Identification and Preliminary Analysis of Granulosa Cell Biomarkers to Predict Oocyte In Vitro Maturation Outcome in the Southern White Rhinoceros (Ceratotherium simum simum)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Management and Ovum Pickup (OPU)
2.2. Granulosa Cells Collection and RNA Isolation/Quantification
2.3. cDNA Synthesis and Quantitative Real Time Polymerase Chain Reaction (qPCR)
2.4. Statistical Analyses
3. Results
3.1. Granulosa Cell Biomarkers Linked to Follicle Development
3.2. Granulosa Cell Biomarkers That Lead to Meiotic Competence
3.3. Granulosa Cell Biomarkers Prophesying Cell Death and Atresia
3.4. Granulosa Cell Biomarkers Predicting Embryonic Genome Activation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sirait, B.; Wiweko, B.; Jusuf, A.A.; Iftitah, D.; Muharam, R. Oocyte Competence Biomarkers Associated with Oocyte Maturation: A Review. Front. Cell Dev. Biol. 2021, 9, 710292. [Google Scholar] [CrossRef] [PubMed]
- Khan, D.R.; Fournier, E.; Dufort, I.; Richard, F.J.; Singh, J.; Sirard, M.A. Meta-analysis of gene expression profiles in granulosa cells during folliculogenesis. Reproduction 2016, 151, R103–R110. [Google Scholar] [CrossRef]
- Cheng, J.; Huang, J.; Yuan, S.; Zhou, S.; Yan, W.; Shen, W.; Chen, Y.; Xia, X.; Luo, A.; Zhu, D.; et al. Circular RNA expression profiling of human granulosa cells during maternal aging reveals novel transcripts associated with assisted reproductive technology outcomes. PLoS ONE 2017, 12, e0177888. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Wang, J.; Zhao, Y.; Ma, D.; Zhao, M.; Li, N.; Men, Y.; Zhang, Y.; Chu, H.; Lei, C.; et al. scRNA-seq of ovarian follicle granulosa cells from different fertility goats reveals distinct expression patterns. Reprod. Domest. Anim. 2021, 56, 801–811. [Google Scholar] [CrossRef]
- Kordus, R.J.; LaVoie, H.A. Granulosa cell biomarkers to predict pregnancy in ART: Pieces to solve the puzzle. Reproduction 2017, 153, R69–R83. [Google Scholar] [CrossRef]
- McKenzie, L.J.; Pangas, S.A.; Carson, S.A.; Kovanci, E.; Cisneros, P.; Buster, J.E.; Amato, P.; Matzuk, M.M. Human cumulus granulosa cell gene expression: A predictor of fertilization and embryo selection in women undergoing IVF. Hum. Reprod. 2004, 19, 2869–2874. [Google Scholar] [CrossRef] [PubMed]
- Hunzicker-Dunn, M.; Mayo, K. Gonadotropin signaling in the ovary. Knobil Neill’s Physiol. Reprod. 2015, 1, 895–946. [Google Scholar]
- Hamel, M.; Dufort, I.; Robert, C.; Léveillé, M.-C.; Leader, A.; Sirard, M.-A. Identification of follicular marker genes as pregnancy predictors for human IVF: New evidence for the involvement of luteinization process. MHR Basic Sci. Reprod. Med. 2010, 16, 548–556. [Google Scholar] [CrossRef]
- Hamel, M.; Dufort, I.; Robert, C.; Léveillé, M.-C.; Leader, A.; Sirard, M.-A. Genomic assessment of follicular marker genes as pregnancy predictors for human IVF. MHR Basic Sci. Reprod. Med. 2009, 16, 87–96. [Google Scholar] [CrossRef]
