Next Article in Journal
A Novel Echocardiographic Index (Modified-Left-Atrium-to-Aorta Ratio) for Quantifying Left Atrial Size and Differentiating Stages in Dogs with Myxomatous Mitral Valve Disease
Previous Article in Journal
Effects of Biological Characteristics and Environmental Factors on Swimming Performance of Endemic Fish in Southwest China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 12
10.3390/ani15121814
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes

by
Cheng-Yan Li
1,2,†,
Yueh-Tung Chen
1,2,3,†,
Tossapol Moonmanee
4,5,
Jacky Peng-Wen Chan
6,*,‡ and
Chien-Kai Wang
1,2,*,‡
1
Department of Animal Science, National Chung Hsing University, Taichung 402202, Taiwan
2
The iEGG and Animal Biotechnology Center, National Chung Hsing University, Taichung 402202, Taiwan
3
Northern Region Branch, Taiwan Livestock Research Institute, Ministry of Agriculture, Miaoli 368003, Taiwan
4
Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
5
Functional Feed Innovation Center, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
6
Department of Veterinary Medicine, National Chung Hsing University, Taichung 402202, Taiwan
*
Authors to whom correspondence should be addressed.
†
These first authors contributed equally to this work.
‡
These corresponding authors contributed equally to this work.
Animals 2025, 15(12), 1814; https://doi.org/10.3390/ani15121814
Submission received: 4 May 2025 / Revised: 13 June 2025 / Accepted: 17 June 2025 / Published: 19 June 2025
(This article belongs to the Section Cattle)
Browse Figure
Versions Notes

Simple Summary

To simulate the immune status of dairy cows during the transition period, 1 mM non-esterified fatty acids (NEFAs) were used to induce inflammatory responses and oxidative stress in bovine immune cells. Choline supplementation was used to evaluate its potential modulatory effects. NEFA stimulation appeared to elevate the expression of pro-inflammatory cytokines at mRNA levels, along with the increased production of oxidative stress markers such as malondialdehyde (MDA). Choline supplementation significantly reduced MDA in both peripheral blood mononuclear cells (PBMCs) and polymorphonuclear leukocytes (PMNs). These observations suggest that choline might exert an alleviating effect on NEFA-induced oxidative stress, but not on pro-inflammatory cytokine expression in bovine leukocytes. Therefore, this study suggests that choline may serve as a functional supplement to alleviate oxidative stress in transition cows, supporting herd health and potentially improving overall productivity.

Abstract

The transition period is defined as 3 weeks around parturition, involving the rapid increase in the energy demand, promoting adipose mobilization and non-esterified fatty acid (NEFA) release. High NEFA levels might cause oxidative stress and associated health risks, including the disruption of the immune capability of peripheral leukocytes. Nutrient supplementation of choline, which improves cellular lipid metabolism and controls lipid oxidation, potentially maintains the integrity of peripheral leukocytes and alleviates the impacts of increased NEFAs. This study investigated the effects of choline on bovine peripheral blood leukocytes (PBLs) treated with high levels of NEFAs. Peripheral blood mononuclear cells (PBMCs) and polymorphonuclear leukocytes (PMNs) were isolated from dry cows, and treated with 1 mM NEFA in combination with 0, 4, or 12 μM choline. The expression of pro-inflammatory cytokines and oxidative stress indicators was determined. This study demonstrates that 1 mM NEFA induces lipid oxidation and pro-inflammatory cytokine expression in PBLs. Supplementation with 4 μM and 12 μM choline significantly reduced NEFA-induced lipid oxidation; however, it did not affect pro-inflammatory cytokine mRNA expression. In conclusion, choline supplementation may help alleviate NEFA-induced oxidative stress in bovine peripheral blood leukocytes, highlighting its potential as a functional supplement during the transition period. However, it had no observable effect on mitigating pro-inflammatory responses, indicating that additional strategies may be needed to address NEFA-induced immune activation.

1. Introduction

The transition period of dairy cows is generally defined as three weeks before to three weeks after parturition. In this period, cows move from pregnancy and the dry period to substantial milk production. Therefore, cows experience significant physiological changes and health risks during this period [1]. During this period, dairy cows often experience a reduction in feed intake. However, to meet the increasing energy demands associated with rapid fetal development and lactation, cows might mobilize body fat reserves, which results in a state of negative energy balance (NEB). NEB results in elevated levels of serum non-esterified fatty acids (NEFAs) to satisfy the energy demands. NEFAs are free fatty acids that are not bound with glycerol. When dietary energy intake is insufficient to meet physiological demands, NEFAs are released from adipose tissue into the bloodstream through lipolysis. As the major component of triglycerides, NEFAs are mobilized during NEB to provide alternative energy substrates, primarily for hepatic β-oxidation and ketogenesis [2]. Therefore, circulating NEFA concentrations reflect the extent of fat mobilization and serve as a reliable biomarker of NEB status in dairy cows [3]. During the lactation and dry periods, the serum levels of NEFAs are less than 0.2 mM, while during the transition period, NEFA is gradually increased to 0.5 to 1 mM [4]. After parturition, NEFA reaches a peak of approximately 0.8 to 1.2 mM [3]. If NEFA levels in the prepartum period is higher than 0.5–1 mM, it is associated with an increased risk of postpartum placental retention and metritis [5]. Elevated NEFA concentrations serve as indicators of excessive lipid mobilization and negative energy balance, both of which are associated with metabolic disorders and immune disruptions in dairy cattle [6,7]. These disruptions impair the function of peripheral blood leukocytes (PBLs), reducing their amounts and capacity to proliferate, migrate, and phagocytose pathogens effectively [8,9,10], and it has been confirmed that NEFAs can induce oxidative stress and inflammation in bovine PBLs [11]. Therefore, the inflammatory responses, combined with oxidative stress, compromise immune regulation, making cows more susceptible to health risks of mastitis, metritis, and metabolic disorders, including fatty liver and ketosis [12].
Elevated serum NEFA levels under severe negative energy balance (NEB) may activate inflammatory signaling pathways through Toll-like receptor 4 (TLR4) and nuclear factor kappa B (NF-κB), leading to the increased production of pro-inflammatory cytokines such as interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-α (TNF-α) [13,14,15,16,17]. This excessive inflammatory response disrupts immune homeostasis during the transition period and contributes to oxidative stress, leukocyte dysfunction, and tissue damage [18,19]. Consequently, elevated NEFA concentrations impair immune regulation and increase disease susceptibility in periparturient dairy cows [20,21,22,23].
Choline plays a crucial role in alleviating oxidative stress and inflammatory responses [24]. As a precursor for phosphatidylcholine, a vital component of cell membranes, choline supports cellular membrane integrity and prevents lipid peroxidation [25,26]. Although choline is present in the diet and can be synthesized endogenously, increased demand during the transition period and insufficient intake of precursors may limit endogenous production, making choline potentially limiting during high-demand periods such as the transition period. Therefore, choline supplements in the diet of dairy cows could be a crucial method to promote lipid metabolism [27,28]. While choline has been shown to influence lipid metabolism in hepatic cells [29], its role in immune regulation remains less defined. Previous evidence suggested that NEFA might accumulate during NEB, activating immune responses through pattern recognition receptors such as TLR4, initiating downstream inflammatory pathways [14,15]. Together, the supplement of choline may have beneficial effects on cows during the transition period. However, the exact mechanisms by which NEFAs regulate immune function in bovine leukocytes remain unclear. On the other hand, it is not clear whether oxidative stress is involved in the immune modulation. Therefore, in this study, choline was used as a potential modulator to evaluate whether it could mitigate NEFA-induced immune responses and oxidative stress in bovine peripheral blood leukocytes in vitro.
The primary objective of this study is to investigate the effects of choline on bovine PBMCs and PMNs exposed to NEFAs, a condition associated with severe NEB during the transition period. Oxidative stress and pro-inflammatory cytokine expression induced by NEFAs in choline-treated bovine PBMCs and PMNs were evaluated to elucidate the protective role of choline against NEFAs.

