhuo, Z.; Hou, Z.; Tao, J.; Xu, J. Establishment and application of a loop-mediated isothermal amplification assay for detection of Sarcocystis suihominis in pigs. Chin. Vet. Sci. 2022, 52, 1102–1107. (In Chinese) [Google Scholar] [CrossRef]
- Chen, Y.; Peng, J.; Zhu, Z.; Zhang, W.; Wang, L.; Xu, J.; Liu, Q.; Liu, J. Development of a highly specific LAMP assay for detection of Sarcocystis tenella and Sarcocystis gigantea in sheep. Parasitol. Res. 2024, 123, 324. [Google Scholar] [CrossRef] [PubMed]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef]









| Target Species | Primer Name | Primer Length (nt) | Sequence (5′-3′) |
|---|---|---|---|
| S. miescheriana | F3 | 19 | TGCTGCCACTTGGTTCAAC |
| B3 | 18 | AGTTGCCCGAACCCAGTA | |
| FIP | 40 | TCAGTGGTGCATACAGCGTCCCTCCACTCGTTCATTGCGG | |
| BIP | 41 | GGCGATGAATACGGAAGCCGTCGCTGCTAATACCGAGGAAC | |
| S. suihominis | F3 | 20 | CCATCGATGATCCTGGCAAT |
| B3 | 18 | CGGC AGCCATAACATCCA | |
| FIP | 40 | GTATCAACCTCGAGGCCGGCAGCCATACTCGGATCACTGG | |
| BIP | 41 | CCATTCCAACGGGCACGAAGAGGCGTATTTACTGCCCATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, Z.; Qin, T.; Qian, L.; Xu, L.; Zhang, L.; Deng, S.; Tao, J.; Hu, J. Rapid and Visually Specific Detection of Sarcocystis miescheriana and Sarcocystis suihominis Infections in Domestic Pigs (Sus scrofa domesticus) Using Loop-Mediated Isothermal Amplification. Animals 2025, 15, 2763. https://doi.org/10.3390/ani15182763
Hu Z, Qin T, Qian L, Xu L, Zhang L, Deng S, Tao J, Hu J. Rapid and Visually Specific Detection of Sarcocystis miescheriana and Sarcocystis suihominis Infections in Domestic Pigs (Sus scrofa domesticus) Using Loop-Mediated Isothermal Amplification. Animals. 2025; 15(18):2763. https://doi.org/10.3390/ani15182763
Chicago/Turabian StyleHu, Zhun, Tao Qin, Luyao Qian, Lu Xu, Liwu Zhang, Shuangsheng Deng, Jianping Tao, and Junjie Hu. 2025. "Rapid and Visually Specific Detection of Sarcocystis miescheriana and Sarcocystis suihominis Infections in Domestic Pigs (Sus scrofa domesticus) Using Loop-Mediated Isothermal Amplification" Animals 15, no. 18: 2763. https://doi.org/10.3390/ani15182763
APA StyleHu, Z., Qin, T., Qian, L., Xu, L., Zhang, L., Deng, S., Tao, J., & Hu, J. (2025). Rapid and Visually Specific Detection of Sarcocystis miescheriana and Sarcocystis suihominis Infections in Domestic Pigs (Sus scrofa domesticus) Using Loop-Mediated Isothermal Amplification. Animals, 15(18), 2763. https://doi.org/10.3390/ani15182763