- Hamel, M.; Dufort, I.; Robert, C.; Gravel, C.; Leveille, M.-C.; Leader, A.; Sirard, M.-A. Identification of differentially expressed markers in human follicular cells associated with competent oocytes. Hum. Reprod. 2008, 23, 1118–1127. [Google Scholar] [CrossRef]
- Sciorio, R.; Miranian, D.; Smith, G.D. Non-invasive oocyte quality assessment. Biol. Reprod. 2022, 106, 274–290. [Google Scholar] [CrossRef] [PubMed]
- Yu, E.J.; Choi, W.Y.; Park, M.S.; Eum, J.H.; Lee, D.R.; Lee, W.S.; Lyu, S.W.; Yoon, S.Y. RNA sequencing-based transcriptome analysis of granulosa cells from follicular fluid: Genes involved in embryo quality during in vitro fertilization and embryo transfer. PLoS ONE 2023, 18, e0280495. [Google Scholar] [CrossRef] [PubMed]
- Tunstall, T.; Kock, R.; Vahala, J.; Diekhans, M.; Fiddes, I.; Armstrong, J.; Paten, B.; Ryder, O.A.; Steiner, C.C. Evaluating recovery potential of the northern white rhinoceros from cryopreserved somatic cells. Genome Res. 2018, 28, 780–788. [Google Scholar] [CrossRef]
- Hildebrandt, T.B.; Holtze, S.; Colleoni, S.; Hermes, R.; Stejskal, J.; Lekolool, I.; Ndereeh, D.; Omondi, P.; Kariuki, L.; Mijele, D.; et al. In vitro fertilization (IVF) program in white rhinoceros. Reproduction 2023, 166, 383–399. [Google Scholar] [CrossRef] [PubMed]
- Hildebrandt, T.B.; Hermes, R.; Goeritz, F.; Appeltant, R.; Colleoni, S.; de Mori, B.; Diecke, S.; Drukker, M.; Galli, C.; Hayashi, K. The ART of bringing extinction to a freeze–History and future of species conservation, exemplified by rhinos. Theriogenology 2021, 169, 76–88. [Google Scholar] [CrossRef]
- Klohonatz, K.; Durrant, B.; Sirard, M.A.; Ruggeri, E. Granulosa cells provide transcriptomic information on ovarian follicle dynamics in southern white rhinoceros. Sci. Rep. 2024, 14, 19321. [Google Scholar] [CrossRef]
- Ruggeri, E.; Klohonatz, K.; Sirard, M.-A.; Durrant, B.; Coleman, S. Genomic insights into southern white rhinoceros (Ceratotherium simum simum) reproduction: Revealing granulosa cell gene expression. Theriogenology Wild 2023, 3, 100055. [Google Scholar] [CrossRef]
- Ruggeri, E.; Young, C.; Ravida, N.; Sirard, M.A.; Krisher, R.; de la Rey, M.; Herbst, C.; Durrant, B. Glucose consumption and gene expression in granulosa cells collected before and after in vitro oocyte maturation in the southern white rhinoceros (Ceratotherium simum simum). Reprod. Fertil. Dev. 2022, 34, 875–888. [Google Scholar] [CrossRef]
- Li, H.; Chang, H.M.; Shi, Z.; Leung, P.C.K. The p38 signaling pathway mediates the TGF-beta1-induced increase in type I collagen deposition in human granulosa cells. FASEB J. 2020, 34, 15591–15604. [Google Scholar] [CrossRef]
- Li, Y.; Li, R.Q.; Ou, S.B.; Zhang, N.F.; Ren, L.; Wei, L.N.; Zhang, Q.X.; Yang, D.Z. Increased GDF9 and BMP15 mRNA levels in cumulus granulosa cells correlate with oocyte maturation, fertilization, and embryo quality in humans. Reprod. Biol. Endocrinol. 2014, 12, 81. [Google Scholar] [CrossRef]