2. Materials and Methods

2.1. Animals and PBMC and PMN Isolation

This study was conducted from 2021 to 2022 and was approved by the IACUC of the National University (Certificate No. IACUC-109-150). Blood samples were collected from healthy Holstein cows (parities 2–3), with an average body weight of approximately 650 ± 25 kg and a body condition score (BCS) ranging from 3.0 to 3.5, at the National Chung Hsing University farm. Cows were housed in free-stall facilities, milked twice daily, and fed a diet of 50% Bermuda hay, 50% Pangola hay, and 1.5 kg of concentrate feed (20.4% crude protein and 20.3% neutral detergent fiber) twice daily. In order to minimize the metabolic disruption during the prepartum period (4 weeks before the expected calving day) and the drying-off period (8 weeks before the expected calving day), the blood samples were collected from cows during the 4–6 weeks before the calving day. The serum NEFA levels remained stable during the 4–6 week period before calving [30]. Blood (100 mL) was drawn 4–6 weeks prepartum into EDTA-coated tubes and processed within 2 hr. Samples were maintained at 4 °C during transport. Blood samples were diluted 1:1 with 1X Hank’s Balanced Salt Solution (HBSS) (No. 14175095, Thermo Fisher Scientific, Waltham, MA, USA) at room temperature. PBMCs and PMNs were isolated by density gradient centrifugation using Lymphoprep TM 1.077 (No. 1114547, Axis-Shield, Oslo, Norway). After 400× g 30 min centrifugation, the PBMCs were collected from the buffy coat layer located at the ficoll interface. Erythrocytes were removed by lysis buffer, according to Horn et al. (2008) [31], with a fivefold volume of erythrocyte lysis buffer, comprising 8.26 g ammonium chloride (12125-02-9, Honeywell International Inc., Charlotte, CA, USA), 1 g potassium bicarbonate (40195, Alfa Aesar, Haverhill, MA, USA), and 0.037 g Ethylenediaminetetraacetic acid (E6635, Sigma-Aldrich, Saint Louis, MO, USA) dissolved in 1 L deionized distilled water), and cells were washed with HBSS. The viability of the purified PBMCs and PMNs were detected to ensure ≥95%, and to confirm that the cell sizes of the PBMCs were within 7–9 µm and PMNs were within 10–12 µm. The cells were resuspended in CMRL medium, w/o choline chloride medium (C5900-07, USBiological, Salem, MA, USA), for subsequent experiments.

2.2. Immune Cell Culture and NEFA–Choline Treatment

Isolated PBMC or PMN cells were cultured as the control group in choline-free CMRL-1066 medium supplemented with 1% penicillin–streptomycin (Biological Industries, Beit HaEmek, Israel), 2% bovine serum albumin (A8806, Sigma-Aldrich, St. Louis, MO, USA), and 0.2% sodium bicarbonate (SO01310500, Scharlab S. L., Barcelona, Spain), without the addition of either NEFA or choline. To prevent disruption from the choline in the medium, the choline-free CMRL-1066 medium was chosen to culture the PBMC and PMN cells [32]. A NEFA stock solution containing 34.35 mM oleic acid (O1383, Sigma-Aldrich, Saint Louis, MO, USA), 25.2 mM palmitic acid (P0500, Sigma-Aldrich, Saint Louis, USA), and 11.4 mM stearic acid (S4751, Sigma-Aldrich, Saint Louis, MO, USA) was prepared and filtered with a 0.45 μm PVDF filter (SLHVR33RS, Millipore, Billerica, MA, USA) for sterility [33]. To clearly investigate the effects of choline on bovine immune cells, a choline-free culture medium was used in this study. In addition, since the physiological concentration of choline in dairy cows is approximately 4 µM [32], 4 µM was used to simulate normal physiological conditions, while 12 µM choline was used to mimic the supplementation of dietary choline. Choline chloride (C7527, ≥98.5% purity; Sigma-Aldrich, Darmstadt, Germany) was used to prepare the working solutions. The stock solution was freshly prepared by dissolving choline chloride in sterile distilled water and filtered through a 0.22 µm syringe filter for sterility. The stock solutions were stored at 4 °C and diluted in choline-free medium to achieve final concentrations of 4 µM and 12 µM for the treatments. PBMCs and PMNs were cultured at 4 × 107 cells/well in 6-well plates (351146, Falcon, Corning Inc., New York, NY, USA) and treated with NEFA and/or choline. As mentioned above, during the transition period, the NEFA concentration may increase to 1 mM [34]. Therefore, according to Garica et al. (2018) [32], we pretreated choline for 2 h. We supplied 1 mM NEFA for 12 h to simulate in vivo conditions during this period, based on Li et al. (2024) [11]. After incubation, cells and supernatants were collected for analysis (Figure 1). Each analysis performed in this study is in triplicate.

2.3. Oxidative Stress Measurement

Protein concentrations were determined by a BSA standard curve (0–0.5 mg/mL) prepared via the serial dilution of a 10 mg/mL stock solution. Samples or standards (10 μL) were mixed with 190 μL of 1× Bio-Rad protein assay reagent (500-0006, Bio-Rad, Hercules, CA, USA) in a 96-well plate. After shaking for 5 min to eliminate the bubbles, absorbance was measured at OD 595 nm. A linear regression curve was generated (R2 > 0.99), and sample protein concentrations were calculated accordingly for SOD activity normalization.
SOD was measured by using the Superoxide Dismutase Assay Kit (706002, Cayman Chemical, Ann Arbor, MI, USA). This assay is based on the generation of superoxide radicals through the reaction of xanthine oxidase and hypoxanthine, which were subsequently detected by the reduction of tetrazolium salt to formazan dye. Then, we added a diluted radical detector and xanthine oxidase to the prepared cell lysates, and incubated the samples on a shaker and protected from light for 30 min. After incubation, the absorbance was measured at optical density (OD) 450 nm using a microplate reader, and then plotted against a standard curve to calculate the SOD activity.
Malondialdehyde (MDA), a product of lipid peroxidation, was used as a marker of oxidative stress and quantified using the Thiobarbituric Acid Reactive Substances (TBARS) Assay Kit (10009055, Cayman Chemical, Ann Arbor, MI, USA). The color reagent and the samples were added to vials and incubated in a water bath at 100 °C for 1 h. After incubation, the vials were cooled on ice for 10 min and centrifuged at 1600× g for 10 min; then, the supernatant was collected, and was left to equilibrate at room temperature for 30 min. A 150 µL aliquot of the supernatant was transferred to a 96-well plate, and the absorbance was measured immediately at OD 530 nm, and then plotted against a standard curve to calculate the MDA concentration.

