De Novo Assembly, Characterization, and Comparative Transcriptome Analysis of Mature Male and Female Gonads of Rabbitfish (Siganus oramin) (Bloch & Schneider, 1801)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction and Library Construction
2.3. Library Sequencing, De Novo Assembly, and Annotation
2.4. Identification of Differentially Expressed Genes (DEGs) and Enrichment Analysis
2.5. Validation of DEGs by Quantitative Real-Time PCR (qRT-PCR)
3. Results
3.1. Illumina Sequencing and Assembly Results
3.2. Unigene Annotation
3.3. Differential Expression Analysis
3.4. Validation of DEGs by qRT-PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Huang, X.; Li, T.; Lin, H.; Yang, Y.; Yu, W.; Huang, Z. Observation on embryonic development of cage-breeding Siganus oramin. South China Fish. Sci. 2018, 14, 96–101. [Google Scholar]
- Huang, X.; Yang, Y.; Li, T.; Yu, W.; Huang, Z.; Lin, H.; Shu, H. Gonadal development of first sexual maturation of Siganus oramin cultured in pond. South China Fish. Sci. 2020, 16, 99–107. [Google Scholar]
- Huang, X.; Li, Q.; Li, W.; Han, C.; Yang, Y.; Huang, Z.; Lin, H. Rabbitfish (Siganus oramin) gut microbiota description of farmed and wild specimens. Aquac. Rep. 2024, 35, 101928. [Google Scholar] [CrossRef]
- Xun, P.; Zhou, C.; Huang, X.; Huang, Z.; Yu, W.; Yang, Y.; Huang, J.; Wu, Y.; Wang, R.; Lin, H. Effects of dietary sodium acetate on intestinal health of juvenile Trachinotus ovatus based on multi-omics approach. Aquaculture 2023, 562, 738776. [Google Scholar] [CrossRef]
- Wang, F.H.; Li, R.J.; Xie, M.Q.; Li, A.X. The serum of rabbitfish (Siganus oramin) has antimicrobial activity to some pathogenic organisms and a novel serum L-amino acid oxidase is isolated. Fish Shellfish. Immunol. 2011, 30, 1095–1108. [Google Scholar] [CrossRef] [PubMed]
- Guo, Z.; Zhang, W.; Du, S.; Zhou, Y.; Gao, N.; Zhang, L.; Green, I. Feeding reduces waterborne Cu bioaccumulation in a marine rabbitfish Siganus oramin. Environ. Pollut. 2016, 208, 580–589. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhang, W.; Guo, Z.; Zhang, L. Effects of salinity and copper co-exposure on copper bioaccumulation in marine rabbitfish Siganus oramin. Chemosphere 2017, 168, 491–500. [Google Scholar] [CrossRef] [PubMed]
- Marshall Graves, J.A. Weird animal genomes and the evolution of vertebrate sex and sex chromosomes. Annu. Rev. Genet. 2008, 42, 565–586. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y. Biology of Mandarin fish in Liangzi Lake. J. Aquat. Biol. 1959, 03, 375–385. [Google Scholar]
- Fan, Z.; You, F.; Wang, L.; Weng, S.; Wu, Z.; Hu, J.; Zou, Y.; Tan, X.; Zhang, P. Gonadal transcriptome analysis of male and female olive flounder (Paralichthys olivaceus). Biomed. Res. Int. 2014, 2014, 291067. [Google Scholar] [CrossRef] [PubMed]
- Du, X.X.; Wang, B.; Liu, X.M.; Liu, X.B.; He, Y.; Zhang, Q.Q.; Wang, X.B. Comparative transcriptome analysis of ovary and testis reveals potential sex-related genes and pathways in spotted knifejaw Oplegnathus punctatus. Gene 2017, 637, 203–210. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Liu, K.Q.; Feng, B.; Zhang, Z.H.; Wang, R.K.; Tang, L.L.; Li, W.S.; Li, Q.Y.; Piferrer, F.; Shao, C.W. Transcriptome of gonads from high temperature induced sex reversal during sex determination and differentiation in Chinese tongue sole, Cynoglossus semilaevis. Front. Genet. 2019, 10, 1128. [Google Scholar] [CrossRef] [PubMed]
- Tian, C.X.; Li, Z.Y.; Dong, Z.D.; Huang, Y.; Du, T.; Chen, H.P.; Jiang, D.N.; Deng, S.P.; Zhang, Y.L.; Wanida, S.; et al. Transcriptome analysis of male and female mature gonads of silver sillago (Sillago sihama). Genes 2019, 10, 129. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.P.; Li, Z.Y.; Wang, Y.R.; Huang, H.; Yang, X.W.; Li, S.F.; Yang, W.; Li, G.L. Comparison of gonadal transcriptomes uncovers reproduction-related genes with sexually dimorphic expression patterns in Diodon hystrix. Animals 2021, 11, 1042. [Google Scholar] [CrossRef] [PubMed]
- Mustapha, U.F.; Peng, Y.X.; Huang, Y.Q.; Assan, D.; Zhi, F.; Shi, G.; Huang, Y.; Li, G.L.; Jiang, D.N. Comparative transcriptome analysis of the differentiating gonads in Scatophagus argus. Front. Mar. Sci. 2022, 9, 962534. [Google Scholar] [CrossRef]
- Zhu, Q.Y.; Han, C.; Liu, S.Y.; Ouyang, H.F.; Liu, D.R.; Zhang, Z.W.; Huang, J.J.; Han, L.Q.; Li, S.S.; Li, G.F.; et al. Development and gene expression analysis of gonad during 17α-methyltestosterone-induced sex reversal in mandarin fish (Siniperca chuatsi). Aquac. Rep. 2022, 23, 101049. [Google Scholar] [CrossRef]
- Han, C.; Huang, W.W.; Peng, S.H.; Zhou, J.W.; Zhan, H.W.; Zhang, Y.Y.; Li, W.J.; Gong, J.; Li, Q. De Novo Assembly, Characterization and Comparative Transcriptome Analysis of the Mature Gonads in Spinibarbus hollandi. Animals 2022, 13, 166. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Han, C.; Zhang, Y. De novo assembly, characterization and comparative transcriptome analysis of gonads reveals sex-biased genes in Coreoperca whiteheadi. Comp. Biochem. Physiol. Part D Genom. Prot. 2023, 47, 101115. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.F.; Zhou, Y.Q.; Chen, Y.R.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, 884–890. [Google Scholar] [CrossRef] [PubMed]
- Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef]
- Simão, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S. Fast gapped-read alignment with Bowtie 2. Nat. Meth. 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; McCarthy, D.J.; Chen, Y.; Okoniewski, M.; Smyth, G.K.; Huber, W.; Robinson, M.D. Count-based differential expression analysis of RNA sequencing data using R and Bioconductor. Nat. Protoc. 2013, 8, 1765–1786. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. Cluster profiler: An R package for comparing biological themes among gene clusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Li, M.; Ma, H.; Liu, X.; Shi, H.; Li, M.; Wang, D. Mutation of foxl2 or cyp19a1a results in female to male sex reversal in XX Nile tilapia. Endocrinology 2017, 158, 2634–2647. [Google Scholar] [CrossRef] [PubMed]
- Lau, E.S.W.; Zhang, Z.; Qin, M.; Ge, W. Knockout of zebrafish ovarian aromatase gene (cyp19a1a) by TALEN and CRISPR/Cas9 leads to all-male offspring due to failed ovarian differentiation. Sci. Rep. 2016, 6, 37357. [Google Scholar] [PubMed]
- Li, M.; Sun, Y.; Zhao, J.; Shi, H.; Zeng, S.; Ye, K.; Jiang, D.; Zhou, L.; Sun, L.; Tao, W.; et al. A tandem duplicate of anti-Müllerian hormone with a missense SNP on the Y chromosome is essential for male sex determination in Nile tilapia, Oreochromis niloticus. PLoS Genet. 2015, 11, e1005678. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Dai, S.; Wu, J.; Wei, X.; Zhou, X.; Chen, M.; Tan, D.; Pu, D.; Li, M.; Wang, D. Roles of anti-Müllerian hormone and its duplicates in sex determination and germ cell proliferation of Nile tilapia. Genetics 2022, 220, iyab237. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.Q.; Deng, K.; Labosky, P.A.; Liaw, L.; Hogan, B.L.M. The gene encoding bone morphogenetic protein 8B is required for the initiation and maintenance of spermatogenesis in the mouse. Genes Dev. 1996, 10, 1657–1669. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.Q.; Liaw, L.; Hogan, B.L.M. Bone morphogenetic protein 8A plays a role in the maintenance of spermatogenesis and the integrity of the epididymis. Development 1998, 125, 1103–1112. [Google Scholar] [CrossRef] [PubMed]
- Lei, X.; Cui, K.; Cai, X.; Ren, Y.; Liu, Q.; Shi, D. Bone morphogenetic protein 1 is expressed in porcine ovarian follicles and promotes oocyte maturation and early embryonic development. J. Veter. Med. Sci. 2017, 79, 258–266. [Google Scholar] [CrossRef] [PubMed]
- Pelliccia, J.L.; Jindal, G.A.; Burdine, R.D. Gdf3 is required for robust Nodal signaling during germ layer formation and left-right patterning. eLife 2017, 6, e28635. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Patel, H.; Mukai, S.; Melino, C.; Garg, R.; Ni, X.; Chang, J.; Peng, C. Activin, Inhibin, and Follistatin in Zebrafish Ovary: Expression and Role in Oocyte Maturation. Biol. Reprod. 2000, 62, 1585–1592. [Google Scholar] [CrossRef] [PubMed]
- Findlay, J.K. An update on the roles of inhibin, activin and follistatin as local regulators of folliculogenesis. Biol. Reprod. 1993, 48, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Takehana, Y.; Matsuda, M.; Myosho, T.; Suster, M.L.; Kawakami, K.; Shini, T.; Kohara, Y.; Kuroki, Y.; Toyoda, A.; Fujiyama, A.; et al. Co-option of Sox3 as the Male-Determining Factor on the Y Chromosome in the Fish Oryzias dancena. Nat. Commun. 2014, 5, 4157. [Google Scholar] [CrossRef] [PubMed]
- Schartl, M.; Schories, S.; Wakamatsu, Y.; Nagao, Y.; Hashimoto, H.; Bertin, C.; Mourot, B.; Schmidt, C.; Wilhelm, D.; Centanin, L.; et al. Sox5 is involved in germ-cell regulation and sex determination inmedaka following co-option of nested transposable elements. BMC Biol. 2018, 16, 16. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Wang, B.; Du, H. A review on sox genes in fish. Rev. Aquac. 2021, 13, 1986–2003. [Google Scholar] [CrossRef]
- Jiang, Y.H.; Han, K.H.; Wang, S.H.; Chen, Y.; Wang, Y.L.; Zhang, Z.P. Identification and expression of transcription factor sox2 in large yellow croaker Larimichthys crocea. Theriogenology 2018, 120, 123–137. [Google Scholar] [CrossRef] [PubMed]
- Navarro-Martın, L.; Galay-Burgos, M.; Sweeney, G.; Piferrer, F. Different sox17 transcripts during sex differentiation in sea bass, Dicentrarchus labrax. Mol. Cell. Endocr. 2009, 299, 240–251. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Luo, X.; Qu, C.; Xu, T.; Zou, G.; Liang, H. The Important Role of Sex-Related Sox Family Genes in the Sex Reversal of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Biology 2022, 11, 83. [Google Scholar] [CrossRef] [PubMed]
- Nicol, B.; Guiguen, Y. Expression Profiling of Wnt Signaling Genes during Gonadal Differentiation and Gametogenesis in Rainbow Trout. Sex. Dev. 2011, 5, 318–329. [Google Scholar] [CrossRef] [PubMed]
- Turk, R.; Zachary, E.; Alaina, B.; Alexandra, L.; Debojyoti, D.; Sunil, S.; Rebecca, S. Evolutionary Turnover in Wnt Gene Expression but Conservation of Wnt Signaling during Ovary Determination in a TSD Reptile. Sex. Dev. 2021, 15, 47–68. [Google Scholar]
- Harwood, B.N.; Cross, S.K.; Radford, E.E.; Haac, B.E.; De Vries, W.N. Members of the WNT signaling pathways are widely expressed in mouse ovaries, oocytes, and cleavage stage embryos. Dev. Dyn. 2008, 237, 1099–1111. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Li, Y.; Ma, W.; Li, H.; He, F.; Pu, D.; Su, T.; Wang, S. Analysis of WNT9B mutations in Chinese women with Mayer–Rokitansky–Küster–Hauser syndrome. Reprod. Biomed. Online 2014, 28, 80–85. [Google Scholar] [CrossRef] [PubMed]
- Wergedal, J.E.; Kesavan, C.; Brommage, R.; Das, S.; Mohan, S. Role of WNT16 in the Regulation of Periosteal Bone Formation in Female Mice. Endocrinology 2015, 156, 1023–1032. [Google Scholar] [CrossRef] [PubMed]
- Habara, O.; Logan, C.Y.; Kanai-Azuma, M.; Nusse, R.; Takase, H.M. WNT signaling in pre-granulosa cells is required for ovarian folliculogenesis and female fertility. Development 2021, 148, dev198846. [Google Scholar] [CrossRef] [PubMed]
Primer ID | Primer Sequences |
---|---|
actinF | AATCGTGCGTGACATCAAG |
actinR | GGAAGGAAGGCTGGAAGA |
amhF | GTTTCCTGACCGAGGTCATGCC |
amhR | AGCTCCGCCAGAAGCGTTTG |
amhrIIF | TTTACTTCTCACGTGCCTCATG |
amhrIIR | CAGCAACTGCTCCAGTTCAATAT |
bmp1F | CGACTCCAGGTCACCGTATCAAA |
bmp1R | AAACGCATGTCTCGCCCATC |
bmp8F | ACTGGACCATAAATACCCCAAAAAG |
bmp8R | TCCTGAAGAAGCACCGCAAC |
egfr3F | ATGGTGAAATGCTGGATGATAGATG |
egfr3R | TAGGGTCCGAGGGACTTGGT |
foxl2F | AGGGTTGGCAGAACAGTATCAGG |
foxl2R | GAAATGCGTCGGTGGAGGTC |
fshF | TCAAACCATCGCTGAGATACGG |
fshR | CCAACTCACTGGAACCCACAAA |
ghr1F | AGCCACAGAGCCAGCAGACAA |
ghr1R | GCCCACAATCCCAAAAAATAGG |
hsd11b1F | GAGGGAGAAGGTCTTACAACAGG |
hsd11b1R | TTGAGAATGAGATAATCCAACCC |
igf2F | ACCTGTTCATCCCGGCGCTT |
igf2R | TCCTCTGCTTGGCATCCATCC |
nano3F | CACTCGCCACTGGTACTCAATTACTAAT |
nano3R | GCGGGACGTGATGGAAGCTT |
sp6F | CTGGCAGAGATGGTGGTGGA |
sp6R | TGGACAGCTCAGGCGTGTGT |
zp3F | GCCTTCAGGTTCCACCAGGAC |
zp3R | GCCACCCATCTGTTGGTTTCG |
ZP4F | TTGAGTGGTTGCTGGTGGTCC |
ZP4R | CAGGTGTTTAGCGCTTTGTGG |
Sample ID | Reads (#) | Base (nt) | GC (%) | Q20 (%) | Q30 (%) |
---|---|---|---|---|---|
F1 | 61,675,162 | 9,251,274,300 | 51.69 | 98.39; 96.97 | 95.05; 91.47 |
F2 | 57,693,072 | 8,653,960,800 | 51.42 | 98.61; 97.81 | 95.76; 93.38 |
F3 | 48,472,486 | 7,270,872,900 | 51.99 | 98.56; 97.96 | 95.58; 93.81 |
M1 | 46,836,218 | 7,025,432,700 | 51.35 | 98.37; 97.31 | 95.02; 92.29 |
M2 | 48,159,824 | 7,223,973,600 | 51.52 | 98.54; 97.54 | 95.50; 92.74 |
M3 | 48,686,820 | 7,303,023,000 | 50.86 | 98.41; 97.50 | 95.21; 92.76 |
Transcript | Unigene | |
---|---|---|
Seqs Num (#): | 71,435 | 47,070 |
Total length (nt): | 108,866,991 | 54,799,987 |
Average length (nt): | 1524 | 1164 |
Max length (nt): | 23,938 | 23,938 |
Min length (nt): | 189 | 189 |
GC: | 49.67% | 48.82% |
N50: | 2875 | 2488 |
Unigene ID | log2 Fold Change (Testes vs. Ovaries) | p-Value (Testes vs. Ovaries) | FDR (Testes vs. Ovaries) | Nr Annotation | Gene Name |
---|---|---|---|---|---|
unigene020497 | 3.352 | 5.35 × 10−11 | 4.19 × 10−10 | anti-Mullerian hormone | amh |
unigene033316 | 2.184 | 1.97 × 10−05 | 5.86 × 10−05 | anti-Mullerian hormone type-2 receptor | amhrII |
unigene038440 | 2.715 | 1.09 × 10−12 | 1.12 × 10−11 | bone morphogenetic protein 8 | bmp8 |
unigene023167 | 3.447 | 1.23 × 10−08 | 6.52 × 10−08 | sterol 26-hydroxylase | cyp27a1 |
unigene033805 | 2.154 | 5.47 × 10−05 | 1.50 × 10−04 | progesterone receptor | pgr |
unigene043282 | 6.890 | 2.77 × 10−08 | 1.38 × 10−07 | sperm-associated antigen 17 | sp17 |
unigene035428 | 9.357 | 4.66 × 10−12 | 4.29 × 10−11 | sperm-associated antigen 6 | sp6 |
unigene041677 | −3.473 | 2.39 × 10−07 | 1.01 × 10−06 | bone morphogenetic protein 1 | bmp1 |
unigene027476 | −2.687 | 4.49 × 10−06 | 1.51 × 10−05 | activin receptor type-2B | acvr2B |
unigene001102 | −3.171 | 2.34 × 10−02 | 3.76 × 10−02 | aromatase | cyp19a1a |
unigene018423 | −2.467 | 2.83 × 10−11 | 2.32 × 10−10 | epidermal growth factor receptor | egfr |
unigene000002 | −3.255 | 1.18 × 10−04 | 3.03 × 10−04 | fibroblast growth factor 13 | fgf13 |
unigene035775 | −2.514 | 1.05 × 10−03 | 2.25 × 10−03 | fibroblast growth factor 16 | fgf16 |
unigene008560 | −3.554 | 1.87 × 10−05 | 5.59 × 10−05 | fibroblast growth factor 20 | fgf20 |
unigene011482 | −2.568 | 6.69 × 10−11 | 5.14 × 10−10 | fibroblast growth factor receptor 1 | fgfr1 |
unigene019550 | −3.799 | 8.28 × 10−08 | 3.79 × 10−07 | forkhead box protein B1 | foxb1 |
unigene040133 | −6.681 | 8.14 × 10−18 | 1.62 × 10−16 | forkhead box protein L2 | foxl2 |
unigene021398 | −6.080 | 1.31 × 10−40 | 1.34 × 10−38 | growth/differentiation factor 3 | gdf3 |
unigene043259 | −2.742 | 1.04 × 10−07 | 4.67 × 10−07 | growth hormone receptor | ghr |
unigene016245 | −5.765 | 3.13 × 10−06 | 1.08 × 10−05 | insulin-like growth factor 2 mRNA-binding protein 3 | igfbp2 |
unigene015144 | −2.828 | 7.16 × 10−05 | 1.91 × 10−04 | inhibin beta | inhb |
unigene032568 | −2.325 | 1.83 × 10−03 | 3.75 × 10−03 | luteinizing hormone receptor | lhr |
unigene019625 | −6.603 | 6.28 × 10−33 | 3.91 × 10−31 | nanos homolog 3 | nano3 |
unigene027321 | −2.135 | 1.08 × 10−02 | 1.88 × 10−02 | steroidogenic factor 1 | nr5a1 |
unigene042213 | −3.339 | 6.49 × 10−13 | 6.85 × 10−12 | mothers against decapentaplegic homolog 7 | smad7 |
unigene032006 | −3.884 | 4.82 × 10−02 | 7.17 × 10−02 | Transcription factor sox11 | sox11 |
unigene033133 | −2.935 | 1.03 × 10−11 | 8.94 × 10−11 | Transcription factor SOX-13 | sox13 |
unigene010073 | −2.919 | 2.73 × 10−05 | 7.92 × 10−05 | transcription factor SOX-17 | sox17 |
unigene031183 | −3.234 | 1.32 × 10−05 | 4.08 × 10−05 | Transcription factor Sox-2 | sox2 |
unigene046385 | −4.074 | 5.47 × 10−10 | 3.63 × 10−09 | transcription factor SOX-6 | sox6 |
unigene037102 | −3.319 | 6.68 × 10−20 | 1.65 × 10−18 | stAR-related lipid transfer protein 13 | star13 |
unigene010465 | −2.031 | 1.45 × 10−09 | 8.97 × 10−09 | transforming growth factor beta regulator 1 | tgfb1 |
unigene031121 | −4.284 | 1.50 × 10−20 | 3.93 × 10−19 | vascular endothelial growth factor D | vegfD |
unigene034851 | −5.654 | 9.65 × 10−15 | 1.33 × 10−13 | protein Wnt-16 | wnt16 |
unigene011231 | −2.496 | 5.62 × 10−06 | 1.85 × 10−05 | protein Wnt-2b | wnt2b |
unigene000882 | −2.937 | 4.66 × 10−06 | 1.56 × 10−05 | protein Wnt-9b | wnt9b |
unigene017893 | −3.974 | 1.59 × 10−28 | 7.75 × 10−27 | Wilms tumor protein 1 | WT1 |
unigene046736 | −9.090 | 2.65 × 10−78 | 3.73 × 10−75 | zona pellucida sperm-binding protein 3 | zp3 |
unigene014003 | −7.758 | 1.10 × 10−19 | 2.66 × 10−18 | zona pellucida sperm-binding protein 4 | zp4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, X.; Huang, Z.; Li, Q.; Li, W.; Han, C.; Yang, Y.; Lin, H.; Wu, Q.; Zhou, Y. De Novo Assembly, Characterization, and Comparative Transcriptome Analysis of Mature Male and Female Gonads of Rabbitfish (Siganus oramin) (Bloch & Schneider, 1801). Animals 2024, 14, 1346. https://doi.org/10.3390/ani14091346
Huang X, Huang Z, Li Q, Li W, Han C, Yang Y, Lin H, Wu Q, Zhou Y. De Novo Assembly, Characterization, and Comparative Transcriptome Analysis of Mature Male and Female Gonads of Rabbitfish (Siganus oramin) (Bloch & Schneider, 1801). Animals. 2024; 14(9):1346. https://doi.org/10.3390/ani14091346
Chicago/Turabian StyleHuang, Xiaolin, Zhong Huang, Qiang Li, Wenjun Li, Chong Han, Yukai Yang, Heizhao Lin, Qiaer Wu, and Yanbo Zhou. 2024. "De Novo Assembly, Characterization, and Comparative Transcriptome Analysis of Mature Male and Female Gonads of Rabbitfish (Siganus oramin) (Bloch & Schneider, 1801)" Animals 14, no. 9: 1346. https://doi.org/10.3390/ani14091346
APA StyleHuang, X., Huang, Z., Li, Q., Li, W., Han, C., Yang, Y., Lin, H., Wu, Q., & Zhou, Y. (2024). De Novo Assembly, Characterization, and Comparative Transcriptome Analysis of Mature Male and Female Gonads of Rabbitfish (Siganus oramin) (Bloch & Schneider, 1801). Animals, 14(9), 1346. https://doi.org/10.3390/ani14091346