- Wei, S.; Gong, Z.; Sheng, L.; Liang, H.; Lai, L.; Deng, Y. Maturation rates of oocytes and levels of FSHR, LHR and GnRHR of COCs response to FSH concentrations in IVM media for sheep. J. Appl. Biomed. 2017, 15, 180–186. [Google Scholar]
- Guo, J.; Zhang, T.; Guo, Y.; Sun, T.; Li, H.; Zhang, X.; Yin, H.; Cao, G.; Yin, Y.; Wang, H.; et al. Oocyte stage-specific effects of MTOR determine granulosa cell fate and oocyte quality in mice. Proc. Natl. Acad. Sci. USA 2018, 115, E5326–E5333. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Wei, X.; Wu, B.; Yuan, C.; Li, C.; Dai, Y.; Chen, J.; Zhou, F.; Lin, X.; Zhang, S. Molecular Signatures Correlated with Poor IVF Outcomes: Insights from the mRNA and lncRNA Expression of Endometriotic Granulosa Cells. Front. Endocrinol. 2022, 13, 825934. [Google Scholar] [CrossRef]
- Douville, G.; Sirard, M.A. Changes in granulosa cells gene expression associated with growth, plateau and atretic phases in medium bovine follicles. J. Ovarian Res. 2014, 7, 50. [Google Scholar] [CrossRef]
- Hatzirodos, N.; Hummitzsch, K.; Irving-Rodgers, H.F.; Harland, M.L.; Morris, S.E.; Rodgers, R.J. Transcriptome profiling of granulosa cells from bovine ovarian follicles during atresia. BMC Genom. 2014, 15, 40. [Google Scholar] [CrossRef] [PubMed]
- Sang, Y.; Yang, Q.; Guo, Y.; Liu, X.; Shen, D.; Jiang, C.; Wang, X.; Li, K.; Wang, H.; Yang, C.; et al. Oocytes orchestrate protein prenylation for mitochondrial function through selective inactivation of cholesterol biosynthesis in murine species. J. Biol. Chem. 2023, 299, 105183. [Google Scholar] [CrossRef] [PubMed]
- Bao, B.; Calder, M.D.; Xie, S.; Smith, M.F.; Salfen, B.E.; Youngquist, R.S.; Garverick, H.A. Expression of steroidogenic acute regulatory protein messenger ribonucleic acid is limited to theca of healthy bovine follicles collected during recruitment, selection, and dominance of follicles of the first follicular wave. Biol. Reprod. 1998, 59, 953–959. [Google Scholar] [CrossRef]
- Taylor, J.M.; Borthwick, F.; Bartholomew, C.; Graham, A. Overexpression of steroidogenic acute regulatory protein increases macrophage cholesterol efflux to apolipoprotein AI. Cardiovasc. Res. 2010, 86, 526–534. [Google Scholar] [CrossRef] [PubMed]
- Dellaqua, T.T.; Vigaro, R.A.; Janini, L.C.Z.; Dal Canto, M.; Renzini, M.M.; Lodde, V.; Luciano, A.M.; Buratini, J. Neuregulin 1 (NRG1) modulates oocyte nuclear maturation during IVM and improves post-IVF embryo development. Theriogenology 2023, 195, 209–216. [Google Scholar] [CrossRef]
- Du, H.; Guo, Y.; Wu, X.; Gong, Y. FOXL2 regulates the expression of the Col4a1 collagen gene in chicken granulosa cells. Mol. Reprod. Dev. 2022, 89, 95–103. [Google Scholar] [CrossRef]
- Kulus, J.; Kulus, M.; Kranc, W.; Jopek, K.; Zdun, M.; Jozkowiak, M.; Jaskowski, J.M.; Piotrowska-Kempisty, H.; Bukowska, D.; Antosik, P.; et al. Transcriptomic Profile of New Gene Markers Encoding Proteins Responsible for Structure of Porcine Ovarian Granulosa Cells. Biology 2021, 10, 1214. [Google Scholar] [CrossRef] [PubMed]
- Boumela, I.; Assou, S.; Aouacheria, A.; Haouzi, D.; Dechaud, H.; De Vos, J.; Handyside, A.; Hamamah, S. Involvement of BCL2 family members in the regulation of human oocyte and early embryo survival and death: Gene expression and beyond. Reproduction 2011, 141, 549–561. [Google Scholar] [CrossRef]
- Galán, A.; Montaner, D.; Póo, M.E.; Ruiz, V.; Valbuena, D.; Simón, C. Defining cell fate and embryonic genome activation by global single-cell cDNA analysis of blastomeres from 5 to 8-cell human embryos. Fertil. Steril. 2010, 94, S22–S23. [Google Scholar] [CrossRef]
- Cai, J.; Ash, D.; Kotch, L.E.; Jabs, E.W.; Attie-Bitach, T.; Auge, J.; Mattei, G.; Etchevers, H.; Vekemans, M.; Korshunova, Y.; et al. Gene expression in pharyngeal arch 1 during human embryonic development. Hum. Mol. Genet. 2005, 14, 903–912. [Google Scholar] [CrossRef] [PubMed]
- Kwon, J.; Jo, Y.-J.; Namgoong, S.; Kim, N.-H. Functional roles of hnRNPA2/B1 regulated by METTL3 in mammalian embryonic development. Sci. Rep. 2019, 9, 8640. [Google Scholar] [CrossRef]
- Bogliotti, Y.; Ross, P. Molecular mechanisms of transcriptional and chromatin remodeling around embryonic genome activation. Anim. Reprod. (AR) 2018, 12, 52–61. [Google Scholar]
- Gambini, A.; Stein, P.; Savy, V.; Grow, E.J.; Papas, B.N.; Zhang, Y.; Kenan, A.C.; Padilla-Banks, E.; Cairns, B.R.; Williams, C.J. Developmentally Programmed Tankyrase Activity Upregulates β-Catenin and Licenses Progression of Embryonic Genome Activation. Dev. Cell 2020, 53, 545–560.e7. [Google Scholar] [CrossRef] [PubMed]
- Asami, M.; Lam, B.Y.H.; Hoffmann, M.; Suzuki, T.; Lu, X.; Yoshida, N.; Ma, M.K.; Rainbow, K.; Guzvic, M.; VerMilyea, M.D.; et al. A program of successive gene expression in mouse one-cell embryos. Cell Rep. 2023, 42, 112023. [Google Scholar] [CrossRef]
- Asami, M.; Lam, B.Y.H.; Ma, M.K.; Rainbow, K.; Braun, S.; VerMilyea, M.D.; Yeo, G.S.H.; Perry, A.C.F. Human embryonic genome activation initiates at the one-cell stage. Cell Stem Cell 2022, 29, 209–216.e4. [Google Scholar] [CrossRef]
- Cai, J.; Chen, H.; Xie, S.; Hu, Z.; Bai, Y. Research Progress of Totipotent Stem Cells. Stem Cells Dev. 2022, 31, 335–345. [Google Scholar] [CrossRef]
- Perera, C.D.; Idrees, M.; Khan, A.M.; Haider, Z.; Ullah, S.; Kang, J.S.; Lee, S.H.; Kang, S.M.; Kong, I.K. PDGFRβ Activation Induced the Bovine Embryonic Genome Activation via Enhanced NFYA Nuclear Localization. Int. J. Mol. Sci. 2023, 24, 17047. [Google Scholar] [CrossRef] [PubMed]
- Lu, F.; Liu, Y.; Inoue, A.; Suzuki, T.; Zhao, K.; Zhang, Y. Establishing Chromatin Regulatory Landscape during Mouse Preimplantation Development. Cell 2016, 165, 1375–1388. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Brändl, B.; Rohrandt, C.; Hong, K.; Pang, A.; Lee, J.; Lewin, H.A.; Migliorelli, G.; Stanke, M.; Schwab, R.; et al. Chromosome-level genome assembly of the functionally extinct northern white rhinoceros (Ceratotherium simum cottoni). bioRxiv 2021. [Google Scholar] [CrossRef]
- Herta, A.C.; Lolicato, F.; Smitz, J.E.J. In vitro follicle culture in the context of IVF. Reproduction 2018, 156, F59–F73. [Google Scholar] [CrossRef]
- Guo, Z.; Yu, Q. Role of mTOR Signaling in Female Reproduction. Front. Endocrinol. 2019, 10, 692. [Google Scholar] [CrossRef] [PubMed]
- Schmelzle, T.; Hall, M.N. TOR, a central controller of cell growth. Cell 2000, 103, 253–262. [Google Scholar] [CrossRef]
- Likszo, P.; Skarzynski, D.J.; Moza Jalali, B. Proteomic Analysis of Porcine Pre-ovulatory Follicle Differentiation into Corpus Luteum. Front. Endocrinol. 2019, 10, 774. [Google Scholar] [CrossRef]
- Menon, K.M.; Nair, A.K.; Wang, L.; Peegel, H. Regulation of luteinizing hormone receptor mRNA expression by a specific RNA binding protein in the ovary. Mol. Cell. Endocrinol. 2007, 260–262, 109–116. [Google Scholar] [CrossRef]
- Zuchero, J.B.; Coutts, A.S.; Quinlan, M.E.; Thangue, N.B.L.; Mullins, R.D. p53-cofactor JMY is a multifunctional actin nucleation factor. Nat. Cell Biol. 2009, 11, 451–459. [Google Scholar] [CrossRef]
- Brunet, S.; Verlhac, M.H. Positioning to get out of meiosis: The asymmetry of division. Hum. Reprod. Update 2011, 17, 68–75. [Google Scholar] [CrossRef]
- Namgoong, S.; Kim, N.H. Roles of actin binding proteins in mammalian oocyte maturation and beyond. Cell Cycle 2016, 15, 1830–1843. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.-C.; Sun, Q.-Y.; Kim, N.-H. JMY is required for asymmetric division and cytokinesis in mouse oocytes. MHR Basic Sci. Reprod. Med. 2011, 17, 296–304. [Google Scholar] [CrossRef]
- Celik, O.; Celik, N.; Ugur, K.; Hatirnaz, S.; Celik, S.; Muderris, I.I.; Yavuzkir, S.; Sahin, I.; Yardim, M.; Aydin, S. Nppc/Npr2/cGMP signaling cascade maintains oocyte developmental capacity. Cell. Mol. Biol. 2019, 65, 83–89. [Google Scholar] [CrossRef]
- Yang, L.; Wei, Q.; Li, W.; Xi, Q.; Zhao, X.; Ma, B. NPR2 is involved in FSH-mediated mouse oocyte meiotic resumption. J. Ovarian Res. 2016, 9, 6. [Google Scholar] [CrossRef] [PubMed]
- Casalechi, M.; Dias, J.A.; Pinto, L.V.; Lobach, V.N.; Pereira, M.T.; Cavallo, I.K.; Reis, A.M.; Dela Cruz, C.; Reis, F.M. C-type natriuretic peptide signaling in human follicular environment and its relation with oocyte maturation. Mol. Cell. Endocrinol. 2019, 492, 110444. [Google Scholar] [CrossRef]
- Tsuji, T.; Kiyosu, C.; Akiyama, K.; Kunieda, T. CNP/NPR2 signaling maintains oocyte meiotic arrest in early antral follicles and is suppressed by EGFR-mediated signaling in preovulatory follicles. Mol. Reprod. Dev. 2012, 79, 795–802. [Google Scholar] [CrossRef]
- Adriaenssens, T.; Mazoyer, C.; Segers, I.; Wathlet, S.; Smitz, J. Differences in collagen expression in cumulus cells after exposure to highly purified menotropin or recombinant follicle-stimulating hormone in a mouse follicle culture model. Biol. Reprod. 2009, 80, 1015–1025. [Google Scholar] [CrossRef] [PubMed]
- Marongiu, M.; Deiana, M.; Marcia, L.; Sbardellati, A.; Asunis, I.; Meloni, A.; Angius, A.; Cusano, R.; Loi, A.; Crobu, F. Novel action of FOXL2 as mediator of Col1a2 gene autoregulation. Dev. Biol. 2016, 416, 200–211. [Google Scholar] [CrossRef] [PubMed]
- Segars, J.H.; Diab, M. Genes involved in recurrent oocyte maturation arrest: What do we know? Fertil. Steril. 2021, 115, 1183–1184. [Google Scholar] [CrossRef]
- Huang, Y.; Bai, J.Y.; Ren, H.T. piRNA biogenesis and its functions. Russ. J. Bioorganic Chem. 2014, 40, 293–299. [Google Scholar] [CrossRef]
- Dorris, E.R.; Tazzyman, S.J.; Moylett, J.; Ramamoorthi, N.; Hackney, J.; Townsend, M.; Muthana, M.; Lewis, M.J.; Pitzalis, C.; Wilson, A.G. The Autoimmune Susceptibility Gene C5orf30 Regulates Macrophage-Mediated Resolution of Inflammation. J. Immunol. 2019, 202, 1069–1078. [Google Scholar] [CrossRef] [PubMed]
- Muthana, M.; Hawtree, S.; Wilshaw, A.; Linehan, E.; Roberts, H.; Khetan, S.; Adeleke, G.; Wright, F.; Akil, M.; Fearon, U. C5orf30 is a negative regulator of tissue damage in rheumatoid arthritis. Proc. Natl. Acad. Sci. USA 2015, 112, 11618–11623. [Google Scholar] [CrossRef] [PubMed]
- McGauran, G.; Dorris, E.; Borza, R.; Morgan, N.; Shields, D.C.; Matallanas, D.; Wilson, A.G.; O’Connell, D.J. Resolving the Interactome of the Human Macrophage Immunometabolism Regulator (MACIR) with Enhanced Membrane Protein Preparation and Affinity Proteomics. Proteomics 2020, 20, e2000062. [Google Scholar] [CrossRef]
- Miao, X.; Guo, R.; Williams, A.; Lee, C.; Ma, J.; Wang, P.J.; Cui, W. Replication Protein A1 is essential for DNA damage repair during mammalian oogenesis. bioRxiv 2023. [Google Scholar] [CrossRef]
- Vogt, E.J.; Meglicki, M.; Hartung, K.I.; Borsuk, E.; Behr, R. Importance of the pluripotency factor LIN28 in the mammalian nucleolus during early embryonic development. Development 2012, 139, 4514–4523. [Google Scholar] [CrossRef]
- Liu, T.; Jing, F.; Huang, P.; Geng, Z.; Xu, J.; Li, J.; Chen, D.; Zhu, Y.; Wang, Z.; Huang, W.; et al. Thymopentin alleviates premature ovarian failure in mice by activating YY2/Lin28A and inhibiting the expression of let-7 family microRNAs. Cell Prolif. 2021, 54, e13089. [Google Scholar] [CrossRef]
- Flemr, M.; Moravec, M.; Libova, V.; Sedlacek, R.; Svoboda, P. Lin28a is dormant, functional, and dispensable during mouse oocyte-to-embryo transition. Biol. Reprod. 2014, 90, 131. [Google Scholar] [CrossRef]
- Meuffels-Barkas, J.; Wilsher, S.; Allen, W.R.T.; Ververs, C.; Lueders, I. Comparative reproduction of the female horse, elephant and rhinoceros: Implications for advancing Assisted Reproductive Technologies (ART). Reprod. Fertil. 2023, 4, e230020. [Google Scholar] [CrossRef]
- Girard, A.; Dufort, I.; Douville, G.; Sirard, M.A. Global gene expression in granulosa cells of growing, plateau and atretic dominant follicles in cattle. Reprod. Biol. Endocrinol. 2015, 13, 17. [Google Scholar] [CrossRef]
- Ginther, O.; Gastal, E.; Gastal, M.; Bergfelt, D.; Baerwald, A.; Pierson, R. Comparative study of the dynamics of follicular waves in mares and women. Biol. Reprod. 2004, 71, 1195–1201. [Google Scholar] [CrossRef]
- Lopez-Gatius, F.; Llobera-Balcells, M.; Palacin-Chauri, R.J.; Garcia-Ispierto, I.; Hunter, R.H.F. Follicular Size Threshold for Ovulation Reassessed. Insights from Multiple Ovulating Dairy Cows. Animals 2022, 12, 1140. [Google Scholar] [CrossRef] [PubMed]
- Hildebrandt, T.B.; Hermes, R.; Colleoni, S.; Diecke, S.; Holtze, S.; Renfree, M.B.; Stejskal, J.; Hayashi, K.; Drukker, M.; Loi, P.; et al. Embryos and embryonic stem cells from the white rhinoceros. Nat. Commun. 2018, 9, 2589. [Google Scholar] [CrossRef]
- Lee, M.T.; Bonneau, A.R.; Giraldez, A.J. Zygotic genome activation during the maternal-to-zygotic transition. Annu. Rev. Cell Dev. Biol. 2014, 30, 581–613. [Google Scholar] [CrossRef]
- Goszczynski, D.; Tinetti, P.; Choi, Y.; Hinrichs, K.; Ross, P. Genome activation in equine in vitro–produced embryos. Biol. Reprod. 2022, 106, 66–82. [Google Scholar] [CrossRef] [PubMed]
- Paris, D.B.; Stout, T.A. Equine embryos and embryonic stem cells: Defining reliable markers of pluripotency. Theriogenology 2010, 74, 516–524. [Google Scholar] [CrossRef] [PubMed]
- Xue, Z.; Huang, K.; Cai, C.; Cai, L.; Jiang, C.Y.; Feng, Y.; Liu, Z.; Zeng, Q.; Cheng, L.; Sun, Y.E.; et al. Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. Nature 2013, 500, 593–597. [Google Scholar] [CrossRef]
- Graf, A.; Krebs, S.; Zakhartchenko, V.; Schwalb, B.; Blum, H.; Wolf, E. Fine mapping of genome activation in bovine embryos by RNA sequencing. Proc. Natl. Acad. Sci. USA 2014, 111, 4139–4144. [Google Scholar] [CrossRef]
- Uyar, A.; Torrealday, S.; Seli, E. Cumulus and granulosa cell markers of oocyte and embryo quality. Fertil. Steril. 2013, 99, 979–997. [Google Scholar] [CrossRef]
- Desquiret-Dumas, V.; Clément, A.; Seegers, V.; Boucret, L.; Ferré-L’Hotellier, V.; Bouet, P.E.; Descamps, P.; Procaccio, V.; Reynier, P.; May-Panloup, P. The mitochondrial DNA content of cumulus granulosa cells is linked to embryo quality. Hum. Reprod. 2017, 32, 607–614. [Google Scholar] [CrossRef]
- Boumela, I.; Assou, S.; Haouzi, D.; Dechaud, H.; Ait-Ahmed, O.; Hamamah, S. Developmental regulated expression of anti- and pro-apoptotic BCL-2 family genes during human early embryonic development. Curr. Med. Chem. 2014, 21, 1361–1369. [Google Scholar] [CrossRef]
Gene | Category | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
COL1A1 | Follicle development | GCATGGCCTGATTAGCAGTG | GCAGTTAGGTTCGCGTGTTC |
GDF9 | Follicle development | ACCAGGTGACAGGAACCGT | CAGCTCTAGGGAGAGTCTTGC |
KAT8 | Follicle development | CCTCCTGACACGTCACAGAC | ATCGCTGTGGTGGAAGTGAC |
LHR | Follicle development | TGGAAGTGATAGAGGCGAACG | GTTCTGGAAGGCATCAGGGT |
mTOR | Follicle development | GGCAGCATTAGAGACAGTGGA | AATCGGGTGAATGATCCGGG |
PGR | Follicle development | TCCCACGAACGTAGAGAGGC | TGAACAGTCCCCAATGTGGC |
TNF | Follicle development | GCCCATGTTGTAGCAAACCCT | AGGAGCACATGGGTGGAAGA |
TP53 | Follicle development | AGGTACGTGTTTGTGCCTGT | TCACGCCCACGAATCTGAAG |
FBXW11 | Meiotic competence | GCACACAGAGACCTGGCATC | GGTACGTTTCCACGTTGCCT |
GGPS1 | Meiotic competence | ATACCGCTTGTCAGGCCATC | ATCCATGCCAATCCCCCTCT |
JMY | Meiotic competence | GAACTTGCCATGCTACGACG | CTTTGGGGAGAAAGGAGCAGA |
MVK | Meiotic competence | TATACCCCGAGTTCCTGGCA | CTTGGCTGCTCAGTCCGTTA |
NPR2 | Meiotic competence | GGCACCCTGAGAAAGCATCC | GGGTGGTTGATAGGTTAGGGC |
NRG1 | Meiotic competence | TTACTTCGTGGAACCCGTGG | GAGGGGCCTTTCAGATGACC |
COL4A1 | Cell death and atresia | TCCGTTTGCTTGCTTTGCTC | TCAGGGTTTGAAGCTCCGTC |
MACIR | Cell death and atresia | AAATCACAGGTACTCGGGGG | GTCAGCAACAACCAAGCAGA |
TMPO | Cell death and atresia | TCGCCCTAAGCCTAACATCTG | GTGGCAGTGGCTCACATAGA |
BCL2A1 | Embryonic genome activation | CCAAATCTGGCTGGCTGACT | GGCAGTTTTCCCAAGATGGA |
CCT3 | Embryonic genome activation | TCTTTGCTGGACCCCTGAAG | AGGAGCAAGCCTGTTGGAAA |
HNRNPA2B1 | Embryonic genome activation | GGCTAAGGAAAAGGTAGGGGC | ATGGTAGGGGATTGGGGAAGA |
MYC | Embryonic genome activation | TCCTCTTCTTATTGGCGGCT | TCTAAGGGGAAGGGATGGGA |
NFYA | Embryonic genome activation | ATACCTGCATGAGTCTCGGC | GGTACAAGTCTTCTCACCTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ruggeri, E.; Klohonatz, K.; Durrant, B.; Sirard, M.-A. Identification and Preliminary Analysis of Granulosa Cell Biomarkers to Predict Oocyte In Vitro Maturation Outcome in the Southern White Rhinoceros (Ceratotherium simum simum). Animals 2024, 14, 3538. https://doi.org/10.3390/ani14233538
Ruggeri E, Klohonatz K, Durrant B, Sirard M-A. Identification and Preliminary Analysis of Granulosa Cell Biomarkers to Predict Oocyte In Vitro Maturation Outcome in the Southern White Rhinoceros (Ceratotherium simum simum). Animals. 2024; 14(23):3538. https://doi.org/10.3390/ani14233538
Chicago/Turabian StyleRuggeri, Elena, Kristin Klohonatz, Barbara Durrant, and Marc-André Sirard. 2024. "Identification and Preliminary Analysis of Granulosa Cell Biomarkers to Predict Oocyte In Vitro Maturation Outcome in the Southern White Rhinoceros (Ceratotherium simum simum)" Animals 14, no. 23: 3538. https://doi.org/10.3390/ani14233538
APA StyleRuggeri, E., Klohonatz, K., Durrant, B., & Sirard, M.-A. (2024). Identification and Preliminary Analysis of Granulosa Cell Biomarkers to Predict Oocyte In Vitro Maturation Outcome in the Southern White Rhinoceros (Ceratotherium simum simum). Animals, 14(23), 3538. https://doi.org/10.3390/ani14233538