2.4. Cytokine Expression by Real-Time PCR

Total RNA was extracted from the PBMCs and PMNs using TRIzol Reagent (15596023, Invitrogen, Carlsbad, CA, USA). The RNA purity and concentration were assessed using a spectrophotometer, ensuring a 260/280 nm ratio of 1.8–2.0. Reverse transcription was performed using the SuperScript IV Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA). The synthesized cDNA was stored at −80 °C. The real-time quantitative polymerase chain reaction (qPCR) mixture included iTaqTM Universal SYBR ® Green Supermix (Bio-Rad, Bio-Rad Laboratories, Hercules, CA, USA) so to confirm the gene expression in treatments. Gene expression levels were analyzed using the ΔΔCT method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene (Table 1). The results provided insights into the changes in pro-inflammatory-related gene expression under NEFA stimulation and choline incubation.

2.5. Statistics

IBM SPSS Statistics 29 (IBM, New York, NY, USA) was used for statistical analysis. Data are presented as mean ± standard error (SE). The MDA concentration, SOD activity, and mRNA expression in the control group, NEFA group, and choline-pretreated groups were analyzed using a one-way ANOVA. Differences between treatment groups were evaluated post hoc using the LSD method. Statistical significance was set at p < 0.05, indicating significant differences.

3. Results

3.1. NEFA-Induced Oxidative Stress and Antioxidative Stress Effects of Choline

To determine whether 1 mM NEFA induces oxidative stress, the MDA levels and SOD activity were measured in the PBMCs and PMNs following 12 h of exposure. The results showed that 1 mM NEFA significantly increased the MDA levels in the PBMCs by 18% compared to the control group (2.85 ± 0.15 µM vs. 2.41 ± 0.15 µM; p < 0.01). Similarly, in the PMNs, 1 mM NEFA significantly increased the MDA levels (2.34 ± 0.26 µM vs. 1.69 ± 0.18 µM; p < 0.05). However, NEFA did not significantly affect the SOD activity in either the PBMCs or PMNs (p > 0.05) (Table 2).
Pre-incubation with 4 µM or 12 µM choline significantly reduced the NEFA-induced MDA levels in the PBMCs by 20 and 32% (p < 0.05), and in the PMNs by 5 and 27%, respectively (p < 0.05). Notably, choline restored both the PBMC and PMN MDA levels to control levels (p > 0.05). Choline pretreatment, however, did not affect the SOD activity in either cell type under NEFA stimulation (p > 0.05). These findings demonstrated that NEFA induced oxidative stress by increasing the MDA levels, which was mitigated by choline supplementation, though the SOD activity remained unaffected.

3.2. NEFA-Induced Inflammatory Cytokine Expression and Effects of Choline

PBMCs and PMNs isolated from cows were treated with 1 mM NEFA for 12 h, and pro-inflammatory cytokine expression was determined using qPCR. The results showed that NEFA significantly increased the mRNA expression of IL-6 (2.76 ± 0.4) and IL-1β (1.78 ± 0.2) in the PBMCs (p < 0.05), while IL-8, IL-10, CSF-1, CSF-2, and CSF- 3 showed no significant changes (p > 0.05). In the PMNs, NEFA significantly induced the mRNA expression of IL-1β (3.27 ± 0.88) and CSF-2 (4.42 ± 1.38) (p < 0.05), but had no significant effect on IL-6, IL-8, IL-10, CSF-1, or CSF-3 (p > 0.05) (Table 3).
To assess the effects of choline, cells were pre-incubated with 4 μM or 12 μM choline for 2 h before NEFA stimulation for 12 h. The results showed that neither 4 μM nor 12 μM choline pretreatment had an effect on inflammatory cytokine mRNA expression in the PBMCs and PMNs. In summary, 1 mM NEFA significantly increased the mRNA expression of inflammation-related cytokine in PBLs. Choline pretreatment did not attenuate NEFA-induced pro-inflammatory cytokine expression in either the PBMCs or PMNs (Table 3).

4. Discussion

NEFA generates ROS through mitochondrial β-oxidation, which might peroxidize lipids, forming MDA, an oxidative stress marker. Increased MDA was observed in the PBMCs, but there were comparatively minimal changes in the PMNs. Research has shown that there were similar PBMC responses [35,36], while PMNs showed limited lipid oxidation [37,38], possibly due to their functional role in pathogen clearance by producing ROS to eliminate pathogens [39]. Overall, these results indicate that PBMCs are more sensitive to NEFA-induced lipid peroxidation than PMNs, which may be due to distinct susceptibilities in their oxidative stress responses. Additionally, 1 mM NEFA did not affect the SOD activity in either cell types after 12 h, aligning with the findings that antioxidant responses may vary depending on stimuli [40,41,42]. Moreover, previous studies showed that bovine hepatocytes stimulated with 1.2 mM NEFA exhibited the lowest SOD activity after 1 h of stimulation, which recovered to the control group after 12 h [42]. Therefore, the stimulation duration may also be an important factor influencing SOD activity. These findings suggest that NEFA induces oxidative stress through lipid oxidation.
Choline’s role in oxidative stress was also investigated. As a precursor for acetylcholine and phosphatidylcholine, choline helps maintain membrane integrity and lipid metabolism [43], and it may help to ease the oxidative stress on cells. Choline has been reported to lower MDA levels and oxidative stress markers [44,45]. In this study, pre-incubation with choline reduced the MDA in the PBMCs and PMNs, indicating that it mitigates NEFA-induced oxidative stress. In cattle mammary epithelial cells, 100 μM choline reduced ROS and MDA under heat stress [46]. However, choline did not affect the SOD activity in NEFA-induced PBMCs or PMNs in this study. This is consistent with studies showing that choline did not affect the SOD or GSH-Px activity in vitro [46,47], but it did enhance their activity under in vivo heat stress conditions [46]. Therefore, choline’s antioxidant enzyme modulation may depend on the type of stress. Overall, choline may serve as a functional nutrient to attenuate NEFA-induced oxidative stress during the transition period.
This study demonstrated the pro-inflammatory responses induced by NEFA treatment in PBMCs and PMNs. NEFA significantly increased IL-1β and IL-6 mRNA expression in the PBMCs, while upregulating IL-1β and CSF-2 in the PMNs. IL-1β and IL-6 are key cytokines involved in acute inflammation. CSF-2 upregulation in PMNs might enhance the expression of pro-inflammatory cytokines such as IL-6 [48], influencing immune cell differentiation and altering immune homeostasis [49]. IL-1β is a pro-inflammatory cytokine that is secreted by various cells, including immune and endothelial cells, enhances immune cell proliferation, and induces the expression of other cytokines [50,51]. IL-6 functions in both pro- and anti-inflammatory responses, stimulating acute-phase protein production [52]. CSF binds to CSF receptors and affects the proliferation and differentiation of neutrophils [53]. CSF-1 acts on monocytes and macrophages, CSF-3 can regulate the proliferation and differentiation of neutrophils [54,55], and CSF-2 acts on macrophages or neutrophils to promote inflammatory responses [56]. Our findings support previous reports that NEFA induces pro-inflammatory cytokine production in a dose-dependent manner [57].
NEFA may activate TLRs and G-protein coupled receptor 40 (GPR40) receptors, triggering NF-κB signaling. Kumolosasi et al. (2014) [58] reported IL-1β upregulation in PBMCs after 4 h of inflammation induction, thereby influencing the CSF family expression. Consistently, NEFA treatment increased IL-1β protein expression [17,59,60,61]. Free fatty acids may also engage receptors, including CD26, IL-15R, programmed death-1 (PD-1), IL-33R, TLRs, IL-6R, IL-4/13R, CD36, fatty acid-binding proteins (FABPs), and free fatty acid receptor-1, thereby activating downstream pathways, including peroxisome proliferator-activated receptors (PPARs), signal transducer and activator of transcription 3 (STAT 3), forkhead box protein P3 (FoxP3), C-MYC, phospholipase C-protein kinase C (PLC/PKC), and sterol regulatory element-binding proteins (SREBPs) [15,62,63,64,65]. These pathways regulate cytokine expression and may underlie the inflammatory effects observed. The exact cellular signaling pathways activated by NEFA to upregulate pro-inflammatory responses in bovine PBMCs and PMNs require further identification.
The role of choline was also examined. In this study, pretreatment with 4 μM or 12 μM choline did not alter the pro-inflammatory cytokine mRNA expression in the NEFA-treated PBMCs and PMNs. Vailati-Riboni et al. (2017) reported that choline supplementation in dairy cows, whether supplied prepartum or postpartum, did not significantly affect the plasma concentrations of pro-inflammatory cytokines such as IL-1β and IL-6 [66]. Similar findings were reported by Zhou et al. (2016) and Swartz et al. (2023) [67,68]. In vitro evidence from Garcia et al. (2018) showed that choline supplementation in PMNs did not significantly affect the inflammatory cytokine mRNA expression, including NF-κB and TNF-α [32], but upregulated the genes involved in choline metabolism. Compared to methionine, choline may exhibit weaker anti-inflammatory effects due to its need for metabolic conversion. In vivo, choline is converted into bioactive forms like acetylcholine and phosphatidylcholine [25,69,70,71], possibly enhancing its function. In contrast, in vitro systems may require higher choline concentrations to observe similar effects [72].
Oxidative stress was indicated by the production of MDA. MDAs are by-products of lipid peroxidation, initiated by ROS attacking polyunsaturated fatty acids [73]. While oxidative stress reflects damage from ROS, inflammation involves immune receptor activation and cytokine production through the NF-κB and MAPK pathways [15,40]. TBARS indicates oxidative damage endpoints, while inflammation reflects signaling responses. These are related but distinct biological processes [74]. However, oxidative stress and inflammation may interact with each other. For example, ROS might activate cell signaling pathways such as NF-κB, leading to the production of pro-inflammatory cytokines [75]. Therefore, oxidative stress may be associated with inflammatory responses, even though their initial triggers and regulatory mechanisms are different.
Choline supplementation showed its potential in alleviating NEFA-induced disruption in bovine PBLs. NEFA, which is elevated during the transition period, affects cytokine expression and immune regulation [33,76]. In vitro, choline reduced lipid oxidation, suggesting its use in preserving the functionality of PBLs under NEFA stress. The primary culture of bovine PBLs provides a proper in vitro model for evaluating the immune cell responses in cattle. However, further studies are needed to clarify NEFA-activated signaling pathways and the optimize choline dosage and duration. Moreover, in vivo validation is essential to confirm choline’s role in immune modulation and oxidative stress reduction during the transition period in dairy cows.

5. Conclusions

Choline supplementation at both 4 µM and 12 µM concentrations effectively reduced NEFA-induced lipid peroxidation. However, choline did not attenuate the upregulation of inflammatory cytokine gene expression, suggesting that its protective effects are primarily associated with oxidative stress mitigation rather than immunomodulation. These results highlight choline’s potential as a functional nutrient to alleviate NEFA-induced oxidative damage during the transition period. Although its anti-inflammatory effects were not evident in our study, the antioxidant role of choline might contribute to maintaining immune cell integrity and function in transition-period cows. These results highlight choline’s potential as a functional nutrient to alleviate NEFA-induced oxidative damage during the transition period, but additional strategies may be required to control NEFA-induced inflammatory responses during the transition period.

Author Contributions

Conceptualization, C.-Y.L. and Y.-T.C.; Formal analysis, C.-Y.L.; Resources, C.-K.W.; Investigation, C.-Y.L. and Y.-T.C.; Methodology, C.-Y.L. and Y.-T.C.; Supervision, C.-K.W. and J.P.-W.C.; Validation, C.-Y.L. and C.-K.W.; Visualization, C.-Y.L. and Y.-T.C.; Writing—original draft, C.-Y.L. and Y.-T.C.; Writing—review and editing, T.M., C.-K.W. and J.P.-W.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Technology, Taiwan, under research grant MOST 108-2321-B-005-009, and the iEGG and Animal Biotechnology Center from the Feature Areas Research Center Program within the framework of the Higher Education Sprout Project by the Ministry of Education (MOE-114-S-0023-A) in Taiwan.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of National Chung Hsing University, Taiwan (protocol code: IACUC-109-150; date of approval: 20 January 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Grummer, R.R. Impact of changes in organic nutrient metabolism on feeding the transition dairy cow. J. Anim. Sci. 1995, 73, 2820–2833. [Google Scholar] [CrossRef] [PubMed]
  2. Li, P.; Liu, Y.; Zhang, Y.; Long, M.; Guo, Y.; Wang, Z.; Li, X.; Zhang, C.; Li, X.; He, J. Effect of non-esterified fatty acids on fatty acid metabolism-related genes in calf hepatocytes cultured in vitro. Cell. Physiol. Biochem. 2013, 32, 1509–1516. [Google Scholar] [CrossRef] [PubMed]
  3. Adewuyi, A.; Gruys, E.; Van Eerdenburg, F. Non esterified fatty acids (NEFA) in dairy cattle. A review. Vet. Q. 2005, 27, 117–126. [Google Scholar] [CrossRef] [PubMed]
  4. Contreras, G.; O’boyle, N.; Herdt, T.; Sordillo, L. Lipomobilization in periparturient dairy cows influences the composition of plasma nonesterified fatty acids and leukocyte phospholipid fatty acids. J. Dairy Sci. 2010, 93, 2508–2516. [Google Scholar] [CrossRef]
  5. Chapinal, N.; Carson, M.; Duffield, T.; Capel, M.; Godden, S.; Overton, M.; Santos, J.; LeBlanc, S. The association of serum metabolites with clinical disease during the transition period. J. Dairy Sci. 2011, 94, 4897–4903. [Google Scholar] [CrossRef]
  6. Ospina, P.; Nydam, D.; Stokol, T.; Overton, T. Evaluation of nonesterified fatty acids and β-hydroxybutyrate in transition dairy cattle in the northeastern United States: Critical thresholds for prediction of clinical diseases. J. Dairy Sci. 2010, 93, 546–554. [Google Scholar] [CrossRef]
  7. Sharma, N.; Singh, N.; Singh, O.; Pandey, V.; Verma, P. Oxidative stress and antioxidant status during transition period in dairy cows. Asian-Australas. J. Anim. Sci. 2011, 24, 479–484. [Google Scholar] [CrossRef]
  8. Herr, M.; Bostedt, H.; Failing, K. IgG and IgM levels in dairy cows during the periparturient period. Theriogenology 2011, 75, 377–385. [Google Scholar] [CrossRef]
  9. Saed, H.A.; Ibrahim, H.M.; El-Khodery, S.A.; Youssef, M.A. Relationship between expression pattern of vitamin D receptor, 1 alpha-hydroxylase enzyme, and chemokine RANTES genes and selected serum parameters during transition period in Holstein dairy cows. Vet. Rec. Open 2020, 7, e000339. [Google Scholar] [CrossRef]
  10. Trevisi, E.; Amadori, M.; Archetti, I.; Lacetera, N.; Bertoni, G. Inflammatory response and acute phase proteins in the transition period of high-yielding dairy cows. In Acute Phase Proteins as Early Non-Specific Biomarkers of Human and Veterinary Diseases; Elsevier: Amsterdam, The Netherlands, 2011; Volume 15, pp. 355–379. [Google Scholar]
  11. Li, C.-Y.; Lin, W.-C.; Moonmanee, T.; Chan, J.P.-W.; Wang, C.-K. The protective role of vitamin E against oxidative stress and immunosuppression induced by non-esterified fatty acids in bovine peripheral blood leukocytes. Animals 2024, 14, 1079. [Google Scholar] [CrossRef]
  12. Sordillo, L.; Mavangira, V. The nexus between nutrient metabolism, oxidative stress and inflammation in transition cows. Anim. Prod. Sci. 2014, 54, 1204–1214. [Google Scholar] [CrossRef]
  13. Baeuerle, P.A.; Henkel, T. Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol. 1994, 12, 141–179. [Google Scholar] [CrossRef] [PubMed]
  14. Francaux, M. Toll-like receptor signalling induced by endurance exercise. Appl. Physiol. Nutr. Metab. 2009, 34, 454–458. [Google Scholar] [CrossRef] [PubMed]
  15. Mena, J.; Manosalva, C.; Ramirez, R.; Chandia, L.; Carroza, D.; Loaiza, A.; Burgos, R.A.; Hidalgo, M.A. Linoleic acid increases adhesion, chemotaxis, granule release, intracellular calcium mobilisation, MAPK phosphorylation and gene expression in bovine neutrophils. Vet. Immunol. Immunopathol. 2013, 151, 275–284. [Google Scholar] [CrossRef]
  16. Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
  17. Zhang, Y.; Li, X.; Zhang, H.; Zhao, Z.; Peng, Z.; Wang, Z.; Liu, G.; Li, X. Non-esterified fatty acids over-activate the TLR2/4-NF-κb signaling pathway to increase inflammatory cytokine synthesis in neutrophils from ketotic cows. Cell. Physiol. Biochem. 2018, 48, 827–837. [Google Scholar] [CrossRef]
  18. Bradford, B.; Yuan, K.; Farney, J.; Mamedova, L.; Carpenter, A. Invited review: Inflammation during the transition to lactation: New adventures with an old flame. J. Dairy Sci. 2015, 98, 6631–6650. [Google Scholar] [CrossRef]
  19. Pascottini, O.B.; Van Schyndel, S.; Spricigo, J.; Carvalho, M.; Mion, B.; Ribeiro, E.; LeBlanc, S. Effect of anti-inflammatory treatment on systemic inflammation, immune function, and endometrial health in postpartum dairy cows. Sci. Rep. 2020, 10, 5236. [Google Scholar] [CrossRef]
  20. Crookenden, M.; Heiser, A.; Murray, A.; Dukkipati, V.; Kay, J.; Loor, J.; Meier, S.; Mitchell, M.; Moyes, K.; Walker, C. Parturition in dairy cows temporarily alters the expression of genes in circulating neutrophils. J. Dairy Sci. 2016, 99, 6470–6483. [Google Scholar] [CrossRef]
  21. Hammon, D.; Evjen, I.; Dhiman, T.; Goff, J.; Walters, J. Neutrophil function and energy status in Holstein cows with uterine health disorders. Vet. Immunol. Immunopathol. 2006, 113, 21–29. [Google Scholar] [CrossRef]
  22. Hoeben, D.; Monfardini, E.; Opsomer, G.; Burvenich, C.; Dosogne, H.; De Kruif, A.; Beckers, J.-F. Chemiluminescence of bovine polymorphonuclear leucocytes during the periparturient period and relation with metabolic markers and bovine pregnancy-associated glycoprotein. J. Dairy Res. 2000, 67, 249–259. [Google Scholar] [CrossRef] [PubMed]
  23. Kehrli, M.E., Jr.; Nonnecke, B.J.; Roth, J.A. Alterations in bovine neutrophil function during the periparturient period. Am. J. Vet. Res 1989, 50, 207–214. [Google Scholar] [CrossRef] [PubMed]
  24. Huang, S.-Y.; Yang, Z.-J.; Cheng, J.; Li, H.-Y.; Chen, S.; Huang, Z.-H.; Chen, J.-D.; Xiong, R.-G.; Yang, M.-T.; Wang, C. Choline alleviates cognitive impairment in sleep-deprived young mice via reducing neuroinflammation and altering phospholipidomic profile. Redox Biol. 2025, 81, 103578. [Google Scholar] [CrossRef] [PubMed]
  25. Goselink, R.; Van Baal, J.; Widjaja, H.; Dekker, R.; Zom, R.; De Veth, M.; Van Vuuren, A. Effect of rumen-protected choline supplementation on liver and adipose gene expression during the transition period in dairy cattle. J. Dairy Sci. 2013, 96, 1102–1116. [Google Scholar] [CrossRef]
  26. Yao, N.; Li, W.; Xu, G.; Duan, N.; Yu, G.; Qu, J. Choline metabolism and its implications in cancer. Front. Oncol. 2023, 13, 1234887. [Google Scholar] [CrossRef]
  27. Santos, J.E.P.; Lima, F.S. Feeding rumen-protected choline to transition dairy cows. In Proceedings of the 20th Annual Florida Ruminant Nutrition Symposium, Gainesville, FL, USA, 10–11 February 2009; pp. 10–11. [Google Scholar]
  28. Grummer, R. Choline: A limiting nutrient for transition dairy cows. In Proceedings of the Cornell Nutrition Conference, Ithaca, NY, USA, 17–18 October 2012; pp. 21–28. [Google Scholar]
  29. Jiang, X.; Greenwald, E.; Jack-Roberts, C. Effects of choline on DNA methylation and macronutrient metabolic gene expression in in vitro models of hyperglycemia. Nutr. Metab. Insights 2016, 9, 11–17. [Google Scholar] [CrossRef]
  30. Rastani, R.; Grummer, R.; Bertics, S.; Gümen, A.; Wiltbank, M.; Mashek, D.; Schwab, M. Reducing dry period length to simplify feeding transition cows: Milk production, energy balance, and metabolic profiles. J. Dairy Sci. 2005, 88, 1004–1014. [Google Scholar] [CrossRef]
  31. Horn, P.; Bork, S.; Horn, P.; Bork, S.; Diehlmann, A.; Walenda, T.; Eckstein, V.; Ho, A.; Wagner, W. Isolation of human mesenchymal stromal cells is more efficient by red blood cell lysis. Cytotherapy 2008, 10, 676–685. [Google Scholar] [CrossRef]
  32. Garcia, M.; Mamedova, L.K.; Barton, B.; Bradford, B.J. Choline regulates the function of bovine immune cells and alters the mRNA abundance of enzymes and receptors involved in its metabolism in vitro. Front. Immunol. 2018, 9, 2448. [Google Scholar] [CrossRef]
  33. Ster, C.; Loiselle, M.-C.; Lacasse, P. Effect of postcalving serum nonesterified fatty acids concentration on the functionality of bovine immune cells. J. Dairy Sci. 2012, 95, 708–717. [Google Scholar] [CrossRef]
  34. Grummer, R.R. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 1993, 76, 3882–3896. [Google Scholar] [CrossRef] [PubMed]
  35. Campoio, T.; Oliveira, F.; Otton, R. Oxidative stress in human lymphocytes treated with fatty acid mixture: Role of carotenoid astaxanthin. Toxicology Vitr. 2011, 25, 1448–1456. [Google Scholar] [CrossRef] [PubMed]
  36. Volpe, C.M.O.; Abreu, L.F.M.; Gomes, P.S.; Gonzaga, R.M.; Veloso, C.A.; Nogueira-Machado, J.A. The production of nitric oxide, IL-6, and TNF-alpha in palmitate-stimulated PBMNCs is enhanced through hyperglycemia in diabetes. Oxidative Med. Cell. Longev. 2014, 2014, 479587. [Google Scholar] [CrossRef] [PubMed]
  37. Rayaman, P.; Rayaman, E.; Çevikbas, A.; Demirtunç, R.; Sehirli, A.O.; Gürer, Ü.S. The effect of some antibiotics on Polymorphonuclear Leukocyte (PMN) functions and PMN’S myeloperoxidase activity, glutathione and malondialdehyde levels of patients with type 2 diabetes mellitus in vitro. Clin. Exp. Health Sci. 2013, 3, 200. [Google Scholar]
  38. Reyes-Quiroz, M.E.; Alba, G.; Saenz, J.; Santa-María, C.; Geniz, I.; Jiménez, J.; Ramírez, R.; Martín-Nieto, J.; Pintado, E.; Sobrino, F. Oleic acid modulates mRNA expression of liver X receptor (LXR) and its target genes ABCA1 and SREBP1c in human neutrophils. Eur. J. Nutr. 2014, 53, 1707–1717. [Google Scholar] [CrossRef]
  39. Johansson, Å.C.; Ohlsson, S.; Pettersson, Å.; Bengtsson, A.A.; Selga, D.; Hansson, M.; Hellmark, T. Impaired phagocytosis and reactive oxygen species production in phagocytes is associated with systemic vasculitis. Arthritis Res. Ther. 2016, 18, 92. [Google Scholar] [CrossRef]
  40. Gao, W.; Du, X.; Lei, L.; Wang, H.; Zhang, M.; Wang, Z.; Li, X.; Liu, G.; Li, X. NEFA-induced ROS impaired insulin signalling through the JNK and p38MAPK pathways in non-alcoholic steatohepatitis. J. Cell. Mol. Med. 2018, 22, 3408–3422. [Google Scholar] [CrossRef]
  41. Li, P.; Li, L.; Zhang, C.; Cheng, X.; Zhang, Y.; Guo, Y.; Long, M.; Yang, S.; He, J. Palmitic acid and β-hydroxybutyrate induce inflammatory responses in bovine endometrial cells by activating oxidative stress-mediated NF-κB signaling. Molecules 2019, 24, 2421. [Google Scholar] [CrossRef]
  42. Zhang, B.; Li, M.; Yang, W.; Loor, J.J.; Liang, Y.; Wang, S.; Zhao, Y.; Guo, H.; Ma, X.; Yu, L. Mitochondrial dysfunction and endoplasmic reticulum stress in calf hepatocytes are associated with fatty acid-induced ORAI calcium release-activated calcium modulator 1 signaling. J. Dairy Sci. 2020, 103, 11945–11956. [Google Scholar] [CrossRef]
  43. EFSA Panel on Dietetic Products, Nutrition and Allergies. Scientific Opinion on the substantiation of health claims related to choline and contribution to normal lipid metabolism (ID 3186), maintenance of normal liver function (ID 1501), contribution to normal homocysteine metabolism (ID 3090), maintenance of normal neurological function (ID 1502), contribution to normal cognitive function (ID 1502), and brain and neurological development (ID 1503) pursuant to Article 13 (1) of Regulation (EC) No 1924/2006. Eur. Food Saf. Auth. J. 2011, 9, 2056. [Google Scholar]
  44. Adjoumani, J.J.Y.; Abasubong, K.P.; Phiri, F.; Xu, C.; Liu, W.; Zhang, D. Effect of dietary betaine and choline association on lipid metabolism in blunt snout bream fed a high-fat diet. Aquac. Nutr. 2019, 25, 1017–1027. [Google Scholar] [CrossRef]
  45. Cetinkaya, M.; Cansev, M.; Cekmez, F.; Tayman, C.; Canpolat, F.E.; Kafa, I.M.; Uysal, S.; Tunc, T.; Sarici, S.U. CDP-choline reduces severity of intestinal injury in a neonatal rat model of necrotizing enterocolitis. J. Surg. Res. 2013, 183, 119–128. [Google Scholar] [CrossRef] [PubMed]
  46. Yang, M.; Kuang, M.; Wang, G.; Ali, I.; Tang, Y.; Yang, C.; Li, Y.; Li, L. Choline attenuates heat stress-induced oxidative injury and apoptosis in bovine mammary epithelial cells by modulating PERK/Nrf-2 signaling pathway. Mol. Immunol. 2021, 135, 388–397. [Google Scholar] [CrossRef] [PubMed]
  47. Zhu, J.; Wu, Y.; Tang, Q.; Leng, Y.; Cai, W. The effects of choline on hepatic lipid metabolism, mitochondrial function and antioxidative status in human hepatic C3A cells exposed to excessive energy substrates. Nutrients 2014, 6, 2552–2571. [Google Scholar] [CrossRef]
  48. Shiomi, A.; Usui, T. Pivotal roles of GM-CSF in autoimmunity and inflammation. Mediat. Inflamm. 2015, 2015, 568543. [Google Scholar] [CrossRef]
  49. Bhattacharya, P.; Thiruppathi, M.; Elshabrawy, H.A.; Alharshawi, K.; Kumar, P.; Prabhakar, B.S. GM-CSF: An immune modulatory cytokine that can suppress autoimmunity. Cytokine 2015, 75, 261–271. [Google Scholar] [CrossRef]
  50. Dinarello, C.A. Biologic basis for interleukin-1 in disease. Blood 1996, 87, 2095–2147. [Google Scholar] [CrossRef]
  51. Voronov, E.; Dotan, S.; Krelin, Y.; Song, X.; Elkabets, M.; Carmi, Y.; Rider, P.; Cohen, I.; Romzova, M.; Kaplanov, I. Unique versus redundant functions of IL-1α and IL-1β in the tumor microenvironment. Front. Immunol. 2013, 4, 177. [Google Scholar] [CrossRef]
  52. Gabay, C. Interleukin-6 and chronic inflammation. Arthritis Res. Ther. 2006, 8, S3. [Google Scholar] [CrossRef]
  53. Solaroglu, I.; Cahill, J.; Jadhav, V.; Zhang, J.H. A novel neuroprotectant granulocyte-colony stimulating factor. Stroke 2006, 37, 1123–1128. [Google Scholar] [CrossRef]
  54. Basu, S.; Dunn, A.; Ward, A. G-CSF: Function and modes of action. Int. J. Mol. Med. 2002, 10, 3–10. [Google Scholar] [PubMed]
  55. Chitu, V.; Stanley, E.R. Colony-stimulating factor-1 in immunity and inflammation. Curr. Opin. Immunol. 2006, 18, 39–48. [Google Scholar] [CrossRef] [PubMed]
  56. Hamilton, J.A. GM-CSF in inflammation. J. Exp. Med. 2019, 217, e20190945. [Google Scholar] [CrossRef] [PubMed]
  57. Li, C.-Y.; Liao, Y.-W.; Liu, C.-S.; Cheng, C.-Y.; Chan, J.P.-W.; Wang, C.-K. In vitro effects of nonesterified fatty acids and β-hydroxybutyric acid on inflammatory cytokine expression in bovine peripheral blood leukocytes. Ital. J. Anim. Sci. 2021, 20, 2197–2210. [Google Scholar] [CrossRef]
  58. Kumolosasi, E.; Salim, E.; Jantan, I.; Ahmad, W. Kinetics of intracellular, extracellular and production of pro-inflammatory cytokines in lipopolysaccharide-stimulated human peripheral blood mononuclear cells. Trop. J. Pharm. Res. 2014, 13, 536–543. [Google Scholar] [CrossRef]
  59. Ma, X.-Z.; Pang, Z.-D.; Wang, J.-H.; Song, Z.; Zhao, L.-M.; Du, X.-J.; Deng, X.-L. The role and mechanism of KCa3. 1 channels in human monocyte migration induced by palmitic acid. Exp. Cell Res. 2018, 369, 208–217. [Google Scholar] [CrossRef]
  60. Tian, H.; Liu, C.; Zou, X.; Wu, W.; Zhang, C.; Yuan, D. MiRNA-194 regulates palmitic acid-induced toll-like receptor 4 inflammatory responses in THP-1 cells. Nutrients 2015, 7, 3483–3496. [Google Scholar] [CrossRef]
  61. Snodgrass, R.G.; Huang, S.; Choi, I.-W.; Rutledge, J.C.; Hwang, D.H. Inflammasome-mediated secretion of IL-1β in human monocytes through TLR2 activation; modulation by dietary fatty acids. J. Immunol. 2013, 191, 4337–4347. [Google Scholar] [CrossRef]
  62. Manosalva, C.; Mena, J.; Velasquez, Z.; Colenso, C.K.; Brauchi, S.; Burgos, R.A.; Hidalgo, M.A. Cloning, identification and functional characterization of bovine free fatty acid receptor-1 (FFAR1/GPR40) in neutrophils. PLoS ONE 2015, 10, e0119715. [Google Scholar] [CrossRef]
  63. Mena, S.J.; Manosalva, C.; Carretta, M.D.; Teuber, S.; Olmo, I.; Burgos, R.A.; Hidalgo, M.A. Differential free fatty acid receptor-1 (FFAR1/GPR40) signalling is associated with gene expression or gelatinase granule release in bovine neutrophils. Innate Immun. 2016, 22, 479–489. [Google Scholar] [CrossRef]
  64. Wu, X.; Schauss, A.G. Mitigation of inflammation with foods. J. Agric. Food Chem. 2012, 60, 6703–6717. [Google Scholar] [CrossRef] [PubMed]
  65. Zhang, S.; Lv, K.; Liu, Z.; Zhao, R.; Li, F. Fatty acid metabolism of immune cells: A new target of tumour immunotherapy. Cell Death Discov. 2024, 10, 39. [Google Scholar] [CrossRef] [PubMed]
  66. Vailati-Riboni, M.; Zhou, Z.; Jacometo, C.; Minuti, A.; Trevisi, E.; Luchini, D.; Loor, J. Supplementation with rumen-protected methionine or choline during the transition period influences whole-blood immune response in periparturient dairy cows. J. Dairy Sci. 2017, 100, 3958–3968. [Google Scholar] [CrossRef] [PubMed]
  67. Zhou, Z.; Bulgari, O.; Vailati-Riboni, M.; Trevisi, E.; Ballou, M.; Cardoso, F.; Luchini, D.; Loor, J. Rumen-protected methionine compared with rumen-protected choline improves immunometabolic status in dairy cows during the peripartal period. J. Dairy Sci. 2016, 99, 8956–8969. [Google Scholar] [CrossRef]
  68. Swartz, T.H.; Bradford, B.; Mamedova, L.; Estes, K. Effects of dietary rumen-protected choline supplementation to periparturient dairy cattle on inflammation, metabolism, and performance during an intramammary lipopolysaccharide challenge. J. Dairy Sci. 2023, 106, 8561–8582. [Google Scholar] [CrossRef]
  69. Coleman, D.N.; Vailati-Riboni, M.; Elolimy, A.A.; Cardoso, F.C.; Rodriguez-Zas, S.L.; Miura, M.; Pan, Y.-X.; Loor, J.J. Hepatic betaine-homocysteine methyltransferase and methionine synthase activity and intermediates of the methionine cycle are altered by choline supply during negative energy balance in Holstein cows. J. Dairy Sci. 2019, 102, 8305–8318. [Google Scholar] [CrossRef]
  70. Zhou, Z.; Ferdous, F.; Montagner, P.; Luchini, D.; Correa, M.; Loor, J. Methionine and choline supply during the peripartal period alter polymorphonuclear leukocyte immune response and immunometabolic gene expression in Holstein cows. J. Dairy Sci. 2018, 101, 10374–10382. [Google Scholar] [CrossRef]
  71. Mehta, A.K.; Singh, B.P.; Arora, N.; Gaur, S.N. Choline attenuates immune inflammation and suppresses oxidative stress in patients with asthma. Immunobiology 2010, 215, 527–534. [Google Scholar] [CrossRef]
  72. Lopreiato, V.; Vailati-Riboni, M.; Bellingeri, A.; Khan, I.; Farina, G.; Parys, C.; Loor, J. Inflammation and oxidative stress transcription profiles due to in vitro supply of methionine with or without choline in unstimulated blood polymorphonuclear leukocytes from lactating Holstein cows. J. Dairy Sci. 2019, 102, 10395–10410. [Google Scholar] [CrossRef]
  73. Halliwell, B.; Gutteridge, J.M. Free Radicals in Biology and Medicine; Oxford University Press: Oxford, UK, 2015. [Google Scholar]
  74. Nathan, C.; Ding, A. Nonresolving inflammation. Cell 2010, 140, 871–882. [Google Scholar] [CrossRef]
  75. Liu, J.; Han, X.; Zhang, T.; Tian, K.; Li, Z.; Luo, F. Reactive oxygen species (ROS) scavenging biomaterials for anti-inflammatory diseases: From mechanism to therapy. J. Hematol. Oncol. 2023, 16, 116. [Google Scholar] [CrossRef]
  76. Bai, H.; Shabur, T.M.A.; Kunii, H.; Itoh, T.; Kawahara, M.; Takahashi, M. Evaluation of the immune status of peripheral blood monocytes from dairy cows during the periparturition period. J. Reprod. Dev. 2019, 65, 313–318. [Google Scholar] [CrossRef]
Animals 15 01814 g001
Figure 1. Culture process diagram.
Figure 1. Culture process diagram.
Animals 15 01814 g001
Table 1. The qPCR primer sequences.
Table 1. The qPCR primer sequences.
Gene SymbolGeneBank Accession NumberForward Primer 5′-3′Product Size (bp)
Reverse Primer 3′-5′
GAPDHNM_001034034.2CAAGCTCATTTCCTGGTACGAC130
AACTCTTCCTCTCGTGCTCC
IL-1βNM_174093GACGAGTTTCTGTGTGACGC149
ATGCAGAACACCACTTCTCGG
IL-6NM_173923.2TGAAAGCAGCAAGGAGACACT99
CAAATCGCCTGATTGAACCCAG
IL-10NM_174088.1CTGTTGACCCAGTCTCTGCT216
GCTCTTGTTTTCGCAGGGC
CSF-1NM_174026.1GCCCGTTTTAACTCCGTTCC180
TGGCTCTTGATGGCTCCGAC
CSF-2NM_174027.2GGCCACCCACTACGAGAAAC160
CTGGTTTGGCCTGCTTCACT
CSF-3NM_174028.1GCCTGAACCAACTACACGGC209
GGCTGAAGTGAAGGTCGGCA
Abbreviation: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-1β/6/10, interleukin-1β/6/10; CSF-1/2/3, colony-stimulating factors-1/2/3.
Table 2. Effect of NEFA and choline pretreatment combined with NEFA on the PBMC and PMN oxidative stress indicators.
Table 2. Effect of NEFA and choline pretreatment combined with NEFA on the PBMC and PMN oxidative stress indicators.
Oxidative Stress IndicatorsControl1 mM NEFA1 mM NEFA +
4 µM CHOL		1 mM NEFA +
12 µM CHOL
PBMC
 TBARS (µM/107 cells)2.41 ± 0.15 a2.85 ± 0.15 b (18%)2.15 ± 0.19 a (32%)2.38 ± 0.16 a (20%)
 SOD (U/mL)2.65 ± 0.34 a3.08 ± 0.34 a2.89 ± 0.24 a2.92 ± 0.41 a
PMN
 TBARS (µM/107 cells)1.69 ± 0.18 a2.34 ± 0.26 b (38%)2.22 ± 0.14 a (5%)1.84 ± 0.24 a (27%)
 SOD(U/mL)0.86 ± 0.17 a0.91 ± 0.2 a0.8 ± 0.15 a0.87 ± 0.17 a
Data are presented as mean ± standard error. TBARS sample size = 12; SOD sample size = 10. The different letters indicate significant differences among treatments (p < 0.05). Control: basal culture medium treatment 2 h + basal culture medium treatment 12 h; 1 mM NEFA: basal culture medium treatment 2 h + 1 mM NEFA treatment 12 h; 1 mM NEFA+ 4 μM/12μM CHOL: 4 μM/12 μM choline pretreatment 2 h + 1 mM NEFA treatment 12 h. Abbreviation: SOD, superoxide dismutase; TBARS, thiobarbituric acid reactive substances.
Table 3. Effect of NEFA and choline pretreatment combined with NEFA on the PBMC and PMN cytokine gene expression.
Table 3. Effect of NEFA and choline pretreatment combined with NEFA on the PBMC and PMN cytokine gene expression.
PBMCPMN
GeneControl1 mM NEFA1 mM NEFA+
4 µM CHOL		1 mM NEFA+
12 µM CHOL		Control1 mM NEFA1 mM NEFA +
4 µM CHOL		1 mM NEFA +
12 µM CHOL
IL-1β1 ± 0.37 a1.78 ± 0.2 b1.81 ± 0.27 b2.28 ± 0.29 b1 ± 0.58 a3.27 ± 0.88 b2.87 ± 0.87 ab2.71 ± 0.51 ab
IL-61 ± 0.36 a2.76 ± 0.4 b2.63 ± 0.46 b2.71 ± 0.61 b1 ± 0.5 a1.58 ± 0.3 a2.11 ± 0.39 a4.27 ± 2.78 a
IL-81 ± 0.57 a2.08 ± 0.49 a2.03 ± 0.54 a2.62 ± 0.93 a1 ± 0.42 a5.09 ± 3.53 a1.73 ± 0.35 a1.5 ± 0.19 a
IL-101 ± 0.3 a1.73 ± 0.43 ab2.1 ± 0.5 b1.72 ± 0.33 ab1 ± 0.43 a2.14 ± 0.51 ab2.08 ± 0.57 ab2.62 ± 0.75 b
CSF-11 ± 0.46 a0.69 ± 0.15 a0.72 ± 0.13 a2.85 ± 2.24 a1 ± 0.33 a1.43 ± 0.35 a1.89 ± 0.95 a1.18 ± 0.39 a
CSF-21 ± 0.53 a0.93 ± 0.18 a1.25 ± 0.21 a1.01 ± 0.28 a1 ± 0.59 a4.42 ± 1.38 b3.18 ± 1.05 ab2.71 ± 0.86 ab
CSF-31 ± 0.88 a7.96 ± 2.39 ab12.33 ± 3.88 b13.34 ± 3.95 b1 ± 0.73 a5.76 ± 2.18 a5.49 ± 1.9 a5.38 ± 1.89 a
Data are presented as mean ± standard error. Sample size = 7. Different letters among treatments indicate p < 0.05. Control: basal culture medium treatment 2 h + basal culture medium treatment 12 h; 1 mM NEFA: basal culture medium treatment 2 h +1 mM NEFA treatment 12 h; 1 mM NEFA+ 4 μM/12 μM CHOL: 4 μM/12 μM choline pretreatment 2 h +1 mM NEFA treatment 12 h. Abbreviation: IL-1β/6/10, interleukin-1β/6/10; CSF-1/2/3, colony-stimulating factors-1/2/3.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, C.-Y.; Chen, Y.-T.; Moonmanee, T.; Chan, J.P.-W.; Wang, C.-K. The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes. Animals 2025, 15, 1814. https://doi.org/10.3390/ani15121814

AMA Style

Li C-Y, Chen Y-T, Moonmanee T, Chan JP-W, Wang C-K. The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes. Animals. 2025; 15(12):1814. https://doi.org/10.3390/ani15121814

Chicago/Turabian Style

Li, Cheng-Yan, Yueh-Tung Chen, Tossapol Moonmanee, Jacky Peng-Wen Chan, and Chien-Kai Wang. 2025. "The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes" Animals 15, no. 12: 1814. https://doi.org/10.3390/ani15121814

APA Style

Li, C.-Y., Chen, Y.-T., Moonmanee, T., Chan, J. P.-W., & Wang, C.-K. (2025). The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes. Animals, 15(12), 1814. https://doi.org/10.3390/ani15121814

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop