You are currently viewing a new version of our website. To view the old version click .
Animals
  • Article
  • Open Access

1 January 2025

A New ‘cyclotis-morphotype’ Species of Tube-Nosed Bat (Chiroptera: Vespertilionidae: Murina) from China

,
,
,
,
and
1
Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223, China
2
Yunnan Huanglianshan National Nature Reserve Management Bureau, Lvchun 662599, China
3
Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650201, China
*
Author to whom correspondence should be addressed.
This article belongs to the Special Issue New Approaches and Insights into Bat Population Status and Trends

Simple Summary

In this paper, a new Murina species is described from Lvchun, Yunnan, China, based on morphological and molecular evidence. Morphologically, the new species is most similar to Murina pluvialis but can be distinguished from this and all other congeners by a combination of morphological characteristics. Genetically, the new species is most closely related to M. pluvialis based on the phylogenetic tree of the mitochondrial cytochrome b (Cyt b) and cytochrome oxidase subunit I (COI) gene sequences, but there is still a genetic distance of 7.2–7.4%. The discovery of the new species not only enriches our understanding of biodiversity but also highlights the importance of southwest China as a biodiversity hotspot.

Abstract

During an examination of various specimens previously collected from different locations at different times, we discovered four Murina specimens that had been collected in October and December 2023 from the Huanglianshan National Nature Reserve, Lvchun, Yunnan, China. Morphologically, these specimens can be distinguished from M. pluvialis and other congeneric species based on a combination of body size, hair distribution, fur colour, and skull and teeth characteristics; molecularly, an analysis of Cyt b and COI gene sequences showed that these specimens form a monophyletic group with M. pluvialis with high posterior probability and bootstrap support values. Furthermore, the genetic distance between our specimens and M. pluvialis was greater than the minimum threshold for interspecific differentiation, indicating that they are phylogenetically close but have diverged. Based on the above assessment of morphological characteristics and molecular data analysis, these specimens were determined to represent a previously unidentified species, designated Murina lvchun Xin Mou & Song Li, sp. nov.

1. Introduction

The family, Vespertilionidae Gray, 1821 [1] is the largest family in the order Chiroptera and the second largest mammalian family after Muridae [2]. According to Simmons [3], this family has 407 known species, 48 genera and 6 subfamilies (Vespertilioninae, Antrozoinae, Myotinae, Miniopterinae, Murininae, and Kerivoulinae) as of 2005. Over the last two decades, a large number of new species in this family have been discovered. As of 13 July 2024, The Mammal Diversity Database of the American Society of Mammalogists (ASM) has recorded 531 species in 60 genera [4]. As the family Vespertilionidae is the most widespread family in the order Chiroptera (found on all continents except Antarctica) [5] and as bats are capable of flight and are usually nocturnal, it is not difficult to speculate that there are still many unreported species of the family Vespertilionidae in remote areas.
Miller [6] named the subfamily Murininæ—including only Murina and Harpiocephalus—based on the following characteristics: anterior upper premolars (P2) slightly reduced, slightly smaller than the posterior upper premolars, and essentially similar in morphology; molars essentially normal or considerably modified, with the metaconid clearly the largest cusp of the first (M1) and second molars (M2); and the nostrils clearly protruding in a tubular shape. The above taxonomic hypothesis is generally accepted [1,7,8,9,10]. The genus Harpiola was originally introduced as an independent genus by Thomas [11], with Murina grisea as its type species. Bhattacharyya [12] provided a detailed description of the second grisea specimen and conducted a comprehensive re-evaluation of Harpiola. In describing a new species (Harpiola isodon), Kuo et al. [13] presented a systematic account of the diagnostic characteristics distinguishing between Harpiola and Murina. Both authors upheld the validity of the genus Harpiola. Kruskop et al. [14] and Li et al. [15] have reported on specimens of H. isodon from Vietnam and mainland China, respectively. The validity of the genus Harpiola is generally accepted.
The genus Murina Gray, 1842 [16] is the largest genus in the subfamily Murininae. Simmons [3] confirmed the presence of 17 species within Murina in 2005, and its membership has more than doubled over the last two decades, with a large number of new species having been reported [17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33]. At present, 41 species of the genus Murina are listed in the Global Biodiversity Information Facility (GBIF) [34] and 39 species are recognised by the Mammal Diversity Database of ASM [4], with 21 species distributed in China according to the Catalogue of Mammals in China [35]. The body size of Murina is usually significantly smaller than that of Harpiocephalus (except for a slight overlap of Murina leucogaster with Harpiocephalus in forearm length), and Murina can be distinguished from Harpiocephalus based on its skull and dentition [36,37]. It also can be distinguished from Harpiola according to a number of diagnostic dental characteristics [13]. Corbet and Hill [7] divided Murina into two groups: the ‘suilla-group’ and the ‘cyclotis-group’, based on the relative size of the upper canines (C1), the first (P2) and second upper premolars (P4), and the position of the incisors. This classification remains in application to species described subsequently [7,9,17,18,19,20,21,22,24,25,26,33,36]. However, the two morphogroups do not represent distinct phylogenetic lineages and will, therefore, be referred to hereafter as the ‘suilla-morphotype’ and the ‘cyclotis-morphotype’ [24,33].
During an examination of specimens collected between October and December 2023 from the Huanglianshan National Nature Reserve, Lvchun, Yunnan, China, we identified four Murina specimens. Morphologically, these specimens appear to belong to the ‘cyclotis-morphotype’, but analyses of molecular and morphological characteristics indicate that the specimens do not belong to any known species of genus Murina. We, therefore, describe these here as a new species of the genus Murina.

2. Materials and Methods

2.1. Sample Collection

The four specimens in this study included two adult males and two adult females, collected from the Huanglianshan National Nature Reserve, Lvchun, Yunnan, China, in October and December 2023. The voucher specimens are stored at the Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS), Kunming, China, under field collection numbers KIZ20230972, 20230973, 20231014, and 20231194 (the corresponding museum collection numbers are KIZ025484, 025485, 025486, and 025487, respectively). All novel sequences were deposited in the NCBI GenBank database under accession numbers PQ815068, PQ815069, PQ815070 and PQ815071 for Cyt b, and PQ818017 (KIZ20230972) and PQ818018 (KIZ20230973) for COI.

2.2. Measurements

External measurements were taken using a digital calliper accurate to 0.01 mm. We measured the following: head-body length (HB), from the tip of the snout to the anus; tail length (TL), from the anus to the tip of the tail; ear length (E), from the lower edge of the external auditory meatus to the tip of the pinna; hindfoot length (HF), from the extremity of the heel to the tip of the longest toe, not including any claws; tibia length (TIB), from the knee joint to the ankle; forearm length (FA), from the elbow to the carpus, with the wings folded; and the lengths of the metatarsals of the second, third, fourth and, fifth digits (MET2, MET3, MET4 and MET5, respectively), from the carpus to the end of the respective metacarpals. Body weight (WT) was measured using an electronic scale accurate to 0.1 g.
Cranial and dental measurements were taken to the nearest 0.01 mm using a digital calliper under a stereomicroscope by Xin Mou, with the definitions and standards for craniodental measurements referenced from Velazco et al. [38] and Chen et al. [25], summarised as follows: total length of skull (STOTL), from the anterior rim of the alveolus of the first upper incisor (I2) to the point projecting out of the occipital region the most; greatest length of skull (GTL), from the anterior aspect of I2 to the most prominent point of the occipital region; condylocanine length (CCL), from the exoccipital condyle to the most anterior part of C1; condylobasal length (CBL), from the exoccipital condyle to the posterior rim of the alveolus of I2; braincase width (BCW), the greatest width of the braincase; mastoid width (MAW), the greatest distance across the mastoid region; interorbital width (IOW), the smallest width of the interorbital constriction; lacrimal width (LW), the greatest width across the lacrimal tubercles at the rostral margins of the orbits; zygomatic width (ZYW), the greatest width of the skull across the zygomatic arches; braincase height (BCH), the distance from the horizontal plane to the highest point of the cranium, measured with the skull placed horizontally; upper canine width (C1C1W), the greatest width of the outer borders of C1; upper molar greatest width (M3M3W), the greatest width of the outer borders of the third upper molar (M3); upper canine–molar length (CM3L), from the anterior of C1 to the posterior of the M3 crown; upper canine–premolar length (CP4L), from the anterior of C1 to the posterior of P4 crown; mandible length (ML), from the anterior rim of the alveolus of I2 to the most posterior part of the condyle; coronoid process height (CPH), the shortest distance from the apex of the coronoid process to the indentation of the lower border of the ramus mandibula; the lower canine–molar length (CM3L), from anterior of the lower canines (C1) to posterior of the third lower molar (M3) crown.

2.3. Molecular Analyses

Total genomic DNA was extracted from muscle samples using the TSINGKE TSP202-50 Trelief ® Hi-Pure Animal Genomic DNA Kit (Tsingke Biotech, Beijing, China), following the manufacturer’s protocols. The Cyt b and COI gene sequences were amplified and sequenced using the following primer pairs: Molcit-F (5′-AATGACATGAAAAATCACCGTTGT-3′, Ibáñez et al. [39]) and CytB-H (5′-CTTTTCTGGTTTACAAGACCAG-3′, Weyeneth et al. [40]) for Cyt b; COF: TTCTCAACCAACCACAAAGACATTGG and COR: TAGACTTCTGGGTGGCCAAAGAATCA (self-designed and optimised) for COI. Polymerase chain reaction (PCR) was conducted in a total volume of 50 μL, including template DNA (1 μL), each primer (10 pM, 2 μL), and GOLD mix (Green-TSINGKE TSE101) (45 μL). The PCR procedure consisted of 94 °C for 2 min; 5 cycles of 94 °C for 30 s, 50 °C for 40 s and 72 °C for 1 min; 35 cycles of 94 °C for 30 s, 55 °C for 40 s and 72 °C for 1 min; and a final extension at 72 °C for 10 min, followed by 4°C for renaturation. The PCR products were analysed via agarose gel electrophoresis and purified using the Trelief ® DNA Gel Extraction Kit (Tsingke Biotech, Beijing). Finally, the purified samples were sequenced using an ABI 3730XL DNA Analyzer (Carlsbad, CA, USA) at Tsingke Biotech (Beijing, China). The sequencing files were checked and assembled using SeqMan in Lasergene v7.1 (DNASTAR Inc. Madison, WI, USA).
The Cyt b and COI sequences were compared to 25 Cyt b and 32 COI sequences of subfamily Murininae species downloaded from the National Center for Biotechnology Information (NCBI) GeneBank database using PhyloSuite v1.2.2 [41], with their accession numbers listed in Table 1. All Cyt b and COI sequences were aligned using the ClustalW algorithm [42] with default parameters in MEGA11 [43] and were truncated to 1140 bp and 657 bp, respectively. The genetic distances were calculated using the pairwise distance parameter based on the Kimura 2-parameter (K2P) model in the distance module of MEGA11 with a bootstrap procedure using 1000 replicates, employing the pairwise deletion option to remove ambiguous positions. ModelFinder [44] was used to select the best-fit model based on the Bayesian information criterion (BIC). Phylogenetic reconstruction for Cyt b and COI was carried out using Bayesian inference (BI) under the GTR+I+G+F model with MrBayes v3.2.6 [45] in PhyloSuite v1.2.2 [40], employing a partition model with two parallel runs and 2,000,000 generations, discarding the initial 25% of sampled data as burn-in. Maximum-likelihood phylogenies were inferred using IQ-TREE [46] under the GTR+I+G4+F model for Cyt b and TIM2+R4+F model for COI with 5000 ultrafast bootstraps [47].
Table 1. Species and GenBank accession numbers of sequences used for phylogenetic reconstruction.

3. Results

3.1. Systematic Description

Murina lvchun Xin Mou & Song Li, sp. nov.
Holotype: Field collection number KIZ20230972 and corresponding museum collection number KIZ025484, adult female, collected by Xin Mou and Song Li on 9 October 2023. The voucher specimen is stored at the Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS), Kunming, China. The mitochondrial Cyt b and COI nucleotide sequences were submitted to GenBank under accession number PQ815068 and PQ818017.
Type locality: Huanglianshan National Nature Reserve, Lvchun County, Yunnan Province, China (22.88° N, 102.30° E, 1724 m).
Paratype: Field collection number KIZ20230973 and corresponding museum collection number KIZ025485 (adult male), collected by Xin Mou and Song Li in Huanglianshan National Nature Reserve (22.88° N, 102.30° E, 1724 m) on 9 October 2023. The voucher specimen is stored at the Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS), Kunming, China. The mitochondrial Cyt b and COI nucleotide sequences were submitted to GenBank under accession number PQ815069 and PQ818018.
Etymology: The name lvchun denotes the toponym for the type (and only) locality of the species.
Measurements: Measurements of Murina lvchun are shown in Table 2.
Table 2. Weight, external, and craniodental measurements of the Murina lvchun Xin Mou & Song Li, sp. nov. “♂” indicates male; “♀” indicates female.
Diagnosis: Medium-sized Murina species, FA 32.76–35.36 mm and GTL 16.45–16.73 mm (Table 3). Tubular nostrils, lower part of the posterior border of the ear slightly emarginate, and tragus about half the length of the ear and notched at the base. Plagiopatagium attached close to the base of the claw on the outer toe. Dorsal hairs are reddish brown overall, with tricoloured bands that are reddish brown apically, lighter in the middle and grey–black at the bases; ventral hairs are greyish-white on the thorax and abdomen and brown on the shoulders, with grey-black bases. Forearms sparsely furred, and hind feet and dorsal part of the uropatagium densely furred near the body. A ring of black stiff hairs around the snout and eyes (Figure 1). Cerebral cranium rounded, with pronounced rostral concavity; sagittal crest slightly pronounced and lambdoid crest inconspicuous. In lateral view, I2 is partially obscured by I3, P2 is elongated but slightly shorter than P4 and longer than 2/3 of C1, and P4 is wider and slightly shorter than C1. In the maxillary occlusal view, crown areas of C1 and P4 are approximately equal; that of P2 is greater than 2/3 of P4; mesostyle is not very well developed in M1 and M2; and M3 is reduced. In the mandible, heights of P2 and P4 approximately equal and about 3/4 of C1, the crown areas of C1 and P4 are approximately equal, and the crown area of P2 about is 2/3 that of C1 and P4. M1 and M2 are short and broad, and their hypoconid is acute and connected to the hypoconulid by the postcristid (Figure 2).
Table 3. Weight (g), external and craniodental measurements (in mm) of some Murina species. “♂” indicates male; “♀” indicates female. Sample sizes that differ from the total number of specimens are given in italics. Data of M. pluvialis, M. annamitica and M. cyclotis were taken from the literature.
Figure 1. External morphology of Murina Lvchun Xin Mou & Song Li, sp. nov. (A) Holotype; (B) paratype. Dorsal (1), ventral (2) and lateral (3) views of unprocessed specimens; dorsal (4) and ventral (5) close-up photographs of stuffed specimens made after alcohol immersion. Scale = 10 mm.
Figure 2. Skull of Murina lvchun Xin Mou & Song Li, sp. nov. (A) Holotype; (B) paratype. Dorsal (1), ventral (2) and lateral (3) views of the skull; lateral (4) and occlusal (5) views of the mandible; lingual view of the mandibular (6) and maxillary (7) dentition; labial view of the upper (8) and lower (9) incisors and canines. Scale = 2 mm.
Description: Body: Medium-sized Murina species, WT 5–6.5 g, HB 41.3–46.11 mm, FA 32.76–35.36 mm, and STOTL 16.15–16.4 mm. Tubular nostrils opening sideways. Ears 14.9–16.3 mm, overall light brown, upper part almost rounded and lower part of the posterior border slightly emarginated. Tragus about half the length of the ear, slightly lighter in colour than the ear and not pointed apically, tending to widen from the tip to the base and distinctly widening about 1/3 of the way from the tip, with a distinct notch at the base. Third, fourth and fifth metacarpals are approximately equal (the third slightly longer than the fourth and fifth) and distinctly larger than the second metacarpal. HB (41.3–46.11 mm) is longer than TL (35.33–36.83 mm), tail slightly free at the tip and calcar extending in the uropatagium about 35–40% of the distance from the foot to the tip of the tail. The plagiopatagium isattached near the base of the claw on the outer toe (Figure 1 and Table 3).
Fur: Dorsal fur is denser and reddish brown overall, with the base dark grey or grey–black; the top reddish-brown; and the middle slightly lighter in colour than the top, yellowish-brown or light brown. Fur denser on the feet, the uropatagium near the body and the caudal vertebrae but sparse elsewhere; colour consistent with that of the dorsal fur. Short, sparse reddish-brown hairs on the forearms. Ventral fur greyish to greyish-brown on the thorax and abdomen, with the base dark grey or greyish-black and the top greyish to greyish-brown; light brown on the shoulders; and short, sparse and light brown on the uropatagium near the abdomen and caudal vertebrae. Shorter stiff black hairs around the muzzle and eyes, and longer, sparse greyish-white whiskers at the muzzle (Figure 1).
Skull: skull medium-sized, and GTL 16.45–16.73 mm. Sagittal crest is not well developed but clearly visible, slightly protruding from the cranial midline; the lambdoid crest is not obvious. The length of the rostrum is relatively long, with a prominent depression in the middle. In dorsal view, narial emargination is as wide as long; the braincase is almost circular; the zygomatic arch thin and straight, with almost no curvature; and the posterior edge of the skull curved. In ventral view, the palatine is narrow and slightly concave; the pterygoid is slightly curved inward; and the basisphenoid pits tear-drop-shaped, extending to the middle–lower part of the tymapanic bulla. In lateral view, the braincase is almost elliptical; the height from the snout to the parietal shows an upward trend, with a gentle slope, prominent depression between the snout and frontal end, with slight protrusion at the frontal end; and the zygomatic arch is wide and slightly robust, with the front and rear ends nearly horizontal, while the middle part slightly convex. ML 10.47–10.76 mm, and mandible slightly robust. In lateral view, the coronoid process is relatively high and no depression between it and the condyle, line connecting the condyle and angle is perpendicular to the horizontal line, with an obvious depression in the middle; and the angle is short and straight, with an obvious depression in the front (Figure 2 and Table 3).
Dentition: Dental formula, I 2   3 1   2   3 C 1 1 P M 2 4 2 4 M 1   2   3 1   2   3 = 34. In the maxilla, I2 is located laterally anterior to the second incisor (I3) and partially visible in the lateral view; crown area of P2 is larger than 2/3 that of P4, and crown area of C1 is roughly equal to that of P4. Murina lvchun clearly belongs to the ‘cyclotis-morphotype’, based on the above characteristics. Upper tooth rows converge slightly anteriorly; C1C1W/M3M3W ratio = 0.69–0.72. I2 is slightly higher than I3, with area less than half that of I3; I2 with two cusps, a smaller secondary cusp located behind the primary cusp. C1, without any secondary cusps, was significantly higher than P2 and P4; P2 is slightly lower than P4; P2 elongated; and P4 wider. In occlusal view, C1 is not rounded, P2 is slightly inclined rectangular and P4 slightly trapezoidal. The mesostyles of M1 and M2 is slightly reduced, but the M1 and M2 surfaces are still distinctly W-shaped and concave; the paracone, metacone and protocone are well developed, with the metacone slightly higher than the paracone; the trigon basin open and the talon well developed, with the antero-external valley area significantly smaller than that of the postero-external valley. M3 reduced, with only parastyles, paracones, and protocones; M1 of holotype has a more pointed mesostyle, subequal in height to the parastyle and metastyle; the mesostyle of M2 relatively rounded, distinctly lower than the parastyle and metastyle; and M3 reduced, with part of its structure lost. In the mandible, the first, second and third lower incisors (I1 I2, and I3) tricuspid and the outer cusps of I1, I2 and I3 slightly overlapped. Height gradually increases from I1 to I3, with C1 significantly higher than I3 and slightly higher than P2 and P4, approximately equal in height. The basal areas of C1 and P4 approximately equal, the basal area of P2 about 2/3 that of C1 and P4. In occlusal view, the trigonid of M1 and M2 approximately equilateral triangular in shape; the talonid wider and shorter, resulting in M1 and M2 appearing shorter and wider; the protoconid of M1 and M2 relatively rounded; the hypoconid more acute, with the protoconid and hypoconid of M3 the opposite; and the talonid of M3 slightly reduced. In labial view, the height of the hypoconid of M1 and M2 about half of that of the protoconid, whereas the height of the paraconid and metaconid about 1/3 of that of the protoconid; hypoconid connected to the hypoconulid by the postcristid, a tooth shape known as the myotodont type (Figure 2).
Comparisons: Based on its dentition, M. lvchun can be distinguished from all members of the ‘suilla-morphotype’ currently described as, in the members of the ‘suilla-morphotype’, I2 is anterior to I3, I2 is clearly visible in the lateral view, and the crown area of P2 is half or less than that of P4. Meanwhile, within the ‘cyclotis-morphotype’, M. aenea, M. fionae, M. guilleni, M. harrisoni, M. huttoni, M. peninsularis, M. puta and M. tiensa were all greater than M. lvchun in measurements of their GTL, STOTL, CBL and ML (if any), while M. lorelieae, M. rongjiangensi, M. rozendaali and M. shuipuensis were significantly smaller than M. lvchun in their GTL and CBL measurements; furthermore, the FA and CBL of female and male specimens of M. liboensis were smaller than those of female and male specimens of M. lvchun, respectively (Table 4).
Table 4. Body and skull size of species in ‘cyclotis-morphotype’. “♂” indicates male; “♀” indicates female. Sample sizes that differ from the total number of specimens are given in italics. Data for other species were taken from the literature.
Comparison with M. pluvialis: In the ‘cyclotis-morphotype’, M. lvchun is closest to M. pluvialis in external morphology and craniodental measurements. Nevertheless, the two species can be distinguished by the following characteristics: The overall colouration is different; although both reddish-brown, the former is more brown and latter more red. The sagittal crest and lambdoid crest of M. pluvialis are distinct, whereas the sagittal crest of M. lvchun is distinct but not as well developed as M. pluvialis, and the lambdoid crest is not readily apparent. The rostral depression of M. lvchun is obviously deeper. In lateral view of the mandible, the condyle of M. pluvialis is thicker and its depression from the angle is more obvious. In lateral view, the degree of obstruction of I2 is different; P2 of M. pluvialis appears short, with a height less than half of C1 and about 2/3 of the height of P4, while P2 of M. lvchun appears slender, with a height greater than 2/3 of C1 and slightly less than the height of P4. In the mandible, the hypoconids of M1 and M2 of M. lvchun appear more pointed and the hypoconid is connected to the hypoconulid by the postcristid, while the hypoconids of M1 and M2 of M. pluvialis are more rounded, and Ruedi et al. [29] have described that the postcristid is connected to the entoconid (Figure 1 and Figure 3A).
Figure 3. Skulls from principal species within the Murina genus for comparative analysis, sourced from the literature: (A) M. pluvialis (Ruedi et al. [29]); (B) M. cyclotis (Francis and Eger [30]); (C) M. annamitica (Francis and Eger [30]). Scale = 2 mm.
Comparison with M. cyclotis: Although the body size and craniodental measurements of M. cyclotis overlap with those of M. lvchun, there are still stable differences that distinguish them. The overall colour of M. lvchun is darker, and there is a mask of black bristles around the snout and eyes, which is not present in M. cyclotis. The sagittal and lambdoid crests of M. lvchun are not as obvious as those of M. cyclotis. In lateral view, the shape of P2 and the height of P2 relative to P4 are different between the two species. In occlusal view, the shapes of P2 and P4 are different between the two species, and the sizes of P2 and P4 of M. cyclotis are similar, while P2 of M. lvchun is obviously smaller than P4; M1 and M2 of M. cyclotis are without mesostyles and their labial surfaces have a U-shaped indentation, while that of M. lvchun has mesostyles and the surface is W-shaped. In the mandible, the height of P2 and P4 of M. cyclotis is about 2/3 of C1, while that of M. lvchun is clearly greater than 2/3 of C1 (Figure 1 and Figure 3B).
Comparison with M. annamitica: The body size and craniodental measurements of M. annamitica are smaller than those of M. lvchun. The overall colour of the dorsal hairs of the two species varies, with M. annamitica being yellowish-brown to brown and M. lvchun being brown. M. annamitica lacks a mask of black bristles on the snout and around the eyes; the posterior margin of the ear is not concave in M. annamitica but is slightly concave in M. lvchun. The maxillary tooth rows of M. annamitica are almost parallel to each other, whereas those of M. lvchun converge slightly anteriorly. In lateral view, the extent to which I2 is obscured; the relative heights of P2, P4 and C1; as well as the heights of mandibles P2 and P4 in relation to C1 of the two species are different. In occlusal view, the shape of P2 and the ratio of the talonid to trigonid area in M1 and M2 are different (Figure 1 and Figure 3C).
Distribution and habitat: Specimens of M. lvchun were collected from two different locations near the stream downstream from the Huanglianshan Reservoir in the Yakou Conservation Office of the Huanglianshan National Nature Reserve in Yunnan (22. 88° N, 102. 30° E, 1724 m and 22. 89° N, 102. 31° E, 1825 m; dominated by wet monsoon evergreen broad-leaved forest, Figure 4). The high humidity, the dense forest in the area, and the absence of caves and houses in the vicinity suggest that M. lvchun may be an arboreal bat.
Figure 4. Habitat at type locality of Murina lvchun Xin Mou & Song Li, sp. nov. at Huanglianshan National Nature Reserve, lvchun, Yunnan, China.

3.2. Molecular Phylogenetic Analyses

Bayesian inference and maximum-likelihood phylogenies resulted in similar topologies: The reconstructed phylogenetic tree based on the Cyt b gene sequences revealed that all specimens of M. lvchun formed a clade and a distinct lineage sister to M. pluvialis with a posterior probability of 1 and an ultrafast bootstrap value of 100. The reconstructed phylogenetic tree based on the COI gene sequences revealed that two specimens of M. lvchun (the COI gene sequences of KIZ20231014 and KIZ20231194 were not sequenced) clustered alone in a clade but did not form a distinct lineage sister to other species (Figure 5 and Figure 6). The smallest genetic distances between M. lvchun and Murina species were found for M. pluvialis (7.2–7.4% in the Cyt b gene sequences). In addition, the genetic distances between M. lvchun and other species of Murina were greater than 12% for both the Cyt b gene and COI gene sequences (Table 5 and Table 6).
Figure 5. Maximum-likelihood phylogenetic tree of Murina species based on Cyt b fragments. Node numbers before “/” indicate Bayesian posterior probabilities (values below 0.90 not shown), and numbers after “/” indicate ultrafast bootstrap support in maximum-likelihood analyses (values below 70 not shown).
Figure 6. Maximum-likelihood phylogenetic tree of Murina species based on COI fragments. Node numbers before “/” indicate Bayesian posterior probabilities (values below 0.90 not shown), and numbers after “/” indicate ultrafast bootstrap support in maximum-likelihood analyses (values below 70 not shown).
Table 5. Genetic distances (%) between species of Murina calculated from 1140 bp Cyt b gene fragment. Taxa arranged in ascending order according to the genetic distances with Murina lvchun Xin Mou & Song Li, sp. nov. Taxa with genetic distances greater than 17.5% from Murina lvchun Xin Mou & Song Li, sp. nov. not shown.
Table 6. Genetic distances (%) between species calculated from 657 bp COI gene fragment. Taxa arranged in ascending order according to the genetic distances with Murina lvchun Xin Mou & Song Li, sp. nov. Taxa with genetic distances greater than 19.0% from Murina lvchun Xin Mou & Song Li, sp. nov. not shown.

4. Discussion

We conducted an in-depth analysis of four specimens of M. lvchun using morphological and molecular approaches: morphologically, M. lvchun belong to the ‘cyclotis-morphotype’; can be distinguished from all members of the ‘suilla-morphotype’ and can be distinguished from the ‘cyclotis-morphotype’ M. aenea, M. huttoni, M. harrisoni, M. fionae, M. peninsularis, M. puta, M. tiensa, M. guilleni, M. rozendaali, M. liboensis, M. lorelieae, M. shuipuensis, and M. rongjiangensis according to body and skull size. We compared M. lvchun with M. pluvialis, M. cyclotis, and M. annamitica in detail (whose measurements are close to M. lvchun, among which M. pluvialis is most similar to M. lvchun) and found that these three species have discrete differences in morphology and skull parameters with respect to M. lvchun. At the molecular level, we sequenced the Cyt b and COI genes of M. lvchun. In the phylogenetic tree constructed based on the Cyt b gene sequence, M. lvchun and M. pluvialis formed a sister clade with a posterior probability of 1 and an ultrafast bootstrap value of 100; in the phylogenetic tree constructed based on the COI gene sequence, as there were no COI sequences of M. pluvialis, M. lvchun formed an independent branch and did not form a sister branch with any other species. This suggests that, among the 37 Murina species with Cyt b or COI gene sequences in Genebank (including all ‘cyclotis-morphotype’ members), M. lvchun and M. pluvialis are molecular sister taxa. At the same time, the interspecific genetic distance between the two species in the Cyt b gene sequence was 7.2–7.4%. Genetic distances less than 2% usually indicate intraspecific variation [51,52,53], and Hebert et al. [54] have suggested that the standard threshold for species differentiation should be 10 times the average genetic distance within the species; Baker and Bradley [55] stated that a genetic distance of 5% usually indicates a high probability of the existence of unrecognised genetic species. Although the above thresholds are subjective values selected from a review of published mammalian genetic distances, they are still of great importance for taxonomic research. The genetic distance between M. lvchun and M. pluvialis was greater than 5% and was more than 10 times the average genetic distance within M. lvchun (0.42%). This suggests that M. lvchun is probably a new species, genetically independent of M. pluvialis. In terms of morphology, M. lvchun can be distinguished from M. pluvialis based on their fur colour; their sagittal and lambdoid crests; their rostral depression; the thickness of their condyle; the degree of depression between their condyle and the angle; the relative heights of their P2, C1 and P4; the type of dentition of their M1 and M2 (M. lvchun is of the myotodont type, where the hypoconid is linked to the hypoconulid by the postcristid; M. pluvialis is of the nyctalodont type, where the entoconid and hypoconid are linked by the postcristid); and the shape of their hypoconid. These characteristic differences are sufficient to support the assertion of M. lvchun as a new species independent of M. pluvialis. In addition, the habitats of the two species are also quite different. According to the description of Ruedi et al. [29], the geographical coordinates of M. pluvialis are N 25°13′, E 91°40′, 780 m above sea level, and the habitat is secondary, dense evergreen forest, with the specimens collected in a small bamboo forest mixed with other plants. Meanwhile, the locality of M. lvchun belongs to wet monsoon evergreen broad-leaved forest (22. 88° N, 102. 30° E, 1724 m and 22. 89° N, 102. 31° E, 1825 m), which is more than 1000 m higher than the altitude recorded for M. pluvialis, and there is no obvious bamboo forest around the capture site. We, therefore, concluded that M. lvchun is a new species of Murina.
Although mtDNA-based barcoding sometimes performs poorly in taxonomic identification [56] (blurred species boundaries), manifested in overestimation of the number of putative species [57], missing taxa due to mtDNA introgression [58,59], or the suggestion of phantom lineages [60], an mtDNA analysis is currently the cheapest method to understand the genetic structure of unidentified species and the associated data are relatively complete (with more species sequences available for comparison). Therefore, it is still an important molecular marker to indicate whether a population has undescribed taxa. The genetic distance based on Cyt b between M. lvchun and M. pluvialis was 7.2–7.4%, which is greater than 5%, suggesting that M. lvchun is likely to be an undescribed new species. This inference was further corroborated by the results of a morphological study, indicating a strong congruence between molecular and morphological evidence in supporting the distinct taxonomic status of M. lvchun.
Due to the low migratory activity, high flight manoeuvrability and relatively low natural population density of Murina, the species composition of the genus may still be underestimated, despite the fact that its membership has more than doubled over the last two decades. The discovery of Murina lvchun Xin Mou & Song Li, sp. nov. has resulted in an increased number of known species in the genus Murina.

5. Conclusions

A new ‘cyclotis-morphotype’ species of Murina, Murina lvchun Xin Mou & Song Li, sp. nov., was described based on four specimens collected from the Huanglianshan National Nature Reserve, Lvchun, Yunnan, China. At present, the new species is known only from its type locality. Due to the presence of the Huanglianshan National Nature Reserve, there is relatively less human activity in the type locality. Therefore, the local ecological environment is relatively well preserved, and this species is apparently not threatened.

Author Contributions

Conceptualization, X.M. and S.L.; methodology, X.M. and S.L.; software, X.M. and Y.Q.; validation, all authors; formal analysis, X.M. and S.L.; investigation, all authors; resources, W.W., W.Z. and J.W.; data curation, X.M.; writing—original draft preparation, X.M.; writing—review and editing, X.M. and S.L.; visualization, X.M. and Y.Q.; supervision, S.L.; project administration, S.L.; funding acquisition, S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Survey of Chiroptera Species Diversity and Distribution in Northwest and Southwest of China (2021FY100302), the Project of Huanglianshan National Nature Reserve Animal Diversity Expedition (E2023HLS001) and the Position of Bioclassonomist of Chinese Academy of Sciences (CAS-TAX-24-055).

Institutional Review Board Statement

Ethical review and approval were waived for this study, due to the specimens and preserved tissue samples coming from the collections of Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS), and this study did not involve any harm to living animals.

Data Availability Statement

All data are presented in this article.

Acknowledgments

We thank the forest rangers of Yunnan Huanglianshan National Nature Reserve Management Bureau for their assistance in re-investigating the habitat of the specimens and the field work. We also thank our workmates for their help and advice in writing and submitting the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gray, J.E. On the natural arrangement of vertebrose animals. Lond. Med. Repos. 1821, 15, 299–300. [Google Scholar]
  2. Burgin, C.J.; Colella, J.P.; Kahn, P.L.; Upham, N.S. How many species of mammals are there? J. Mammal. 2018, 99, 1–14. [Google Scholar] [CrossRef]
  3. Simmons, N.B. Order Chiroptera. In Mammal Species of the World: A Taxonomic and Geographic Reference, 3rd ed.; Wilson, D.E., Reeder, D.M., Eds.; Johns Hopkins University Press: Baltimore, MD, USA, 2005; pp. 312–529. [Google Scholar]
  4. ASM Mammal Diversity Database. Available online: https://www.mammaldiversity.org/taxa.html (accessed on 4 December 2024).
  5. Hill, J.; Smith, J. Bats: A Natural History, 1st ed.; University of Texas Press: Austin, TX, USA, 1992; 248p. [Google Scholar]
  6. Miller, G.S. The families and genera of bats. Bull. U.S. Natl. Mus. 1907, 57, 229. [Google Scholar]
  7. Corbet, G.B.; Hill, J.E. The Mammals of the Indomalayan Region: A Systematic Review; Oxford University Press: New York, UK, 1992; pp. 148–149. [Google Scholar]
  8. Koopman, K.F. Order Chiroptera. In Mammal Species of the World: A Taxonomic and Geographic Reference, 2nd ed.; Wilson, D.E., Reeder, D.M., Eds.; Smithsonian Institution Press: Washington, DC, USA, 1973; pp. 137–241. [Google Scholar]
  9. Koopman, K.F. Chiroptera: Systematics. In Handbook of Zoology; Niethammer, J., Schliemann, H., Starck, D., Eds.; Walter de Gruyter: Berlin, Germany, 1994; Volume 8, 217p. [Google Scholar]
  10. Pavlinov, I.Y. Systematics of Recent Mammals; Moscow University Publisher: Moscow, Russia, 2003; [In Russian]. [Google Scholar]
  11. Thomas, O. A special genus for the Himalayan bat known as Murina grisea. Ann. Mag. Nat. Hist. 1915, 16, 309–310. [Google Scholar] [CrossRef]
  12. Bhattacharyya, T.P. Taxonomic status of the genus Harpiola Thomas, 1915 (Mammalia: Chiroptera: Vespertilionidae), with a report of the occurrence of Harpiola grisea (Peters, 1872) in Mizoram, India. Proc. Zool. Soc. 2002, 55, 73–76. [Google Scholar]
  13. Kuo, H.C.; Fang, Y.P.; Csorba, G.; Lee, L.L. The definition of Harpiola (Vespertilionidae: Murininae) and the description of a new species from Taiwan. Acta Chiropterol. 2006, 8, 11–19. [Google Scholar] [CrossRef]
  14. Kruskop, S.V.; Kalyakin, M.V.; Abramov, A.V. First record of Harpiola (Chiroptera, Vespertilionidae) from Vietnam. Russ. J. Theriol. 2006, 5, 13–16. [Google Scholar] [CrossRef]
  15. Li, S.; Mou, X.; Li, M.C.; Li, F.Y.; Li, M.; Li, B.; Li, M.J.; Luo, X.; Csorba, G.; Kuo, H.C. New records of Harpiola isodon (Chiroptera, Vespertilionidae) from the Chinese mainland. Biodivers. Data J. 2024, 12, e120670. [Google Scholar] [CrossRef] [PubMed]
  16. Gray, J.E. Description of some new genera and fifty unrecorded species of Mammalia. Ann. Mag. Nat. Hist. 1842, 10, 255–267. [Google Scholar] [CrossRef]
  17. Csorba, G.; Bates, P.J.J. Description of a new species of Murina from Cambodia (Chiroptera: Vespertilionidae: Murininae). Acta Chiropt. 2005, 7, 1–7. [Google Scholar] [CrossRef]
  18. Csorba, G.; Thong, D.V.; Bates, P.J.J.; Furey, N.M. Description of a new species of Murina from Vietnam (Chiroptera: Vespertilionidae: Murininae). Occas. Pap. Tex. Technol. Univ. Mus. 2007, 268, 1–12. [Google Scholar] [CrossRef]
  19. Csorba, G.; Son, N.S.; Saveng, I.; Furey, N.M. Revealing cryptic bat diversity: Three new Murina and redescription of Murina tubinaris from southeast Asia. J. Mammal. 2011, 92, 891–904. [Google Scholar] [CrossRef]
  20. Furey, N.M.; Thong, V.D.; Bates, P.J.J.; Csorba, G. Description of a new species belonging to the Murina ‘suilla-group’ (Chiroptera: Vespertilionidae: Murininae) from north Vietnam. Acta Chiropt. 2009, 11, 225–236. [Google Scholar] [CrossRef]
  21. Kuo, H.C.; Fang, Y.P.; Csorba, G.; Lee, L.L. Three new species of Murina (Chiroptera: Vespertilionidae) from Taiwan. J. Mammal. 2009, 90, 980–991. [Google Scholar] [CrossRef]
  22. Soisook, P.; Karapan, S.; Satasook, C.; Bates, P.J.J. A new species of Murina (Mammalia: Chiroptera: Vespertilionidae) from peninsular Thailand. Zootaxa 2013, 4, 567–579. [Google Scholar] [CrossRef] [PubMed]
  23. Soisook, P.; Karapan, S.; Satasook, C.; Thong, V.D.; Khan, F.A.A.; Maryanto, I.; Csorba, G.; Furey, N.; Aul, B.; Bates, P.J.J. A review of the Murina cyclotis complex (Chiroptera: Vespertilionidae) with descriptions of a new species and subspecies. Acta Chiropt. 2013, 15, 271–292. [Google Scholar] [CrossRef]
  24. Son, N.T.; Csorba, G.; Tu, V.T.; Thong, V.D.; Wu, Y.; Harada, M.; Oshida, T.; Endo, H.; Motokawa, M. A new species of the genus Murina (Chiroptera: Vespertilionidae) from the Central Highlands of Vietnam with a review of the subfamily Murininae in Vietnam. Acta Chiropt. 2015, 17, 201–232. [Google Scholar] [CrossRef]
  25. Chen, J.; Liu, T.; Deng, H.Q.; Xiao, N.; Zhou, J. A new species of Murina bats was discovered in Guizhou Province, China. Cave Res. 2017, 2, 1–10. [Google Scholar]
  26. Zeng, X.; Chen, J.; Deng, H.Q.; Xiao, N.; Zhou, J. A new species of Murina from China (Chiroptera: Vespertilionidae). Ekoloji 2018, 103, 9–16. [Google Scholar]
  27. Kruskop, S.V.; Eger, J.L. A new species of tube-nosed bat Murina (Vespertilionidae: Chiroptera) from Vietnam. Acta Chiropt. 2008, 10, 213–220. [Google Scholar] [CrossRef]
  28. Eger, J.L.; Lim, B.K. Three New Species of Murina from Southern China (Chiroptera: Vespertilionidae). Acta Chiropt. 2011, 13, 227–243. [Google Scholar] [CrossRef]
  29. Ruedi, M.; Biswas, J.; Csorba, G. Bats from the wet: Two new species of tube-nosed bats (Chiroptera: Vespertilionidae) from Meghalaya, India. Rev. Suisse. Zool. 2012, 119, 111–135. [Google Scholar] [CrossRef]
  30. Francis, C.M.; Eger, J.L. A review of tube-nosed bats (Murina) from Laos with a description of two new species. Acta Chiropt. 2012, 14, 15–38. [Google Scholar] [CrossRef]
  31. He, F.; Xiao, N.; Zhou, J. A new species of Murina from China (Chiroptera: Vespertilionidae). Cave Res. 2015, 2, 1–6. Available online: https://www.researchgate.net/publication/282651837_A_new_species_of_Murina_from_China_Chiroptera_Vespertilionidae (accessed on 27 December 2024).
  32. Yu, W.H.; Csorba, G.; Wu, Y. Tube-nosed variations–a new species of the genus Murina (Chiroptera: Vespertilionidae) from China. Zool. Res. 2020, 41, 70–77. [Google Scholar] [CrossRef]
  33. Mou, X.; Qian, Y.; Li, M.; Li, B.; Luo, X.; Li, S. A New Species of Murina (Chiroptera: Vespertilionidae) from Yunnan, China. Animals 2024, 14, 2371. [Google Scholar] [CrossRef] [PubMed]
  34. Murina Gray, 1842 in GBIF Secretariat (2023). GBIF Backbone Taxonomy. Available online: https://www.gbif.org/species/2432317 (accessed on 14 October 2024).
  35. Wei, F.W.; Yang, Q.S.; Wu, Y.; Jiang, X.L.; Liu, S.Y.; Li, B.G.; Yang, G.; Li, M.; Zhou, J.; Li, S.; et al. Catalogue of mammals in China (2021). Acta Theriol. Sin. 2021, 41, 487–501. [Google Scholar] [CrossRef]
  36. Matveev, V.A. Checklist of Cambodian bats (Chiroptera), with new records and remarks on taxonomy. Russ. J. Theriol. 2005, 4, 43–62. [Google Scholar] [CrossRef]
  37. Bates, P.J.J.; Harrison, D.L. Bats of the Indian Subcontinent; Harrison Zoological Museum: Sevenoaks, UK, 1997; 258p. [Google Scholar]
  38. Velazco, P.M.; Gardner, A.L. A new species of Lophostoma (Chiroptera: Phyllostomidae) from Panama. J. Mammal. 2012, 93, 605–614. [Google Scholar] [CrossRef]
  39. Ibáñez, C.; García-Mudarra, J.L.; Ruedi, M.; Stadelmann, B.; Juste, J. The Iberian contribution to cryptic diversity in European bats. Acta Chiropt 2006, 8, 277–297. [Google Scholar] [CrossRef]
  40. Weyeneth, N.; Goodman, S.; Stanley, W.; Ruedi, M. The biogeography of Miniopterus bats (Chiroptera: Miniopteridae) from the Comoro Archipelago inferred from mitochondrial DNA. Mol. Ecol. 2008, 17, 5205–5219. [Google Scholar] [CrossRef]
  41. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
  42. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
  43. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  44. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
  45. Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  46. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  47. Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [PubMed]
  48. Bumrungsri, S.; Harrison, D.L.; Satasook, C.; Prajukjitr, A.; Thong-Aree, S.; Bates, P.J.J. A review of bat research in Thailand with eight new species record for the country. Acta Chiropt. 2006, 8, 325–359. [Google Scholar] [CrossRef]
  49. Son, N.T.; Motokawa, M.; Oshida, T.; Thong, V.D.; Csorba, G.; Endo, H. Multivariate analysis of the skull size and shape in tube-nosed bats of the genus Murina (Chiroptera: Vespertilionidae) from Vietnam. Mammal Study 2015, 40, 79–94. [Google Scholar] [CrossRef]
  50. Hill, J.E.; Francis, C.M. New bats (Mammalia: Chiroptera) and new records ofbats from Borneo and Malaya. Bull. Br. Mus. Nat. Hist. Zool. 1984, 47, 303–329. [Google Scholar] [CrossRef]
  51. Avise, J.C. Phylogeography: The History and Formation of Species; Harvard University Press: Cambridge, MA, USA, 2000. [Google Scholar]
  52. Bradley, R.D.; Baker, R.J. A test of the genetic species concept: Cytochrome-b sequences and mammals. J. Mammal. 2001, 82, 960–973. [Google Scholar] [CrossRef]
  53. Hebert, P.D.; Ratnasingham, S.; deWaard, J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closelyrelated species. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270 (Suppl. S1), S96–S99. [Google Scholar] [CrossRef] [PubMed]
  54. Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [PubMed]
  55. Baker, R.J.; Bradley, R.D. Speciation in mammals and the genetic species concept. J. Mammal. 2006, 87, 643–662. [Google Scholar] [CrossRef]
  56. Galtier, N.; Nabholz, B.; Glémin, S.; Hurst, G.D. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Mol. Ecol. 2009, 18, 4541–4550. [Google Scholar] [CrossRef] [PubMed]
  57. Harrington, S.; Burbrink, F. Complex cycles of divergence and migration shape lineage structure in the common kingsnake species complex. J. Biogeogr. 2022, 50, 341–351. [Google Scholar] [CrossRef]
  58. Babik, W.; Branicki, W.; Crnobrnja-Isailović, J.; Cogălniceanu, D.; Sas, I.; Olgun, K.; Poyarkov, N.A.; Garcia-París, M.; Arntzen, J.W. Phylogeography of two European newt species — discordance between mtDNA and morphology. Mol. Ecol. 2005, 14, 2475–2491. [Google Scholar] [CrossRef] [PubMed]
  59. Dufresnes, C.; Mazepa, G.; Jablonski, D.; Caliari Oliveira, R.; Wenseleers, T.; Shabanov, D.; Auer, M.; Ernst, R.; Koch, C.; Ramírez-chaves, H.E.; et al. Fifteen shades of green: The evolution of Bufotes toads revisited. Mol. Phylogenet. Evol. 2019, 141, 106615. [Google Scholar] [CrossRef]
  60. Dufresnes, C.; Ghielmi, S.; Halpern, B.; Martínez-Freiría, F.; Mebert, K.; Jelić, D.; Crnobrnja-Isailović, J.; Gippner, S.; Jablonski, D.; Joger, U.; et al. Phylogenomic insights into the diversity and evolution of Palearctic vipers. Mol. Phylogenet. Evol. 2024, 197, 108095. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.