Next Article in Journal
The Role of the Endocannabinoid System in Oncology and the Potential Use of Cannabis Derivatives for Cancer Management in Companion Animals
Previous Article in Journal
Intestinal Alkaline Phosphatase Expression in Response to Escherichia coli Infection in Nursery Pigs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Mature Gonads in Megalobrama terminalis

School of Life Sciences, Guangzhou University, Guangzhou 510006, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(15), 2184; https://doi.org/10.3390/ani15152184
Submission received: 19 June 2025 / Revised: 13 July 2025 / Accepted: 22 July 2025 / Published: 24 July 2025
(This article belongs to the Section Aquatic Animals)

Simple Summary

Megalobrama terminalis is an economically important fish indigenous to South China. However, there is less research on gonadal differentiation and development in M. terminalis. In this study, the gonadal transcriptome of female and male M. terminalis was analyzed for the first time. Many differentially expressed genes (DEGs) relevant to steroidogenesis, gonadal differentiation and development, and gametogenesis were identified after comparing the transcriptomes of male and female gonads. The annotation results of DEGs showed that some reported genes related to gonadal differentiation in teleost fishes may play essential roles in M. terminalis. Results of this study will provide data to support the reproduction and breeding of M. terminalis.

Abstract

Megalobrama terminalis is a significant aquatic fish in South China, renowned for its tasty meat. Nonetheless, related studies are deficient concerning the gonadal development of M. terminalis. This paper presents the first comparative transcriptome analysis of the gonads of female and male M. terminalis. A total of 84,886 unigenes were assembled, with 42,322 effectively annotated to the Nr, SwissProt, KEGG, KOG, and GO databases. Furthermore, comparative transcriptomic analysis of M. terminalis was conducted to examine its gonadal development. A total of 14,972 differentially expressed genes (DEGs) were discovered. In the testis, the expression of 11,928 unigenes was significantly upregulated, while 3044 were significantly downregulated. Numerous DEGs associated with steroidogenesis, gonadal differentiation and development, and gametogenesis in teleost fish were identified. The results provide empirical support for further study of genes and pathways associated with sex determination and gonadal differentiation in teleost fish.

1. Introduction

Megalobrama are widely distributed freshwater fish in China, inhabiting the Yangtze River, Pearl River, Yellow River, and Hainan Island, among other river systems. They are favored by the public for their tender texture and exceptional taste, which makes them an important aquatic product in China [1,2,3]. Therefore, genomics [4], transcriptomics [5], molecular markers [6], and germplasm survey of this genus have been extensively investigated. However, research on M. terminalis, a species of Megalobrama, is limited.
M. terminalis belongs to Megalobrama, Culterinae, Cyprinidae, Cypriniformes, mainly distributed in the Pearl River system and Hainan Island water system, and it is an economically important fish endemic to the South China region [7,8]. Due to the superimposed effects of multiple anthropogenic factors such as hydraulic engineering, channel dredging, water pollution, and overfishing, M. terminalis resources have been decreasing since 1970, and M. terminalis resources dropped to roughly 5 tons in the 1980s [9,10]. A few studies have been conducted on M. terminalis, mainly focusing on the taxonomic status and evolutionary history through mitochondrial sequences [11,12,13], exploration and improvement of the feed composition [14,15], and artificial propagation and crossbreeding techniques for M. terminalis [16,17]. However, less attention has been paid to the gonadal development, differentiation, maturation, and gametogenesis of M. terminalis. To better promote the study of the mechanisms of gonadal development and reproduction of M. terminalis, it is vital to explore the genes and pathways related to gonadal differentiation using the RNA-seq technique.
Fish are different from higher vertebrates. Their sex determination and gonadal differentiation are intricate and are affected by environmental and genetic factors, and many other variables. Up to now, some important pathways and genes have been identified in fish [18,19]. Moreover, due to the diversity of fish species and living habitats, gonadal development and sex differentiation of fish are diversified [20]. Next-generation sequencing (NGS)-based transcriptome sequencing can quickly and cost-effectively generate large amounts of transcript sequences and mRNA expression data with high-throughput advantages, enabling efficient gene expression profiling and providing data support for fish research [21]. Currently, NGS-based transcriptome sequencing has been applied in many fish species such as Coreoperca whiteheadi [22], Scortum barcoo [23], Siganus oramin [24], and Spinibarbus hollandi [25]. These studies provide important insights into the mechanisms of gonadal development, reproduction-related genes, and complement the gaps in gonadal transcriptome studies in specific fish species.
In the present study, gonadal RNA-seq of female and male M. terminalis was performed using the Illumina platform, followed by de novo assembly and gene annotation. The comparative transcriptomics approach was employed to systematically analyze gene expression differences potentially involved in gonadal differentiation and gametogenesis. This study aims to further expand the existing genetic and genomic data resources, and through deepening gene expression analysis and functional gene mining, to screen and identify genes related to key reproductive processes such as gonadal differentiation and development and gametogenesis as comprehensively as possible, to lay a solid data foundation for subsequent in-depth investigation of the molecular mechanism of reproduction in M. terminalis.

2. Materials and Methods

2.1. Sampling

Six 2-year-old and sexually mature M. terminalis individuals (three females and three males) were acquired from an aquaculture farm in Shaoguan, Guangdong province. The fish were subsequently anesthetized and euthanized using MS-222 (STAHERB, Changsha, China) [26]. Gonadal tissues were immediately dissected, placed in an RNA keeper (Vazyme, Nanjing, China), and stored at −20 °C.

2.2. RNA Extraction and cDNA Library Construction

Total RNA from gonadal tissues was extracted using FreeZol regent (Vazyme, Nanjing, China), which was operated strictly according to the manufacturer’s instructions. RNA concentration and purity were initially checked using a NanoPhotometer N60 (Implen, Munich, Germany), and further assessed for integrity and quantitative analysis by an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Eukaryotic transcriptome sequencing libraries were constructed using the NEBNext® Ultra™ RNA Library Preparation Kit (NEB, Ipswich, MA, USA), which includes the following steps: enrichment of mRNAs with polyA tails using Oligo (dT) magnetic beads, fragmentation of mRNAs by ultrasound; synthesis of mRNAs in an M-MuLV reverse transcriptase system using fragmented mRNAs and random oligonucleotides as primers. The first strand of cDNA was subsequently synthesized in the DNA polymerase I system using dNTPs as the raw material for the second strand. The purified double-stranded cDNA was end-repaired, added A tails, and ligated to the sequencing adaptor. cDNAs of about 200 bp were selected with AMPure XP beads (Beckman Coulter, Brea, CA, USA), PCR amplification was performed, and the PCR products were purified again using AMPure XP beads, and the libraries were finally obtained.

2.3. Library Sequencing, De Novo Assembly, and Annotation

Qualified libraries underwent a pair-end 150 sequencing strategy (PE150) utilizing the Illumina Novaseq6000 sequencing platform (Illumina, San Diego, CA, USA), yielding a minimum sequencing data volume of 6 Gb per sample. Raw sequencing data were filtered to remove reads with adapter contamination and low quality (N base >10%) to get clean reads, which were subsequently stored in FASTQ format. De novo assembly of the transcriptome was performed using Trinity 2.8.4 [27], and the quality was evaluated using N50 and BUSCO 3.0.2 [28]. At last, sequences of coding regions of the assembled unigene were predicted by six reading frames (3 forward and 3 reverse).
The predicted protein sequences were aligned with the Nr database (https://ftp.ncbi.nlm.nih.gov/blast/db/ (accessed on 20 April 2025)) and the SwissProt database (https://www.uniprot.org/ (accessed on 2 May 2025)), selecting the coding mode of the optimal alignment (maximum alignment score) as the gene’s coding region. Homology predictions of unigenes were subsequently done through comparisons with the Nr, KOG (https://www.ncbi.nlm.nih.gov/COG/ (accessed on 3 May 2025)), KEGG (http://www.kegg.jp, (accessed on 4 May 2025)), and SwissProt databases using the BLAST+ 2.6.0. The Nr results were subsequently annotated using Blast2GO 6.0 (GO, http://eggnog5.embl.de/download/emapperdb-5.0.2/ (accessed on 13 May 2025). Unigenes were categorized based on biological processes, cellular components, and molecular functions.

2.4. Identification of Differentially Expressed Genes and Enrichment Analysis

Clean reads from each sample were aligned to the assembled transcripts utilizing hisat2 [29], and gene expression metrics, including Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) and coverage, were computed using RSEM 1.2.19 [30]. The python script prepDE.py was used to convert the output of stringtie to the compatible format of the edgeR package (V3.6), and edgeR was used for the analysis of differentially expressed genes (DEGs), aiming to identify the significantly differentially expressed genes with the filtering thresholds of FDR value < 0.05 and |log2FC| > 2. Finally, using the clusterProfiler program in the R package, significant GO terms and KEGG pathways (FDR < 0.05) were further enriched based on these DEGs following Fisher’s exact test and Benjamini-Hochberg correction [31].

2.5. Validation of DEGs Using Quantitative Real-Time PCR

The reliability of the data was confirmed through quantitative reverse transcription polymerase chain reaction (qRT-PCR). Sixteen DEGs related to gonadal differentiation and development were chosen for validation. β-actin was selected as the reference gene. Primers were designed using Primer-BLAST (Table 1). The specific steps were as follows: cDNA template was synthesized by HiScript III RT SuperMix (Vazyme, Nanjing, China), and amplified by SYBR Green qPCR Mix (GDSBIO, Guangzhou, China) on the LightCycler 480 platform. The reaction program was as follows: The reaction program included pre-denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s, concluding with a final extension at 72 °C for 5 min, which included melting curve analysis. Each sample was subjected to three biological replicates, and the results were normalized using the comparative CT method (2−∆∆CT) [32]. Results are presented as the mean ± standard error of the mean (Mean ± SEM).

2.6. Gonadal Histology

Gonadal tissues were first dehydrated in 70–100% alcohol in a gradient (gradient of 10%) and then made transparent with xylene. And then embedded in paraffin for 3 h before cutting into slices ranging from 3 to 6 μm. Qualified slices were dried overnight at 42 °C and stained with hematoxylin and eosin. The transparent slides were promptly sealed using neutral resin and left to air-dry at 25 °C overnight. Finally, slices were observed and photographed using a light microscope (Leica DM3000, Wetzlar, Germany) [23].

3. Results

3.1. Overview of Transcriptome Assembly Quality

cDNA libraries were constructed from three ovary and three testis samples using RNA-seq. Following data quality control and filtering of low-quality data, clean reads totaling 41.18 GB were generated, with an average of 6.86 GB per sample, utilizing the Illumina HiSeq platform. Base quality values Q20 and Q30 were 99.28% and 97.36%, respectively (Table 2). In addition, PCA results showed significant differences between testis and ovary samples and good consistencies in parallel samples (Figure 1). A total of 84,886 unigenes were successfully assembled, with an overall length of 92.26 MB. The lengths of individual unigenes varied from 201 to 20,142 bp, with an average length of 1086 bp and a N50 of 2238 bp (Table 3). However, the majority of unigenes were 1–1000 bp in length (70.7%) while those with lengths greater than 1000 accounted for only 29.3% of the total (Figure 2).

3.2. Unigene Annotation

A total of 42,322 unigenes were successfully annotated among all the assembled unigenes. The number of annotated unigenes and their percentage in the five major databases (Nr, SwissProt, KEGG, GO, and KOG) in descending order were 40,529, 95.8%; 25,877, 61.1%; 25,801, 60.9%; 25,055, 59.2%; and 20,139, 47.6%, respectively (Table 3). In the Nr annotation, the results showed that Megalobrama amblycephala had the largest number of homologous genes with M. terminalis (18,324), followed by Culter albumus (4915), while the remaining species had less than 4000 homologous genes (Figure 3).
In addition, all unigenes were further annotated in KEGG, GO, and KOG databases to predict their functions and categorize them. The KEGG database categorized 25,801 unigenes into metabolism, genetic information processing, environmental information processing, cellular processing and organismal systems (Figure 4A); In the GO database, a total of 25,055 unigenes were annotated into three functional categories of biological process, cellular component and molecular function and the most representative terms in each category were cellular process, cellular anatomical entity and binding (Figure 4B); Finally, the KOG database categorized 20,139 unigenes into 25 families, of which the two families with the highest proportion were signal transduction mechanisms and general function prediction only (Figure 4C). More results of KEGG and GO annotation can be found in Tables S1 and S2.

3.3. Differential Expression Analysis

A total of 14,972 DEGs were identified between ovary and testis samples, of which 11,928 were significantly upregulated in the testis and 3044 were significantly downregulated (Figure 5). KEGG enrichment analysis showed that among the top 25 significantly enriched pathways, there are multiple pathways related to gonad development, such as cell cycle, MAPK signaling pathway, and Calcium signaling pathway (Figure 6).
In addition, several DEGs related to steroidogenesis, gonadal differentiation and development, and gametogenesis were identified. Aromatase (cyp19a1a), cytochrome P450 26A1 (cyp26a1), estradiol 17-beta-dehydrogenase 1 (hsd17b1) and synaptonemal complex protein 2-like (sycp2l) are predominantly expressed in ovary; Doublesex- and mab-3-related transcription factor 1 (dnmrt1), transcription factor SOX-30-like (sox30), tektin-4 (tekt4), and cholesterol 25-hydroxylase-like protein (ch25h) are predominantly expressed in testis (Table 4).

3.4. Validation of Transcriptomic Data by qRT-PCR

The differential expression results of qRT-PCR, including 16 DEGs (dmrt1, cyp11b, sycp1, cyp26a1, rln3, cyp27a1, star, gdf9, bmp15, hsd17b12a, hsd17b1, foxl2, and zp3), were consistent with those of RNA-seq (Figure 7, Table 4).

3.5. Gonadal Histology Analysis

The testes and ovaries of the two-year-old M. terminalis were utilized for histological analysis. The testes had numerous spermatids and interstitial cells, coupled with a limited quantity of sperm (Figure 8A), whereas the ovaries were abundant in mature oocytes (Figure 8B). Histological results showed that the gonads of male and female M. terminalis were mature.

4. Discussion

Sex hormone synthesis, gonadal differentiation, and gametogenesis are complex processes involving numerous specific pathways and genes. Transcriptome sequencing has been widely used to obtain comprehensive genetic information from specific organs and tissues of organisms, as it effectively identifies differences in gene expression among different treatment groups. M. terminalis is a commercially significant fish in southeastern China. However, overfishing has resulted in a substantial decline of its wild resources in recent years, necessitating urgent research on its captive breeding and cultivation. In this study, genes related to gonadal differentiation and gametogenesis in M. terminalis were revealed by transcriptome sequencing for the first time.

4.1. DEGs Involved in Steroidogenesis

Sex hormones are classified as steroid hormones, essential for embryonic development, gonadal differentiation, and gametogenesis in teleost fish [33]. Steroids are synthesized from their precursor, cholesterol. Notably, within our annotated genes, cyp27a1 is involved in the initial hydroxylation reaction of cholesterol in the Japanese Lamprey Lethenteron reissneri [34], while ch25h, which is crucial for cholesterol metabolism, has been reported to exhibit high expression levels in the gonads of Cynoglossus semilaevis [35]. In addition, cyp11a1 encodes the type I cytochrome P450 enzyme located in mitochondria, which catalyzes the transformation of cholesterol into pregnenolone [36]. star encodes the steroidogenic acute regulatory protein (StAR), which facilitates the transport of cholesterol from the mitochondria and has been reported to regulate the transformation of cholesterol to steroids in some teleost fish [37,38].
11-Ketotestosterone (11-KT) and 17-estradiol (E2) are the major androgens and estrogens in teleost fish [25]. Their production requires the involvement of several P450 family and HSD family genes [39], and we identified several related genes. Previous studies have shown that hsd17b12a catalyzes the transformation of 11-ketoandrostenedione (11-KA4) to 11-KT in the testis of Anguilla japonica [40]. Additionally, hsd17b1 and hsd17b12a were predicted to participate in the synthesis of E2 in the ovaries of female Japanese eels [41]. The CYP11B enzyme facilitates the conversion of progesterone to the steroid testosterone and androstenedione in humans [42]. Concurrently, cyp11b was identified as being expressed in the ovaries and testes of Paralichthys olivaceus, and a reduction in the transcript level of cyp11b following E2 treatment implies its potential role in estrogen synthesis in fish [43]. Additionally, the deletion of cyp17a1 resulted in decreased E2 levels in zebrafish plasma, while concurrently increasing progesterone and DHP concentrations in the testes, indicating that cyp17a1 regulates sex hormone production in fish [44]. In summary, these DEGs play an important role in the steroidogenesis of M. terminalis, and the species may share the same pattern of steroidogenesis with other teleost fish.

4.2. DEGs Involved in Gonadal Differentiation and Development

In mammals, gonadal differentiation and development are regulated by several genes and pathways, such as the WNT/β-catenin signaling pathway [45,46], the sry, sox [47], dmrt, and fst gene family. In vertebrates, gonadal differentiation is more intricate in fish compared to other species. Fish show several patterns of sexual differentiation, ranging from hermaphroditic to differentiated or undifferentiated gonochoristic species [48]. Among the genes identified in this study, several have been reported to be associated with gonadal differentiation in fish. In mandarin fish and Pengze crucian carp, dmrt1 was found to be predominantly expressed in the testis [49], whereas in zebrafish ovary to testis transformation, dmrt1 expression was found to be upregulated [50], suggesting that dmrt1 mainly acts on testis development, which was similar to the result that the testis of M. terminalis had a higher dmrt1 expression than that in the ovaries. Similarly, dmrt2 is also highly expressed in the testis of M. terminalis and several other fish species, and its expression increases during testis development, suggesting that dmrt2 may have similar roles as dmrt1 [49,51]. Fsta is a follicular repressor-encoding gene, and treatment with follicular repressor reverses zebrafish females to males [52]. Thus, higher expression of fst in the testis of M. terminalis suggests that fst may also have a role in the development of its testis.
In addition, we identified several ovarian development-related genes. Foxl2 is a forkhead transcription factor essential for proper reproductive function in females. It is involved in almost all stages of ovarian development. A central role of FOXL2 is the lifetime maintenance of GC identity through the repression of testis-specific genes [53]. It has been reported to play a key role in ovarian differentiation in various fish species such as Paralichthys olivaceus [54,55]. The bone morphogenetic protein 15 (bmp15) and growth differentiation factor 9 (gdf9) genes are relevant members of the TGFβ superfamily that encode proteins secreted by the oocytes into the ovarian follicles [56]. In M. terminalis, foxl2, bmp15, and gdf9 were highly expressed in the ovary, suggesting that they may play an important role in ovarian development in M. terminalis.

4.3. DEGs Involved in Gametogenesis and Gamete Maturation

In aquaculture, optimal gamete development is crucial for reproduction and enhanced yield of economically important fish. Meiosis in spermatocytes and oocytes is an essential step in gametogenesis. cyb26a1 is identified as a gene that facilitates meiotic start in various fish species, and its downregulation accelerates the commencement of meiosis [57,58,59]. Additionally, both sycp1 and msh5 are essential for meiosis in mice. Mutations in sycp1 result in meiotic arrest and spermatocyte mortality in males [60], whereas such mutations in female zebrafish cause a decrease in normal offspring, and mutations in males cause sterility [61]. Murine Msh5 facilitates the synapsis of homologous chromosomes during meiotic prophase I [62]. In M. terminalis, all three meiosis-associated genes are upregulated in the testis, potentially correlating with the increased incidence of meiosis in the spermatheca.
We have also found genes exclusive to spermatogenesis and oogenesis. In Nile tilapias, mutations in rln3a result in decreased sperm tail length and the formation of two-tailed spermatozoa [63], while sox30-deficient female mice exhibit normal phenotypes, and males are sterile [64]. In addition, TEKT4 protein is localized to the flagellum of mouse spermatozoa, and deletion of tekt4 results in reduced fertility in male mice [65], suggesting that it is important for spermatogenesis. In addition, SYCP2L, which is important for meiosis in the oocyte, is a paralogue of the synaptonemal complex protein SYCP2 and is expressed exclusively in oocytes [66], and the gene sycp2l was highly expressed in the ovary of M. terminalis. These genes are differentially expressed in the gonads of M. terminalis, suggesting that they are important for spermatogenesis and oogenesis in M. terminalis.

5. Conclusions

We present the first transcriptome data from the gonads (testis and ovary) of M. terminalis, utilizing Illumina sequencing. A total of 14,972 DEGs were identified, with 11,928 exhibiting upregulation in the testis and 3044 showing downregulation. Furthermore, we found numerous DEGs linked to steroidogenesis, gonadal differentiation and development, and gametogenesis in mammals and teleost fish, indicating that these genes are likely to play significant roles in M. terminalis. The results will provide data to underpin further studies on gonadal differentiation in M. terminalis, as well as its reproduction and breeding.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani15152184/s1, Table S1. Top 50 terms of GO (Testis_vs_Ovary). Table S2. Top 50 pathway of KEGG (Testis_vs_Ovary).

Author Contributions

Conceptualization, C.H. and Q.L.; methodology, K.W.; software, Y.Z.; validation, W.L.; formal analysis, W.L. and H.Y.; investigation, P.Z. and S.L.; resources, Q.L.; data curation, C.H.; writing—original draft preparation, Y.Z.; writing—review and editing, C.H. and Q.L.; visualization, Z.D. and G.C.; supervision, C.H. and Q.L.; project administration, C.H. and Q.L.; funding acquisition, Q.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number: 42077321).

Institutional Review Board Statement

All procedures in this experiment were approved by the Institutional Review Committee of Bioethics and Biosafety of Guangzhou University on 16 March 2024 (No. GURBBB240316).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are openly available in NCBI/Bioproject, reference number PRJNA1278959.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Chen, J. Population Genetics of Megalobrama Based on Whole Genome Resequencing; Huangzhong Agricultural University: Wuhan, China, 2021; (In Chinese with English Abstract). [Google Scholar]
  2. Lai, R.; Zhang, X.; Li, Y.; Wu, J.; Yang, D.; Wang, W. Comparison and phylogenetic analysis of mitochondrial genomes of Megalobrama. J. Fish. China 2014, 38, 1–14, (In Chinese with English Abstract). [Google Scholar]
  3. Gong, D.; Wang, X.; Yang, J.; Liang, J.; Tao, M.; Hu, F.; Wang, S.; Liu, Z.; Tang, C.; Luo, K.; et al. Protection and utilization status of Parabramis and Megalobrama germplasm resources. Reprod. Breed. 2023, 3, 26–34. [Google Scholar] [CrossRef]
  4. Hu, X.; Luan, P.; Cao, C.; Li, C.; Jia, Z.; Ge, Y.; Shang, M.; Wang, S.; Meng, Z.; Tong, J.; et al. Characterization of the mitochondrial genome of Megalobrama terminalis in the Heilong River and a clearer phylogeny of the genus Megalobrama. Sci. Rep. 2019, 9, 8509. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, K.; Xie, N. Full-length transcriptome assembly of black amur bream (Megalobrama terminalis) as a reference resource. Mol. Biol. Rep. 2024, 51, 1101. [Google Scholar] [CrossRef] [PubMed]
  6. Gao, Z.; Luo, W.; Liu, H.; Zeng, C.; Liu, X.; Yi, S.; Wang, W.; Fuentes, J. Transcriptome analysis and SSR/SNP markers information of the blunt snout bream (Megalobrama amblycephala). PLoS ONE 2012, 7, e42637. [Google Scholar] [CrossRef] [PubMed]
  7. Xu, W.; Xiong, B. Research progress of Megalobrama in China. J. Hydroecology 2008, 29, 7–11, (In Chinese with English Abstract). [Google Scholar]
  8. Liu, Y.; Li, X.; Li, Y.; Yang, G.; Xu, T. Histological study on gonad development of Megalobrama terminalis. South China Fish. Sci. 2019, 15, 113–118, (In Chinese with English Abstract). [Google Scholar]
  9. Tan, X.; Li, X.; Chang, J.; Tao, J. Acoustic observation of the spawning aggregation of Megalobrama hoffmanni in the Pearl River. J. Freshw. Ecol. 2009, 24, 293–299. [Google Scholar] [CrossRef]
  10. Liu, Y.; Li, X.; Li, Y.; Chen, W.; Li, J.; Zhu, S. Reproductive biology and strategy of Megalobrama terminalis of Xijiang River. J. Lake Sci. 2021, 33, 232–241, (In Chinese with English Abstract). [Google Scholar] [CrossRef]
  11. Chen, J.; Liu, H.; Gooneratne, R.; Wang, Y.; Wang, W. Population genomics of Megalobrama provides insights into evolutionary history and dietary adaptation. Biology 2022, 11, 186. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, K.; Xie, N.; Wang, Y.; Liu, X. Extensive mitogenomic heteroplasmy and its implications in the phylogeny of the fish genus Megalobrama. 3 Biotech 2023, 13, 115. [Google Scholar] [CrossRef] [PubMed]
  13. Luo, C.; Tan, X.; Weng, S. Genetic diversity of Megalobrama terminalis based on mtDNA CO I sequences. Mar. Fish. 2025, 47, 1–9. [Google Scholar]
  14. Yang, Q.; Wang, Y.; Li, G.; Huang, X.; Zheng, L.; Peng, M.; Cao, Y.; Wang, X. Effect of dietary supplementation Ampelopsis grossedentata extract on growth performance and muscle nutrition of Megalobrama hoffmanni by gut bacterial mediation. Heliyon 2024, 10, e29008. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, Y.; Mai, Y.; Li, H.; Zheng, L.; Wang, X. Comparative analysis of the effects of dietary supplementation with Ampelopsis grossedentata extract and dihydromyricetin on growth performance, muscle quality, and gut microbiota of Megalobrama hoffmanni. Aquaculture 2025, 598, 742049. [Google Scholar] [CrossRef]
  16. Study on Artificial Propagation and Culture Technology of Megalobrama terminalis; Pearl River Fisheries Research Institute: Guangzhou, China, 2007; (In Chinese with English Abstract).
  17. Lin, X.; Chen, J.; Chen, L. Large scale breeding technology of hybrid Megalobrama (Megalobrama hoffmannii♂ × Megalobrama amblycephala♀). Sci. Fish Farming 2014, 11, 8–10, (In Chinese with English Abstract). [Google Scholar]
  18. Hang, Y.; Guang, G.; Hong, Y. Insights of sex determination and differentiation from medaka as a teleost model. Hereditas 2017, 39, 441–454, (In Chinese with English Abstract). [Google Scholar]
  19. Li, Y.; Wu, L.; Li, X. Research Progress on sex determination and differentiation related genes in teleost fishes. J. Henan Norm. Univ. 2017, 45, 72–78, (In Chinese with English Abstract). [Google Scholar]
  20. Xu, G.; Bao, M.; Du, F.; Xu, P. Research Progress on gonad development and spawning types of fish. J. Yangtze Univ. 2017, 14, 43–48, (In Chinese with English Abstract). [Google Scholar]
  21. Metzker, M.L. Sequencing technologies—The next generation. Nat. Rev. Genet. 2010, 11, 31–46. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, S.; Han, C.; Zhang, Y. De novo assembly, characterization and comparative transcriptome analysis of gonads reveals sex-biased genes in Coreoperca whiteheadi. Comp. Biochem. Physiol. Part D Genom. Proteom. 2023, 47, 101115. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, S.; Lian, Y.; Song, Y.; Chen, Q.; Huang, J. De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Gonads of Jade Perch (Scortum barcoo). Animals 2023, 13, 2254. [Google Scholar] [CrossRef] [PubMed]
  24. Huang, X.; Huang, Z.; Li, Q.; Li, W.; Han, C.; Yang, Y.; Lin, H.; Wu, Q.; Zhou, Y. De Novo Assembly, Characterization, and Comparative Transcriptome Analysis of Mature Male and Female Gonads of Rabbitfish (Siganus oramin) (Bloch & Schneider, 1801). Animals 2024, 14, 1346. [Google Scholar] [CrossRef] [PubMed]
  25. Han, C.; Huang, W.; Peng, S.; Zhou, J.; Zhan, H.; Zhang, Y.; Li, W.; Gong, J.; Li, Q. De Novo Assembly, characterization and comparative transcriptome analysis of the mature gonads in Spinibarbus hollandi. Animals 2022, 13, 166. [Google Scholar] [CrossRef] [PubMed]
  26. Martins, T.; Valentim, A.; Pereira, N.; Antunes, L.M. Anaesthetics and analgesics used in adult fish for research: A review. Lab. Anim. 2019, 53, 325–341. [Google Scholar] [CrossRef] [PubMed]
  27. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644. [Google Scholar] [CrossRef] [PubMed]
  28. Simão, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef] [PubMed]
  29. Wen, G. A simple process of RNA-sequence analyses by Hisat2, Htseq and DESeq2. In Proceedings of the 2017 International Conference on Biomedical Engineering and Bioinformatics, Bangkok, Thailand, 14–16 September 2017; pp. 11–15. [Google Scholar]
  30. Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
  31. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
  32. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  33. Rajakumar, A.; Senthilkumaran, B. Steroidogenesis and its regulation in teleost-a review. Fish. Physiol. Biochem. 2020, 46, 803–818. [Google Scholar] [CrossRef] [PubMed]
  34. Morii, M.; Hebiguchi, T.; Watanabe, R.; Yoshino, H.; Mezaki, Y. Cloning and Characterization of Cyp7a1 and Cyp27a1 Genes from the Non-Parasitic Japanese Lamprey Lethenteron reissneri. Zool. Sci. 2023, 40, 208–218. [Google Scholar] [CrossRef] [PubMed]
  35. Xu, H.; Sun, B.; Jia, L.; Wei, Y.; Liao, Z.; Liang, M. Cloning and characterization of cholesterol 25-hydroxylase (ch25h) from a marine teleost, Chinese tongue sole (Cynoglossus semilaevis), and its gene expressions in response to dietary arachidonic acid. Front. Mar. Sci. 2020, 6, 800. [Google Scholar] [CrossRef]
  36. Shih, M.-C.M.; Chiu, Y.-N.; Hu, M.-C.; Guo, I.-C.; Chung, B.-C. Regulation of steroid production: Analysis of Cyp11a1 promoter. Mol. Cell. Endocrinol. 2011, 336, 80–84. [Google Scholar] [CrossRef] [PubMed]
  37. Goetz, F.W.; Norberg, B.; McCauley, L.A.; Iliev, D.B. Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2004, 137, 351–362. [Google Scholar] [CrossRef] [PubMed]
  38. Yu, X.; Wu, L.; Xie, L.; Yang, S.; Charkraborty, T.; Shi, H.; Wang, D.; Zhou, L. Characterization of two paralogous StAR genes in a teleost, Nile tilapia (Oreochromis niloticus). Mol. Cell. Endocrinol. 2014, 392, 152–162. [Google Scholar] [CrossRef] [PubMed]
  39. Melamed, P.; Sherwood, N. Hormones and Their Receptors in Fish Reproduction; World Scientific: Singapore, 2005. [Google Scholar]
  40. Suzuki, H.; Ozaki, Y.; Ijiri, S.; Gen, K.; Kazeto, Y. 17β-Hydroxysteroid dehydrogenase type 12a responsible for testicular 11-ketotestosterone synthesis in the Japanese eel, Anguilla japonica. J. Steroid Biochem. Mol. Biol. 2020, 198, 105550. [Google Scholar] [CrossRef] [PubMed]
  41. Suzuki, H.; Ito, R.; Ozaki, Y.; Kazeto, Y. Three types of 17β-hydroxysteroid dehydrogenases involved in Japanese eel ovarian steroidogenesis. Gen. Comp. Endocrinol. 2025, 365, 114697. [Google Scholar] [CrossRef] [PubMed]
  42. Schiffer, L.; Anderko, S.; Hannemann, F.; Eiden-Plach, A.; Bernhardt, R. The CYP11B subfamily. J. Steroid Biochem. Mol. Biol. 2015, 151, 38–51. [Google Scholar] [CrossRef] [PubMed]
  43. Meng, L.; Yu, H.; Ni, F.; Niu, J.; Liu, X.; Wang, X. Roles of two cyp11 genes in sex hormone biosynthesis in Japanese flounder (Paralichthys olivaceus). Mol. Reprod. Dev. 2020, 87, 53–65. [Google Scholar] [CrossRef] [PubMed]
  44. Zhai, G.; Shu, T.; Xia, Y.; Lu, Y.; Shang, G.; Jin, X.; He, J.; Nie, P.; Yin, Z. Characterization of sexual trait development in cyp17a1-deficient zebrafish. Endocrinology 2018, 159, 3549–3562. [Google Scholar] [CrossRef] [PubMed]
  45. Xie, Y.; Wu, C.; Li, Z.; Wu, Z.; Hong, L. Early gonadal development and sex determination in mammal. Int. J. Mol. Sci. 2022, 23, 7500. [Google Scholar] [CrossRef] [PubMed]
  46. Vainio, S.; Heikkilä, M.; Kispert, A.; Chin, N.; McMahon, A.P. Female development in mammals is regulated by Wnt-4 signalling. Nature 1999, 397, 405–409. [Google Scholar] [CrossRef] [PubMed]
  47. Marshall Graves, J.A. Interactions between SRY and SOX genes in mammalian sex determination. Bioessays 1998, 20, 264–269. [Google Scholar] [CrossRef]
  48. Devlin, R.H.; Nagahama, Y. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture 2002, 208, 191–364. [Google Scholar] [CrossRef]
  49. Han, C.; Wang, C.; Ouyang, H.; Zhu, Q.; Huang, J.; Han, L.; Li, S.; Li, G.; Lin, H.; Zhang, Y. Characterization of dmrts and their potential role in gonadal development of mandarin fish (Siniperca chuatsi). Aquac. Rep. 2021, 21, 100802. [Google Scholar] [CrossRef]
  50. Sreenivasan, R.; Jiang, J.; Wang, X.; Bártfai, R.; Kwan, H.Y.; Christoffels, A.; Orbán, L. Gonad differentiation in zebrafish is regulated by the canonical Wnt signaling pathway. Biol. Reprod. 2014, 90, 45. [Google Scholar] [CrossRef] [PubMed]
  51. Zhu, Y.; Cui, Z.; Yang, Y.; Xu, W.; Shao, C.; Fu, X.; Li, Y.; Chen, S. Expression analysis and characterization of dmrt2 in Chinese tongue sole (Cynoglossus semilaevis). Theriogenology 2019, 138, 1–8. [Google Scholar] [CrossRef] [PubMed]
  52. Jiang, N.; Jin, X.; He, J.; Yin, Z. The roles of follistatin 1 in regulation of zebrafish fecundity and sexual differentiation. Biol. Reprod. 2012, 87, 54. [Google Scholar] [CrossRef] [PubMed]
  53. Georges, A.; Auguste, A.; Bessière, L.; Vanet, A.; Todeschini, A.-L.; A Veitia, R. FOXL2: A central transcription factor of the ovary. J. Mol. Endocrinol. 2014, 52, R17–R33. [Google Scholar] [CrossRef] [PubMed]
  54. Fan, Z.; Zou, Y.; Liang, D.; Tan, X.; Jiao, S.; Wu, Z.; Li, J.; Zhang, P.; You, F. Roles of forkhead box protein L2 (foxl2) during gonad differentiation and maintenance in a fish, the olive flounder (Paralichthys olivaceus). Reprod. Fertil. Dev. 2019, 31, 1742–1752. [Google Scholar] [CrossRef] [PubMed]
  55. Crespo, B.; Lan-Chow-Wing, O.; Rocha, A.; Zanuy, S.; Gómez, A. foxl2 and foxl3 are two ancient paralogs that remain fully functional in teleosts. Gen. Comp. Endocrinol. 2013, 194, 81–93. [Google Scholar] [CrossRef] [PubMed]
  56. Paulini, F.; Melo, E.O. The role of oocyte-secreted factors GDF9 and BMP15 in follicular development and oogenesis. Reprod. Domest. Anim. 2011, 46, 354–361. [Google Scholar] [CrossRef] [PubMed]
  57. Feng, R.; Fang, L.; Cheng, Y.; He, X.; Jiang, W.; Dong, R.; Shi, H.; Jiang, D.; Sun, L.; Wang, D. Retinoic acid homeostasis through aldh1a2 and cyp26a1 mediates meiotic entry in Nile tilapia (Oreochromis niloticus). Sci. Rep. 2015, 5, 10131. [Google Scholar] [CrossRef] [PubMed]
  58. Rodríguez-Marí, A.; Cañestro, C.; BreMiller, R.A.; Catchen, J.M.; Yan, Y.-L.; Postlethwait, J.H.; Orban, L. Retinoic acid metabolic genes, meiosis, and gonadal sex differentiation in zebrafish. PLoS ONE 2013, 8, e73951. [Google Scholar] [CrossRef] [PubMed]
  59. Li, M.; Feng, R.; Ma, H.; Dong, R.; Liu, Z.; Jiang, W.; Tao, W.; Wang, D. Retinoic acid triggers meiosis initiation via stra8-dependent pathway in Southern catfish, Silurus meridionalis. Gen. Comp. Endocrinol. 2016, 232, 191–198. [Google Scholar] [CrossRef] [PubMed]
  60. Billmyre, K.K.; Kesler, E.A.; Tsuchiya, D.; Corbin, T.J.; Weaver, K.; Moran, A.; Yu, Z.; Adams, L.; Delventhal, K.; Durnin, M.; et al. SYCP1 head-to-head assembly is required for chromosome synapsis in mouse meiosis. Sci. Adv. 2023, 9, eadi1562. [Google Scholar] [CrossRef] [PubMed]
  61. Olaya, I.; Yilmaz, I.N.; Nour-Kasally, N.; Draper, B.W.; Burgess, S.M. Zebrafish lack a strong meiotic checkpoint response to defects in chromosome synapsis. bioRxiv 2025. [Google Scholar] [CrossRef]
  62. de Vries, S.S.; Baart, E.B.; Dekker, M.; Siezen, A.; de Rooij, D.G.; de Boer, P.; Riele, H.T. Mouse MutS-like protein Msh5 is required for proper chromosome synapsis in male and female meiosis. Genes Dev. 1999, 13, 523–531. [Google Scholar] [CrossRef] [PubMed]
  63. Yang, L.; Li, Y.; Wu, Y.; Sun, S.; Song, Q.; Wei, J.; Sun, L.; Li, M.; Wang, D.; Zhou, L. Rln3a is a prerequisite for spermatogenesis and fertility in male fish. J. Steroid Biochem. Mol. Biol. 2020, 197, 105517. [Google Scholar] [CrossRef] [PubMed]
  64. Feng, C.-W.A.; Spiller, C.; Merriner, D.J.; O’bRyan, M.K.; Bowles, J.; Koopman, P. SOX30 is required for male fertility in mice. Sci. Rep. 2017, 7, 17619. [Google Scholar] [CrossRef] [PubMed]
  65. Roy, A.; Lin, Y.-N.; Agno, J.E.; DeMayo, F.J.; Matzuk, M.M. Absence of tektin 4 causes asthenozoospermia and subfertility in male mice. FASEB J. 2007, 21, 1013–1025. [Google Scholar] [CrossRef] [PubMed]
  66. Zhou, J.; Stein, P.; Leu, N.A.; Chmátal, L.; Xue, J.; Ma, J.; Huang, X.; Lampson, M.A.; Schultz, R.M.; Wang, P.J. Accelerated reproductive aging in females lacking a novel centromere protein SYCP2L. Hum. Mol. Genet. 2015, 24, 6505–6514. [Google Scholar] [CrossRef] [PubMed]
Figure 1. PCA of six samples.
Figure 1. PCA of six samples.
Animals 15 02184 g001
Figure 2. Length distribution of all assembled unigenes of the M. terminalis gonadal transcriptome. The “#” refers to numbers.
Figure 2. Length distribution of all assembled unigenes of the M. terminalis gonadal transcriptome. The “#” refers to numbers.
Animals 15 02184 g002
Figure 3. The species distribution of the results of the Nr annotation.
Figure 3. The species distribution of the results of the Nr annotation.
Animals 15 02184 g003
Figure 4. Gene function classification based on KEGG (A), GO (B), and KOG (C).
Figure 4. Gene function classification based on KEGG (A), GO (B), and KOG (C).
Animals 15 02184 g004
Figure 5. DEGs in testis and ovary samples. (A) Number of DEGs. (B) Volcano plot of DEGs. The red, blue, and gray dots, respectively, represent significantly upregulated genes, significantly downregulated genes, and genes without significant expression difference in testes.
Figure 5. DEGs in testis and ovary samples. (A) Number of DEGs. (B) Volcano plot of DEGs. The red, blue, and gray dots, respectively, represent significantly upregulated genes, significantly downregulated genes, and genes without significant expression difference in testes.
Animals 15 02184 g005
Figure 6. Top 25 KEGG enrichment analysis. The horizontal axis is the ratio of the number of differential genes annotated to the KEGG pathway to the total number of differential genes. The vertical is the enriched KEGG pathways. The size of the dots represents the number of genes annotated on the KEGG pathway term. The color key, from red to blue, represents significant enrichment.
Figure 6. Top 25 KEGG enrichment analysis. The horizontal axis is the ratio of the number of differential genes annotated to the KEGG pathway to the total number of differential genes. The vertical is the enriched KEGG pathways. The size of the dots represents the number of genes annotated on the KEGG pathway term. The color key, from red to blue, represents significant enrichment.
Animals 15 02184 g006
Figure 7. Validation of transcriptomic data by qRT-PCR. T: testis; O: ovary.
Figure 7. Validation of transcriptomic data by qRT-PCR. T: testis; O: ovary.
Animals 15 02184 g007
Figure 8. Testis (A) and ovary (B) histology. IC: Interstitial cells; ST: spermatid; SP: sperm; OC: Oocyte; YG: Yolk granules; YV: Yolk vacuoles.
Figure 8. Testis (A) and ovary (B) histology. IC: Interstitial cells; ST: spermatid; SP: sperm; OC: Oocyte; YG: Yolk granules; YV: Yolk vacuoles.
Animals 15 02184 g008
Table 1. Primers used for qRT-PCR.
Table 1. Primers used for qRT-PCR.
Gene IDGeneSequence (5′-3′)Product Size (bp)
Unigene0048221β-actinF: ACCACGGCCGAAAGAGAAAT97
R: AAGATGAGGCAGCAGTTCCC
Unigene0006630cyp27a1F: GATTGTTGTGCGTGCACTGT135
R: AGCGCTGAGGAATACGGATG
Unigene0010781ch25hF: TGGGCTGCCACCCATTTAG99
R: GATGCAGTGCCCAAGGAAAG
Unigene0002701cyp11a1F: GGTCTGTACGCTATGGGTCG102
R: CAGGCTCCTGAAGTAGTGGC
Unigene0056686starF: TGGTTACACACGAGGTGTCG115
R: GCAGCTCCGCCCAAATAAAC
Unigene0029504hsd17b12aF: GCTGGCGTTGTTTCTGTTGT130
R: TTTCCCAATCCCATCCGTGG
Unigene0059133hsd17b1F: ACGGACGAATCCTTGTGACC112
R: ATAGCCAGGCTCTCACATGC
Unigene0098050cyp11bF: AGGACTTCTGCCGTTCACTG140
R: TTCTCCGTACAGAACGTGGC
Unigene0097311dmrt1F: AACCACGGATTCGTGTCTCC106
R: CCATGACCCGCTGTCTTTCA
Unigene0055493dmrt2F: GCAGGTAGATGTGACCCACC107
R: CTGGAGCTTCATCCGTCCTC
Unigene0061978foxl2F: ATAACTCGTGGTCTCCTGCG126
R: TCTGCACACGCGAATATGGG
Unigene0081098cyp26a1F: AATTGGGCATCTACTCGCCT142
R: TCAAAGGTTTTGAGCGCCAC
Unigene0045041sycp1F: GCTGAAGTCAACGCAAGCAA128
R: GAAACGGGTGTCCTCAAGGT
Unigene0030921rln3F: ACCGAGAGACTTCGGAGTGA124
R: ATACGAGTCCAGGAGCCAGT
Unigene0005965gdf9F: TGTACCTCAACGACACCAGC146
R: GGTGCCCTTTAGGGTTCCTC
Unigene0002552bmp15F: TCACTGGATCATTGCACCCC94
R: GTGGTTGGGCGAATTGTAGC
Unigene0089400zp3F: CAGTGGCAAAACTGACGTGG95
R: GTTGGGAGGGATAGGATGCG
Table 2. Summary statistics of the gonadal RNA-seq data.
Table 2. Summary statistics of the gonadal RNA-seq data.
SampleReads NumberTotal BaseQ20(%)Q30(%)GC Content(%)
ovary-153,679,5727,989,217,22599.2697.2946.52
ovary-244,297,6626,605,257,41699.2797.3545.90
ovary-343,255,1246,449,759,68199.2797.3446.73
testis-150,405,0487,516,704,07799.3197.4945.78
testis-238,698,7065,779,517,82399.2697.3145.81
testis-345,877,3366,839,458,85299.2897.3945.63
Mean46,035,5756,863,319,17999.2897.3646.06
Total276,213,44841,179,915,074
Table 3. Summary statistics of gonadal transcriptome assembly and annotation.
Table 3. Summary statistics of gonadal transcriptome assembly and annotation.
TypeDatabaseNumber
AssemblyGene number (#)84,886
Total length (nt)92,262,782
Average length (nt)1086
Max length (nt)20,142
Min length (nt)201
N50 (nt)2238
Total number of unigenes42,322
Unigenes match against Nr40,529
AnnotationUnigenes match against SwissProt25,877
Unigenes match against KEGG25,801
Unigenes match against GO25,055
Unigenes match against KOG 20,139
Table 4. The patterns of DEGs related to reproduction, gonad development, and differentiation (Testis_vs_Ovary).
Table 4. The patterns of DEGs related to reproduction, gonad development, and differentiation (Testis_vs_Ovary).
IDlog2(FC)p-ValueFDRNr AnnotationGene Name
Unigene00918131.6443.31 × 10−43.05 × 10−3adenylate cyclase type 5adcy5
Unigene00508312.9336.84 × 10−71.27 × 10−5apolipoprotein Ebapoeb
Unigene00810174.6381.39 × 10−41.42 × 10−3beta-carotene oxygenase1 likebco1
Unigene00930287.0661.15 × 10−346.04 × 10−32beta-carotene oxygenase 2bbco2b
Unigene0002552−3.9394.31 × 10−206.08 × 10−18bone morphogenetic protein 15bmp15
Unigene00328036.4719.54 × 10−167.84 × 10−14bone morphogenetic protein 8 A-likebmp8a
Unigene00107812.2195.12 × 10−33.17 × 10−2cholesterol 25-hydroxylase-like proteinch25h
Unigene0002701−3.0994.51 × 10−66.92 × 10−5cholesterol side-chain cleavage enzyme, mitochondrialcyp11a1
Unigene00980506.2937.30 × 10−144.69 × 10−12cytochrome P45011B, mitochondrialcyp11b
Unigene0047166−2.8294.12 × 10−66.40 × 10−5teroid 17-alpha-hydroxylase/17, 20lyasecyp17a1
Unigene0004230−5.3691.48 × 10−141.04 × 10−12Aromatasecyp19a1a
Unigene0081098−4.4272.00 × 10−318.18 × 10−29cytochrome P45026A1cyp26a1
Unigene00610966.1824.75 × 10−67.23 × 10−5cytochrome P45026C1cyp26b1
Unigene00066302.9137.94 × 10−58.72 × 10−4sterol 26-hydroxylase, mitochondrialcyp27a1
Unigene00266632.4045.64 × 10−81.32 × 10−6daz-associated protein 1dazap1
Unigene00529972.3264.64 × 10−67.07 × 10−5deleted in azoospermia-likedazl
Unigene0059765−1.2663.88 × 10−43.50 × 10−3putative ATP-dependent RNA helicase DDX5ddx5
Unigene0055695−2.3183.91 × 10−89.44 × 10−7probable ATP-dependent RNA helicase DDX52ddx52
Unigene00973117.8101.39 × 10−481.74 × 10−45doublesex-and mab-3-related transcription factor 1dmrt1
Unigene00554932.0637.38 × 10−34.29 × 10−2doublesex-and mab-3-related transcription factor 2bdmrt2
Unigene00107116.1541.57 × 10−73.36 × 10−6doublesex-and mab-3-related transcription factor 3admrt3a
Unigene0090348−3.9913.16 × 10−111.34 × 10−9estrogen receptoresr1
Unigene00836325.4111.27 × 10−41.31 × 10−3fibroblast growth factor 10bfgf10
Unigene00973403.6382.46 × 10−97.47 × 10−8fibroblast growth factor 12fgf12
Unigene00532172.2823.88 × 10−32.51 × 10−2fibroblast growth factor 13fgf13
Unigene00549444.5541.83 × 10−131.11 × 10−11fibroblast growth factor 14fgf14
Unigene00450813.5974.88 × 10−44.26 × 10−3fibroblast growth factor 18afgf18
Unigene00200296.4528.78 × 10−59.51 × 10−4fibroblast growth factor 20afgf20
Unigene00128887.2883.04 × 10−64.87 × 10−5fibroblast growth factor 5fgf5
Unigene00150614.7182.15 × 10−42.09 × 10−3fibroblast growth factor 7fgf7
Unigene00565153.2227.83 × 10−61.13 × 10−4fibroblast growth factor 8fgf8a
Unigene00437759.7582.25 × 10−42.17 × 10−3fibroblast growth factor 8bfgf8b
Unigene0061978−5.0614.58 × 10−111.89 × 10−9forkhead box protein L2afoxl2
Unigene00679563.5961.22 × 10−39.36 × 10−3Follistatin afsta
Unigene0005965−3.9246.18 × 10−197.55 × 10−17growth/differentiation factor 9gdf9
Unigene00367722.3724.96 × 10−67.51 × 10−53-hydroxy-3-methylglutaryl-CoA reductase-Ahmgcr
Unigene0059133−4.9304.35 × 10−249.78 × 10−22estradiol 17-beta-dehydrogenase 1hsd17b1
Unigene0029504−4.2994.34 × 10−281.35 × 10−25very-long-chain 3-oxoacyl-CoA reductase-Ahsd17b12a
Unigene00781122.0753.52 × 10−32.32 × 10−2branched-chain-amino-acid aminotransferase, mitochondrialhsd17b14
Unigene0094765−2.0107.06 × 10−71.31 × 10−5low-density lipoprotein receptor adapter protein 1aldlrap1
Unigene00890258.4172.24 × 10−341.15 × 10−31mutS protein homolog 5msh5
Unigene00907612.5021.61 × 10−41.62 × 10−3nuclear receptor subfamily 1, group D, member 4anr1d4a
Unigene00916652.1275.11 × 10−79.77 × 10−6glucocorticoid receptornr3c1
Unigene00760311.6982.07 × 10−31.48 × 10−2mineralocorticoid receptornr3c2
Unigene00451484.1841.23 × 10−72.70 × 10−6proprotein convertase subtilisin/kexintype5pcsk5
Unigene00309214.2504.48 × 10−66.88 × 10−5prorelaxin H1rln3
Unigene00038161.4934.63 × 10−32.91 × 10−2retinoid x receptor, betarxrba
Unigene00571442.0521.87 × 10−31.35 × 10−2retinoic acid receptor RXR-beta-Brxrbb
Unigene00602965.6307.98 × 10−272.23 × 10−24transcription factor SOX-30-likesox30
Unigene0056686−3.3702.19 × 10−74.56 × 10−6steroidogenic acute regulatory protein, mitochondrialstar
Unigene00450414.8452.12 × 10−131.27 × 10−11synaptonemal complex protein 1sycp1
Unigene0013279−7.9543.33 × 10−607.20 × 10−57synaptonemal complex protein 2-likesycp2l
Unigene003457810.6932.07 × 10−74.32 × 10−6tektin-4tekt4
Unigene00084142.8687.65 × 10−58.44 × 10−4transforming growth factor beta-2 proproteintgf-β2
Unigene0068547−1.1093.88 × 10−32.51 × 10−2transforming growth factor beta receptor-associated protein 1 homologtgf-βrap1
Unigene0089400−8.4674.99 × 10−732.22 × 10−69zona pellucida sperm-binding protein 3-likezp3
Unigene0017634−8.6478.75 × 10−479.72 × 10−44zona pellucida sperm-binding protein 4-likezp4
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhou, Y.; Liang, W.; Wang, K.; Zheng, P.; Lin, S.; Yang, H.; Cai, G.; Deng, Z.; Han, C.; Li, Q. De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Mature Gonads in Megalobrama terminalis. Animals 2025, 15, 2184. https://doi.org/10.3390/ani15152184

AMA Style

Zhou Y, Liang W, Wang K, Zheng P, Lin S, Yang H, Cai G, Deng Z, Han C, Li Q. De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Mature Gonads in Megalobrama terminalis. Animals. 2025; 15(15):2184. https://doi.org/10.3390/ani15152184

Chicago/Turabian Style

Zhou, Yicheng, Weiqian Liang, Kaifeng Wang, Peng Zheng, Shengyue Lin, Haiying Yang, Guojun Cai, Ziyan Deng, Chong Han, and Qiang Li. 2025. "De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Mature Gonads in Megalobrama terminalis" Animals 15, no. 15: 2184. https://doi.org/10.3390/ani15152184

APA Style

Zhou, Y., Liang, W., Wang, K., Zheng, P., Lin, S., Yang, H., Cai, G., Deng, Z., Han, C., & Li, Q. (2025). De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Mature Gonads in Megalobrama terminalis. Animals, 15(15), 2184. https://doi.org/10.3390/ani15152184

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop