The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and PBMC and PMN Isolation
2.2. Immune Cell Culture and NEFA–Choline Treatment
2.3. Oxidative Stress Measurement
2.4. Cytokine Expression by Real-Time PCR
2.5. Statistics
3. Results
3.1. NEFA-Induced Oxidative Stress and Antioxidative Stress Effects of Choline
3.2. NEFA-Induced Inflammatory Cytokine Expression and Effects of Choline
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Grummer, R.R. Impact of changes in organic nutrient metabolism on feeding the transition dairy cow. J. Anim. Sci. 1995, 73, 2820–2833. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Liu, Y.; Zhang, Y.; Long, M.; Guo, Y.; Wang, Z.; Li, X.; Zhang, C.; Li, X.; He, J. Effect of non-esterified fatty acids on fatty acid metabolism-related genes in calf hepatocytes cultured in vitro. Cell. Physiol. Biochem. 2013, 32, 1509–1516. [Google Scholar] [CrossRef] [PubMed]
- Adewuyi, A.; Gruys, E.; Van Eerdenburg, F. Non esterified fatty acids (NEFA) in dairy cattle. A review. Vet. Q. 2005, 27, 117–126. [Google Scholar] [CrossRef] [PubMed]
- Contreras, G.; O’boyle, N.; Herdt, T.; Sordillo, L. Lipomobilization in periparturient dairy cows influences the composition of plasma nonesterified fatty acids and leukocyte phospholipid fatty acids. J. Dairy Sci. 2010, 93, 2508–2516. [Google Scholar] [CrossRef]
- Chapinal, N.; Carson, M.; Duffield, T.; Capel, M.; Godden, S.; Overton, M.; Santos, J.; LeBlanc, S. The association of serum metabolites with clinical disease during the transition period. J. Dairy Sci. 2011, 94, 4897–4903. [Google Scholar] [CrossRef]
- Ospina, P.; Nydam, D.; Stokol, T.; Overton, T. Evaluation of nonesterified fatty acids and β-hydroxybutyrate in transition dairy cattle in the northeastern United States: Critical thresholds for prediction of clinical diseases. J. Dairy Sci. 2010, 93, 546–554. [Google Scholar] [CrossRef]
- Sharma, N.; Singh, N.; Singh, O.; Pandey, V.; Verma, P. Oxidative stress and antioxidant status during transition period in dairy cows. Asian-Australas. J. Anim. Sci. 2011, 24, 479–484. [Google Scholar] [CrossRef]
- Herr, M.; Bostedt, H.; Failing, K. IgG and IgM levels in dairy cows during the periparturient period. Theriogenology 2011, 75, 377–385. [Google Scholar] [CrossRef]
- Saed, H.A.; Ibrahim, H.M.; El-Khodery, S.A.; Youssef, M.A. Relationship between expression pattern of vitamin D receptor, 1 alpha-hydroxylase enzyme, and chemokine RANTES genes and selected serum parameters during transition period in Holstein dairy cows. Vet. Rec. Open 2020, 7, e000339. [Google Scholar] [CrossRef]
- Trevisi, E.; Amadori, M.; Archetti, I.; Lacetera, N.; Bertoni, G. Inflammatory response and acute phase proteins in the transition period of high-yielding dairy cows. In Acute Phase Proteins as Early Non-Specific Biomarkers of Human and Veterinary Diseases; Elsevier: Amsterdam, The Netherlands, 2011; Volume 15, pp. 355–379. [Google Scholar]
- Li, C.-Y.; Lin, W.-C.; Moonmanee, T.; Chan, J.P.-W.; Wang, C.-K. The protective role of vitamin E against oxidative stress and immunosuppression induced by non-esterified fatty acids in bovine peripheral blood leukocytes. Animals 2024, 14, 1079. [Google Scholar] [CrossRef]
- Sordillo, L.; Mavangira, V. The nexus between nutrient metabolism, oxidative stress and inflammation in transition cows. Anim. Prod. Sci. 2014, 54, 1204–1214. [Google Scholar] [CrossRef]
- Baeuerle, P.A.; Henkel, T. Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol. 1994, 12, 141–179. [Google Scholar] [CrossRef] [PubMed]
- Francaux, M. Toll-like receptor signalling induced by endurance exercise. Appl. Physiol. Nutr. Metab. 2009, 34, 454–458. [Google Scholar] [CrossRef] [PubMed]
- Mena, J.; Manosalva, C.; Ramirez, R.; Chandia, L.; Carroza, D.; Loaiza, A.; Burgos, R.A.; Hidalgo, M.A. Linoleic acid increases adhesion, chemotaxis, granule release, intracellular calcium mobilisation, MAPK phosphorylation and gene expression in bovine neutrophils. Vet. Immunol. Immunopathol. 2013, 151, 275–284. [Google Scholar] [CrossRef]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, X.; Zhang, H.; Zhao, Z.; Peng, Z.; Wang, Z.; Liu, G.; Li, X. Non-esterified fatty acids over-activate the TLR2/4-NF-κb signaling pathway to increase inflammatory cytokine synthesis in neutrophils from ketotic cows. Cell. Physiol. Biochem. 2018, 48, 827–837. [Google Scholar] [CrossRef]
- Bradford, B.; Yuan, K.; Farney, J.; Mamedova, L.; Carpenter, A. Invited review: Inflammation during the transition to lactation: New adventures with an old flame. J. Dairy Sci. 2015, 98, 6631–6650. [Google Scholar] [CrossRef]
- Pascottini, O.B.; Van Schyndel, S.; Spricigo, J.; Carvalho, M.; Mion, B.; Ribeiro, E.; LeBlanc, S. Effect of anti-inflammatory treatment on systemic inflammation, immune function, and endometrial health in postpartum dairy cows. Sci. Rep. 2020, 10, 5236. [Google Scholar] [CrossRef]
- Crookenden, M.; Heiser, A.; Murray, A.; Dukkipati, V.; Kay, J.; Loor, J.; Meier, S.; Mitchell, M.; Moyes, K.; Walker, C. Parturition in dairy cows temporarily alters the expression of genes in circulating neutrophils. J. Dairy Sci. 2016, 99, 6470–6483. [Google Scholar] [CrossRef]
- Hammon, D.; Evjen, I.; Dhiman, T.; Goff, J.; Walters, J. Neutrophil function and energy status in Holstein cows with uterine health disorders. Vet. Immunol. Immunopathol. 2006, 113, 21–29. [Google Scholar] [CrossRef]
- Hoeben, D.; Monfardini, E.; Opsomer, G.; Burvenich, C.; Dosogne, H.; De Kruif, A.; Beckers, J.-F. Chemiluminescence of bovine polymorphonuclear leucocytes during the periparturient period and relation with metabolic markers and bovine pregnancy-associated glycoprotein. J. Dairy Res. 2000, 67, 249–259. [Google Scholar] [CrossRef] [PubMed]
- Kehrli, M.E., Jr.; Nonnecke, B.J.; Roth, J.A. Alterations in bovine neutrophil function during the periparturient period. Am. J. Vet. Res 1989, 50, 207–214. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.-Y.; Yang, Z.-J.; Cheng, J.; Li, H.-Y.; Chen, S.; Huang, Z.-H.; Chen, J.-D.; Xiong, R.-G.; Yang, M.-T.; Wang, C. Choline alleviates cognitive impairment in sleep-deprived young mice via reducing neuroinflammation and altering phospholipidomic profile. Redox Biol. 2025, 81, 103578. [Google Scholar] [CrossRef] [PubMed]
- Goselink, R.; Van Baal, J.; Widjaja, H.; Dekker, R.; Zom, R.; De Veth, M.; Van Vuuren, A. Effect of rumen-protected choline supplementation on liver and adipose gene expression during the transition period in dairy cattle. J. Dairy Sci. 2013, 96, 1102–1116. [Google Scholar] [CrossRef]
- Yao, N.; Li, W.; Xu, G.; Duan, N.; Yu, G.; Qu, J. Choline metabolism and its implications in cancer. Front. Oncol. 2023, 13, 1234887. [Google Scholar] [CrossRef]
- Santos, J.E.P.; Lima, F.S. Feeding rumen-protected choline to transition dairy cows. In Proceedings of the 20th Annual Florida Ruminant Nutrition Symposium, Gainesville, FL, USA, 10–11 February 2009; pp. 10–11. [Google Scholar]
- Grummer, R. Choline: A limiting nutrient for transition dairy cows. In Proceedings of the Cornell Nutrition Conference, Ithaca, NY, USA, 17–18 October 2012; pp. 21–28. [Google Scholar]
- Jiang, X.; Greenwald, E.; Jack-Roberts, C. Effects of choline on DNA methylation and macronutrient metabolic gene expression in in vitro models of hyperglycemia. Nutr. Metab. Insights 2016, 9, 11–17. [Google Scholar] [CrossRef]
- Rastani, R.; Grummer, R.; Bertics, S.; Gümen, A.; Wiltbank, M.; Mashek, D.; Schwab, M. Reducing dry period length to simplify feeding transition cows: Milk production, energy balance, and metabolic profiles. J. Dairy Sci. 2005, 88, 1004–1014. [Google Scholar] [CrossRef]
- Horn, P.; Bork, S.; Horn, P.; Bork, S.; Diehlmann, A.; Walenda, T.; Eckstein, V.; Ho, A.; Wagner, W. Isolation of human mesenchymal stromal cells is more efficient by red blood cell lysis. Cytotherapy 2008, 10, 676–685. [Google Scholar] [CrossRef]
- Garcia, M.; Mamedova, L.K.; Barton, B.; Bradford, B.J. Choline regulates the function of bovine immune cells and alters the mRNA abundance of enzymes and receptors involved in its metabolism in vitro. Front. Immunol. 2018, 9, 2448. [Google Scholar] [CrossRef]
- Ster, C.; Loiselle, M.-C.; Lacasse, P. Effect of postcalving serum nonesterified fatty acids concentration on the functionality of bovine immune cells. J. Dairy Sci. 2012, 95, 708–717. [Google Scholar] [CrossRef]
- Grummer, R.R. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 1993, 76, 3882–3896. [Google Scholar] [CrossRef] [PubMed]
- Campoio, T.; Oliveira, F.; Otton, R. Oxidative stress in human lymphocytes treated with fatty acid mixture: Role of carotenoid astaxanthin. Toxicology Vitr. 2011, 25, 1448–1456. [Google Scholar] [CrossRef] [PubMed]
- Volpe, C.M.O.; Abreu, L.F.M.; Gomes, P.S.; Gonzaga, R.M.; Veloso, C.A.; Nogueira-Machado, J.A. The production of nitric oxide, IL-6, and TNF-alpha in palmitate-stimulated PBMNCs is enhanced through hyperglycemia in diabetes. Oxidative Med. Cell. Longev. 2014, 2014, 479587. [Google Scholar] [CrossRef] [PubMed]
- Rayaman, P.; Rayaman, E.; Çevikbas, A.; Demirtunç, R.; Sehirli, A.O.; Gürer, Ü.S. The effect of some antibiotics on Polymorphonuclear Leukocyte (PMN) functions and PMN’S myeloperoxidase activity, glutathione and malondialdehyde levels of patients with type 2 diabetes mellitus in vitro. Clin. Exp. Health Sci. 2013, 3, 200. [Google Scholar]
- Reyes-Quiroz, M.E.; Alba, G.; Saenz, J.; Santa-María, C.; Geniz, I.; Jiménez, J.; Ramírez, R.; Martín-Nieto, J.; Pintado, E.; Sobrino, F. Oleic acid modulates mRNA expression of liver X receptor (LXR) and its target genes ABCA1 and SREBP1c in human neutrophils. Eur. J. Nutr. 2014, 53, 1707–1717. [Google Scholar] [CrossRef]
- Johansson, Å.C.; Ohlsson, S.; Pettersson, Å.; Bengtsson, A.A.; Selga, D.; Hansson, M.; Hellmark, T. Impaired phagocytosis and reactive oxygen species production in phagocytes is associated with systemic vasculitis. Arthritis Res. Ther. 2016, 18, 92. [Google Scholar] [CrossRef]
- Gao, W.; Du, X.; Lei, L.; Wang, H.; Zhang, M.; Wang, Z.; Li, X.; Liu, G.; Li, X. NEFA-induced ROS impaired insulin signalling through the JNK and p38MAPK pathways in non-alcoholic steatohepatitis. J. Cell. Mol. Med. 2018, 22, 3408–3422. [Google Scholar] [CrossRef]
- Li, P.; Li, L.; Zhang, C.; Cheng, X.; Zhang, Y.; Guo, Y.; Long, M.; Yang, S.; He, J. Palmitic acid and β-hydroxybutyrate induce inflammatory responses in bovine endometrial cells by activating oxidative stress-mediated NF-κB signaling. Molecules 2019, 24, 2421. [Google Scholar] [CrossRef]
- Zhang, B.; Li, M.; Yang, W.; Loor, J.J.; Liang, Y.; Wang, S.; Zhao, Y.; Guo, H.; Ma, X.; Yu, L. Mitochondrial dysfunction and endoplasmic reticulum stress in calf hepatocytes are associated with fatty acid-induced ORAI calcium release-activated calcium modulator 1 signaling. J. Dairy Sci. 2020, 103, 11945–11956. [Google Scholar] [CrossRef]
- EFSA Panel on Dietetic Products, Nutrition and Allergies. Scientific Opinion on the substantiation of health claims related to choline and contribution to normal lipid metabolism (ID 3186), maintenance of normal liver function (ID 1501), contribution to normal homocysteine metabolism (ID 3090), maintenance of normal neurological function (ID 1502), contribution to normal cognitive function (ID 1502), and brain and neurological development (ID 1503) pursuant to Article 13 (1) of Regulation (EC) No 1924/2006. Eur. Food Saf. Auth. J. 2011, 9, 2056. [Google Scholar]
- Adjoumani, J.J.Y.; Abasubong, K.P.; Phiri, F.; Xu, C.; Liu, W.; Zhang, D. Effect of dietary betaine and choline association on lipid metabolism in blunt snout bream fed a high-fat diet. Aquac. Nutr. 2019, 25, 1017–1027. [Google Scholar] [CrossRef]
- Cetinkaya, M.; Cansev, M.; Cekmez, F.; Tayman, C.; Canpolat, F.E.; Kafa, I.M.; Uysal, S.; Tunc, T.; Sarici, S.U. CDP-choline reduces severity of intestinal injury in a neonatal rat model of necrotizing enterocolitis. J. Surg. Res. 2013, 183, 119–128. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Kuang, M.; Wang, G.; Ali, I.; Tang, Y.; Yang, C.; Li, Y.; Li, L. Choline attenuates heat stress-induced oxidative injury and apoptosis in bovine mammary epithelial cells by modulating PERK/Nrf-2 signaling pathway. Mol. Immunol. 2021, 135, 388–397. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Wu, Y.; Tang, Q.; Leng, Y.; Cai, W. The effects of choline on hepatic lipid metabolism, mitochondrial function and antioxidative status in human hepatic C3A cells exposed to excessive energy substrates. Nutrients 2014, 6, 2552–2571. [Google Scholar] [CrossRef]
- Shiomi, A.; Usui, T. Pivotal roles of GM-CSF in autoimmunity and inflammation. Mediat. Inflamm. 2015, 2015, 568543. [Google Scholar] [CrossRef]
- Bhattacharya, P.; Thiruppathi, M.; Elshabrawy, H.A.; Alharshawi, K.; Kumar, P.; Prabhakar, B.S. GM-CSF: An immune modulatory cytokine that can suppress autoimmunity. Cytokine 2015, 75, 261–271. [Google Scholar] [CrossRef]
- Dinarello, C.A. Biologic basis for interleukin-1 in disease. Blood 1996, 87, 2095–2147. [Google Scholar] [CrossRef]
- Voronov, E.; Dotan, S.; Krelin, Y.; Song, X.; Elkabets, M.; Carmi, Y.; Rider, P.; Cohen, I.; Romzova, M.; Kaplanov, I. Unique versus redundant functions of IL-1α and IL-1β in the tumor microenvironment. Front. Immunol. 2013, 4, 177. [Google Scholar] [CrossRef]
- Gabay, C. Interleukin-6 and chronic inflammation. Arthritis Res. Ther. 2006, 8, S3. [Google Scholar] [CrossRef]
- Solaroglu, I.; Cahill, J.; Jadhav, V.; Zhang, J.H. A novel neuroprotectant granulocyte-colony stimulating factor. Stroke 2006, 37, 1123–1128. [Google Scholar] [CrossRef]
- Basu, S.; Dunn, A.; Ward, A. G-CSF: Function and modes of action. Int. J. Mol. Med. 2002, 10, 3–10. [Google Scholar] [PubMed]
- Chitu, V.; Stanley, E.R. Colony-stimulating factor-1 in immunity and inflammation. Curr. Opin. Immunol. 2006, 18, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, J.A. GM-CSF in inflammation. J. Exp. Med. 2019, 217, e20190945. [Google Scholar] [CrossRef] [PubMed]
- Li, C.-Y.; Liao, Y.-W.; Liu, C.-S.; Cheng, C.-Y.; Chan, J.P.-W.; Wang, C.-K. In vitro effects of nonesterified fatty acids and β-hydroxybutyric acid on inflammatory cytokine expression in bovine peripheral blood leukocytes. Ital. J. Anim. Sci. 2021, 20, 2197–2210. [Google Scholar] [CrossRef]
- Kumolosasi, E.; Salim, E.; Jantan, I.; Ahmad, W. Kinetics of intracellular, extracellular and production of pro-inflammatory cytokines in lipopolysaccharide-stimulated human peripheral blood mononuclear cells. Trop. J. Pharm. Res. 2014, 13, 536–543. [Google Scholar] [CrossRef]
- Ma, X.-Z.; Pang, Z.-D.; Wang, J.-H.; Song, Z.; Zhao, L.-M.; Du, X.-J.; Deng, X.-L. The role and mechanism of KCa3. 1 channels in human monocyte migration induced by palmitic acid. Exp. Cell Res. 2018, 369, 208–217. [Google Scholar] [CrossRef]
- Tian, H.; Liu, C.; Zou, X.; Wu, W.; Zhang, C.; Yuan, D. MiRNA-194 regulates palmitic acid-induced toll-like receptor 4 inflammatory responses in THP-1 cells. Nutrients 2015, 7, 3483–3496. [Google Scholar] [CrossRef]
- Snodgrass, R.G.; Huang, S.; Choi, I.-W.; Rutledge, J.C.; Hwang, D.H. Inflammasome-mediated secretion of IL-1β in human monocytes through TLR2 activation; modulation by dietary fatty acids. J. Immunol. 2013, 191, 4337–4347. [Google Scholar] [CrossRef]
- Manosalva, C.; Mena, J.; Velasquez, Z.; Colenso, C.K.; Brauchi, S.; Burgos, R.A.; Hidalgo, M.A. Cloning, identification and functional characterization of bovine free fatty acid receptor-1 (FFAR1/GPR40) in neutrophils. PLoS ONE 2015, 10, e0119715. [Google Scholar] [CrossRef]
- Mena, S.J.; Manosalva, C.; Carretta, M.D.; Teuber, S.; Olmo, I.; Burgos, R.A.; Hidalgo, M.A. Differential free fatty acid receptor-1 (FFAR1/GPR40) signalling is associated with gene expression or gelatinase granule release in bovine neutrophils. Innate Immun. 2016, 22, 479–489. [Google Scholar] [CrossRef]
- Wu, X.; Schauss, A.G. Mitigation of inflammation with foods. J. Agric. Food Chem. 2012, 60, 6703–6717. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Lv, K.; Liu, Z.; Zhao, R.; Li, F. Fatty acid metabolism of immune cells: A new target of tumour immunotherapy. Cell Death Discov. 2024, 10, 39. [Google Scholar] [CrossRef] [PubMed]
- Vailati-Riboni, M.; Zhou, Z.; Jacometo, C.; Minuti, A.; Trevisi, E.; Luchini, D.; Loor, J. Supplementation with rumen-protected methionine or choline during the transition period influences whole-blood immune response in periparturient dairy cows. J. Dairy Sci. 2017, 100, 3958–3968. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Bulgari, O.; Vailati-Riboni, M.; Trevisi, E.; Ballou, M.; Cardoso, F.; Luchini, D.; Loor, J. Rumen-protected methionine compared with rumen-protected choline improves immunometabolic status in dairy cows during the peripartal period. J. Dairy Sci. 2016, 99, 8956–8969. [Google Scholar] [CrossRef]
- Swartz, T.H.; Bradford, B.; Mamedova, L.; Estes, K. Effects of dietary rumen-protected choline supplementation to periparturient dairy cattle on inflammation, metabolism, and performance during an intramammary lipopolysaccharide challenge. J. Dairy Sci. 2023, 106, 8561–8582. [Google Scholar] [CrossRef]
- Coleman, D.N.; Vailati-Riboni, M.; Elolimy, A.A.; Cardoso, F.C.; Rodriguez-Zas, S.L.; Miura, M.; Pan, Y.-X.; Loor, J.J. Hepatic betaine-homocysteine methyltransferase and methionine synthase activity and intermediates of the methionine cycle are altered by choline supply during negative energy balance in Holstein cows. J. Dairy Sci. 2019, 102, 8305–8318. [Google Scholar] [CrossRef]
- Zhou, Z.; Ferdous, F.; Montagner, P.; Luchini, D.; Correa, M.; Loor, J. Methionine and choline supply during the peripartal period alter polymorphonuclear leukocyte immune response and immunometabolic gene expression in Holstein cows. J. Dairy Sci. 2018, 101, 10374–10382. [Google Scholar] [CrossRef]
- Mehta, A.K.; Singh, B.P.; Arora, N.; Gaur, S.N. Choline attenuates immune inflammation and suppresses oxidative stress in patients with asthma. Immunobiology 2010, 215, 527–534. [Google Scholar] [CrossRef]
- Lopreiato, V.; Vailati-Riboni, M.; Bellingeri, A.; Khan, I.; Farina, G.; Parys, C.; Loor, J. Inflammation and oxidative stress transcription profiles due to in vitro supply of methionine with or without choline in unstimulated blood polymorphonuclear leukocytes from lactating Holstein cows. J. Dairy Sci. 2019, 102, 10395–10410. [Google Scholar] [CrossRef]
- Halliwell, B.; Gutteridge, J.M. Free Radicals in Biology and Medicine; Oxford University Press: Oxford, UK, 2015. [Google Scholar]
- Nathan, C.; Ding, A. Nonresolving inflammation. Cell 2010, 140, 871–882. [Google Scholar] [CrossRef]
- Liu, J.; Han, X.; Zhang, T.; Tian, K.; Li, Z.; Luo, F. Reactive oxygen species (ROS) scavenging biomaterials for anti-inflammatory diseases: From mechanism to therapy. J. Hematol. Oncol. 2023, 16, 116. [Google Scholar] [CrossRef]
- Bai, H.; Shabur, T.M.A.; Kunii, H.; Itoh, T.; Kawahara, M.; Takahashi, M. Evaluation of the immune status of peripheral blood monocytes from dairy cows during the periparturition period. J. Reprod. Dev. 2019, 65, 313–318. [Google Scholar] [CrossRef]

| Gene Symbol | GeneBank Accession Number | Forward Primer 5′-3′ | Product Size (bp) |
|---|---|---|---|
| Reverse Primer 3′-5′ | |||
| GAPDH | NM_001034034.2 | CAAGCTCATTTCCTGGTACGAC | 130 |
| AACTCTTCCTCTCGTGCTCC | |||
| IL-1β | NM_174093 | GACGAGTTTCTGTGTGACGC | 149 |
| ATGCAGAACACCACTTCTCGG | |||
| IL-6 | NM_173923.2 | TGAAAGCAGCAAGGAGACACT | 99 |
| CAAATCGCCTGATTGAACCCAG | |||
| IL-10 | NM_174088.1 | CTGTTGACCCAGTCTCTGCT | 216 |
| GCTCTTGTTTTCGCAGGGC | |||
| CSF-1 | NM_174026.1 | GCCCGTTTTAACTCCGTTCC | 180 |
| TGGCTCTTGATGGCTCCGAC | |||
| CSF-2 | NM_174027.2 | GGCCACCCACTACGAGAAAC | 160 |
| CTGGTTTGGCCTGCTTCACT | |||
| CSF-3 | NM_174028.1 | GCCTGAACCAACTACACGGC | 209 |
| GGCTGAAGTGAAGGTCGGCA |
| Oxidative Stress Indicators | Control | 1 mM NEFA | 1 mM NEFA + 4 µM CHOL | 1 mM NEFA + 12 µM CHOL |
|---|---|---|---|---|
| PBMC | ||||
| TBARS (µM/107 cells) | 2.41 ± 0.15 a | 2.85 ± 0.15 b (18%) | 2.15 ± 0.19 a (32%) | 2.38 ± 0.16 a (20%) |
| SOD (U/mL) | 2.65 ± 0.34 a | 3.08 ± 0.34 a | 2.89 ± 0.24 a | 2.92 ± 0.41 a |
| PMN | ||||
| TBARS (µM/107 cells) | 1.69 ± 0.18 a | 2.34 ± 0.26 b (38%) | 2.22 ± 0.14 a (5%) | 1.84 ± 0.24 a (27%) |
| SOD(U/mL) | 0.86 ± 0.17 a | 0.91 ± 0.2 a | 0.8 ± 0.15 a | 0.87 ± 0.17 a |
| PBMC | PMN | |||||||
|---|---|---|---|---|---|---|---|---|
| Gene | Control | 1 mM NEFA | 1 mM NEFA+ 4 µM CHOL | 1 mM NEFA+ 12 µM CHOL | Control | 1 mM NEFA | 1 mM NEFA + 4 µM CHOL | 1 mM NEFA + 12 µM CHOL |
| IL-1β | 1 ± 0.37 a | 1.78 ± 0.2 b | 1.81 ± 0.27 b | 2.28 ± 0.29 b | 1 ± 0.58 a | 3.27 ± 0.88 b | 2.87 ± 0.87 ab | 2.71 ± 0.51 ab |
| IL-6 | 1 ± 0.36 a | 2.76 ± 0.4 b | 2.63 ± 0.46 b | 2.71 ± 0.61 b | 1 ± 0.5 a | 1.58 ± 0.3 a | 2.11 ± 0.39 a | 4.27 ± 2.78 a |
| IL-8 | 1 ± 0.57 a | 2.08 ± 0.49 a | 2.03 ± 0.54 a | 2.62 ± 0.93 a | 1 ± 0.42 a | 5.09 ± 3.53 a | 1.73 ± 0.35 a | 1.5 ± 0.19 a |
| IL-10 | 1 ± 0.3 a | 1.73 ± 0.43 ab | 2.1 ± 0.5 b | 1.72 ± 0.33 ab | 1 ± 0.43 a | 2.14 ± 0.51 ab | 2.08 ± 0.57 ab | 2.62 ± 0.75 b |
| CSF-1 | 1 ± 0.46 a | 0.69 ± 0.15 a | 0.72 ± 0.13 a | 2.85 ± 2.24 a | 1 ± 0.33 a | 1.43 ± 0.35 a | 1.89 ± 0.95 a | 1.18 ± 0.39 a |
| CSF-2 | 1 ± 0.53 a | 0.93 ± 0.18 a | 1.25 ± 0.21 a | 1.01 ± 0.28 a | 1 ± 0.59 a | 4.42 ± 1.38 b | 3.18 ± 1.05 ab | 2.71 ± 0.86 ab |
| CSF-3 | 1 ± 0.88 a | 7.96 ± 2.39 ab | 12.33 ± 3.88 b | 13.34 ± 3.95 b | 1 ± 0.73 a | 5.76 ± 2.18 a | 5.49 ± 1.9 a | 5.38 ± 1.89 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, C.-Y.; Chen, Y.-T.; Moonmanee, T.; Chan, J.P.-W.; Wang, C.-K. The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes. Animals 2025, 15, 1814. https://doi.org/10.3390/ani15121814
Li C-Y, Chen Y-T, Moonmanee T, Chan JP-W, Wang C-K. The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes. Animals. 2025; 15(12):1814. https://doi.org/10.3390/ani15121814
Chicago/Turabian StyleLi, Cheng-Yan, Yueh-Tung Chen, Tossapol Moonmanee, Jacky Peng-Wen Chan, and Chien-Kai Wang. 2025. "The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes" Animals 15, no. 12: 1814. https://doi.org/10.3390/ani15121814
APA StyleLi, C.-Y., Chen, Y.-T., Moonmanee, T., Chan, J. P.-W., & Wang, C.-K. (2025). The In Vitro Effects of Choline on Non-Esterified Fatty Acid-Treated Bovine Peripheral Blood Leukocytes. Animals, 15(12), 1814. https://doi.org/10.3390/ani15121814

