Effects of Prolactin Inhibition on Lipid Metabolism in Goats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Management
2.2. Experimental Design and Sample Collection
2.3. Serum Biochemical Index Analyses
2.4. Tissue Hematoxylin–Eosin Staining and Histology
2.5. Quantitative Real-Time PCR
2.6. Statistical Analyses
3. Results
3.1. Effects of PRL Inhibition on Body Weight and Feed Intake of Cashmere Goats
3.2. Effects of PRL Inhibition on Serum Lipid Metabolism-Related Indexes
3.3. Effects of PRL Inhibition on the Histology of Liver, Subcutaneous Adipose, and Perirenal Adipose Tissues
3.4. Effects of PRL Inhibition on Lipid Metabolism-Related Genes in Liver, Subcutaneous Adipose, and Perirenal Adipose Tissues
3.5. Changes in the Expression of PRL, LPRLR, SPRLR, and Lipid Metabolism-Related Genes in Liver, Subcutaneous Adipose, and Perirenal Adipose Tissues
4. Discussion
4.1. Effects of PRL on Serum Lipid Metabolism Indexes
4.2. Effects of PRL on the Histology of the Liver, Subcutaneous Adipose, and Perirenal Adipose Tissues
4.3. Effects of PRL on the Expression of Genes Related to Lipid Metabolism
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Freeman, M.E.; Kanyicska, B.; Lerant, A.; Nagy, G. Prolactin: Structure, function, and regulation of secretion. Physiol. Rev. 2000, 80, 1523–1631. [Google Scholar] [CrossRef] [PubMed]
- Bernard, V.; Young, J.; Binart, N. Prolactin—A pleiotropic factor in health and disease. Nat. Rev. Endocrinol. 2019, 15, 356–365. [Google Scholar] [CrossRef] [PubMed]
- Auriemma, R.S.; De Alcubierre, D.; Pirchio, R.; Pivonello, R.; Colao, A. The effects of hyperprolactinemia and its control on metabolic diseases. Expert Rev. Endocrinol. Metab. 2018, 13, 99–106. [Google Scholar] [CrossRef] [PubMed]
- Ben-Jonathan, N.; Hugo, E.R.; Brandebourg, T.D.; LaPensee, C.R. Focus on prolactin as a metabolic hormone. Trends Endocrin Met. 2006, 17, 110–116. [Google Scholar] [CrossRef] [PubMed]
- Mastnak, L.; Herman, R.; Ferjan, S.; Janez, A.; Jensterle, M. Prolactin in Polycystic Ovary Syndrome: Metabolic Effects and Therapeutic Prospects. Life 2023, 13, 2124. [Google Scholar] [CrossRef] [PubMed]
- Brandebourg, T.; Hugo, E.; Ben-Jonathan, N. Adipocyte prolactin: Regulation of release and putative functions. Diabetes Obes. Metab. 2007, 9, 464–476. [Google Scholar] [CrossRef]
- Strader, A.D.; Buntin, J.D. Changes in agouti-related peptide during the ring dove breeding cycle in relation to prolactin and parental hyperphagia. J. Neuroendocrinol. 2003, 15, 1046–1053. [Google Scholar] [CrossRef]
- Atmaca, A.; Bilgici, B.; Ecemis, G.C.; Tuncel, O.K. Evaluation of body weight, insulin resistance, leptin and adiponectin levels in premenopausal women with hyperprolactinemia. Endocrine 2013, 44, 756–761. [Google Scholar] [CrossRef]
- Bina, K.G.; Cincotta, A.H. Dopaminergic agonists normalize elevated hypothalamic neuropeptide Y and corticotropin-releasing hormone, body weight gain, and hyperglycemia in ob/ob mice. Neuroendocrinology 2000, 71, 68–78. [Google Scholar] [CrossRef]
- Brelje, T.C.; Stout, L.E.; Bhagroo, N.V.; Sorenson, R.L. Distinctive roles for prolactin and, growth hormone in the activation of signal transducer and activator of transcription 5 in pancreatic islets of Langerhans. Endocrinology 2004, 145, 4162–4175. [Google Scholar] [CrossRef]
- Landgraf, R.; Landraf-Leurs, M.M.; Weissmann, A.; Horl, R.; von Werder, K.; Scriba, P.C. Prolactin: A diabetogenic hormone. Diabetologia 1977, 13, 99–104. [Google Scholar] [CrossRef] [PubMed]
- Macotela, Y.; Triebel, J.; Clapp, C. Time for a New Perspective on Prolactin in Metabolism. Trends Endocrin. Met. 2020, 31, 276–286. [Google Scholar] [CrossRef] [PubMed]
- Corona, G.; Wu, F.C.; Rastrelli, G.; Lee, D.M.; Forti, G.; O'Connor, D.B.; O'Neill, T.W.; Pendleton, N.; Bartfai, G.; Boonen, S.; et al. Low Prolactin Is Associated with Sexual Dysfunction and Psychological or Metabolic Disturbances in Middle-Aged and Elderly Men: The European Male Aging Study (EMAS). J. Sex. Med. 2014, 11, 240–253. [Google Scholar] [CrossRef] [PubMed]
- Ben-Jonathan, N.; Hnasko, R. Dopamine as a prolactin (PRL) inhibitor. Endocr. Rev. 2001, 22, 724–763. [Google Scholar] [CrossRef] [PubMed]
- Picazo, R.A.; Ruiz, J.; Moreno, J.S.; de Bulnes, A.G.; Munoz, J.; Silvan, G.; Lorenzo, P.L.; Illera, J.C. Cellular localization and changes in expression of prolactin receptor isoforms in sheep ovary throughout the estrous cycle. Reproduction 2004, 128, 545–553. [Google Scholar] [CrossRef][Green Version]
- Brym, P.; Kaminski, S.; Wojcik, E. Nucleotide sequence polymorphism within exon 4 of the bovine prolactin gene and its associations with milk performance traits. J. Appl. Genet. 2005, 46, 179–185. [Google Scholar]
- Nixon, A.J.; Ford, C.A.; Wildermoth, J.E.; Craven, A.J.; Ashby, M.G.; Pearson, A.J. Regulation of prolactin receptor expression in ovine skin in relation to circulating prolactin and wool follicle growth status. J. Endocrinol. 2002, 172, 605–614. [Google Scholar] [CrossRef]
- Albu, A.; Florea, S.; Fica, S. Is prolactin the missing link in adipose tissue dysfunction of polycystic ovary syndrome patients? Endocrine 2016, 51, 163–173. [Google Scholar] [CrossRef]
- Shi, H.; Zhang, T.; Yi, Y.; Wang, H.; Luo, J. Long form PRLR (lPRLR) regulates genes involved in the triacylglycerol synthesis in goat mammary gland epithelial cells. Small Rumin. Res. 2016, 139, 7–14. [Google Scholar] [CrossRef]
- Ben-Jonathan, N.; Hugo, E. Prolactin (PRL) in Adipose Tissue: Regulation and Functions. In Recent Advances in Prolactin Research; Springer: Cham, Switzerland, 2015; Volume 846, pp. 1–35. [Google Scholar] [CrossRef]
- Feng, S.; Sun, Z.; Jia, X.; Li, L.; Wu, Y.; Wu, C.; Lin, L.; Liu, J.; Zeng, B. Lipophagy: Molecular Mechanisms and Implications in Hepatic Lipid Metabolism. Front. Biosci. 2023, 28, 6. [Google Scholar] [CrossRef]
- Harvey, S.; Aramburo, C.; Sanders, E.J. Extrapituitary production of anterior pituitary hormones: An overview. Endocrine 2012, 41, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Harvey, S.; Martinez-Moreno, C.G.; Luna, M.; Aramburo, C. Autocrine/paracrine roles of extrapituitary growth hormone and prolactin in health and disease: An overview. Gen. Comp. Endocr. 2015, 220, 103–111. [Google Scholar] [CrossRef] [PubMed]
- BenJonathan, N.; Mershon, J.L.; Allen, D.L.; Steinmetz, R.W. Extrapituitary prolactin: Distribution, regulation, functions, and clinical aspects. Endocr. Rev. 1996, 17, 639–669. [Google Scholar] [CrossRef] [PubMed]
- Zinger, M.; McFarland, M.; Ben-Jonathan, N. Prolactin expression and secretion by human breast glandular and adipose tissue explants. J. Clin. Endocr. Metab. 2003, 88, 689–696. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ben-Jonathan, N.; LaPensee, C.R.; LaPensee, E.W. What can we learn from rodents about prolactin in humans? Endocr. Rev. 2008, 29, 1–41. [Google Scholar] [CrossRef]
- Brandebourg, T.D.; Bown, J.L.; Ben-Jonathan, N. Prolactin upregulates its receptors and inhibits lipolysis and leptin release in male rat adipose tissue. Biochem. Biophys. Res. Commun. 2007, 357, 408–413. [Google Scholar] [CrossRef][Green Version]
- McFarland-Mancini, M.; Hugo, E.; Loftus, J.; Ben-Jonathan, N. Induction of prolactin expression and release in human preadipocytes by cAMP activating ligands. Biochem. Biophys. Res. Commun. 2006, 344, 9–16. [Google Scholar] [CrossRef]
- Flint, D.J.; Binart, N.; Boumard, S.; Kopchick, J.J.; Kelly, P. Developmental aspects of adipose tissue in CH receptor and prolactin receptor gene disrupted mice: Site-specific effects upon proliferation, differentiation and hormone sensitivity. J. Endocrinol. 2006, 191, 101–111. [Google Scholar] [CrossRef]
- Carre, N.; Solomon, G.; Gertler, A.; Binart, N. Effects of High Affinity Leptin Antagonist on Prolactin Receptor Deficient Male Mouse. PLoS ONE 2014, 9, e91422. [Google Scholar] [CrossRef]
- Doknic, M.; Pekic, S.; Zarkovic, M.; Medic-Stojanoska, M.; Dieguez, C.; Casanueva, F.; Popovic, V. Dopaminergic tone and obesity: An insight from prolactinomas treated with bromocriptine. Eur. J. Endocrinol. 2002, 147, 77–84. [Google Scholar] [CrossRef]
- Kok, P.; Roelfsema, F.; Frolich, M.; Meinders, A.E.; Pijl, H. Prolactin release is enhanced in proportion to excess visceral fat in obese women. J. Clin. Endocr. Metab. 2004, 89, 4445–4449. [Google Scholar] [CrossRef] [PubMed]
- Hogan, J.C.; Stephens, J.M. The regulation of fatty acid synthase by STAT5A. Diabetes 2005, 54, 1968–1975. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Ge, Z.; Wang, H.; Feng, W.; Sun, X.; Chu, X.; Jiang, C.; Wang, Y.; Zhu, D.; Bi, Y. Prolactin improves hepatic steatosis via CD36 pathway. J. Hepatol. 2018, 68, 1247–1255. [Google Scholar] [CrossRef] [PubMed]
- LaPensee, C.R.; Horseman, N.D.; Tso, P.; Brandebourg, T.D.; Hugo, E.R.; Ben-Jonathan, N. The prolactin-deficient mouse has an unaltered metabolic phenotype. Endocrinology 2006, 147, 4638–4645. [Google Scholar] [CrossRef]
- Wang, S.; Liu, J.; Zhao, W.; Wang, G.; Gao, S. Selection of candidate genes for differences in fat metabolism between cattle subcutaneous and perirenal adipose tissue based on RNA-seq. Anim. Biotechnol. 2021, 34, 633–644. [Google Scholar] [CrossRef]
- Rosas-Hernandez, H.; Ramirez, M.; Ramirez-Lee, M.A.; Ali, S.F.; Gonzalez, C. Inhibition of prolactin with bromocriptine for 28days increases blood-brain barrier permeability in the rat. Neuroscience 2015, 301, 61–70. [Google Scholar] [CrossRef]
- Zhang, L.; Duan, C.; Guo, Y.; Zhang, Y.; Liu, Y. Inhibition of prolactin promotes secondary skin follicle activation in cashmere goats. J. Anim. Sci. 2021, 99, skab079. [Google Scholar] [CrossRef]
- Hilfiker-Kleiner, D.; Struman, I.; Hoch, M.; Podewski, E.; Sliwa, K. 16-kDa prolactin and bromocriptine in postpartum cardiomyopathy. Curr. Heart Fail. Rep. 2012, 9, 174–182. [Google Scholar] [CrossRef]
- Naz, F.; Malik, A.; Riaz, M.; Mahmood, Q.; Mehmood, M.H.; Rasool, G.; Mahmood, Z.; Abbas, M. Bromocriptine therapy: Review of mechanism of action, safety and tolerability. Clin. Exp. Pharmacol. P. 2022, 49, 903–922. [Google Scholar] [CrossRef]
- Liu, X.; Duan, C.; Yin, X.; Zhang, L.; Chen, M.; Zhao, W.; Li, X.; Liu, Y.; Zhang, Y. Inhibition of Prolactin Affects Epididymal Morphology by Decreasing the Secretion of Estradiol in Cashmere Bucks. Animals 2024, 14, 1778. [Google Scholar] [CrossRef]
- Dicks, P.; Russel, A.J.; Lincoln, G.A. The role of prolactin in the reactivation of hair follicles in relation to moulting in cashmere goats. J. Endocrinol. 1994, 143, 441–448. [Google Scholar] [CrossRef] [PubMed]
- Honecker, J.; Weidlich, D.; Heisz, S.; Lindgren, C.M.; Karampinos, D.C.; Claussnitzer, M.; Hauner, H. A distribution-centered approach for analyzing human adipocyte size estimates and their association with obesity-related traits and mitochondrial function. Int. J. Obes. 2021, 45, 2108–2117. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Vicchi, F.; De Winne, C.; Brie, B.; Sorianello, E.; Ladyman, S.R.; Becu-Villalobos, D. Metabolic functions of prolactin: Physiological and pathological aspects. J. Neuroendocrinol. 2020, 32, e12888. [Google Scholar] [CrossRef] [PubMed]
- Macotela, Y.; Ruiz-Herrera, X.; Vazquez-Carrillo, D.; Ramirez-Hernandez, G.; de la Escalera, G.M.; Clapp, C. The beneficial metabolic actions of prolactin. Front. Endocrinol. 2022, 13, 1001703. [Google Scholar] [CrossRef]
- Pirchio, R.; Graziadio, C.; Colao, A.; Pivonello, R.; Auriemma, R.S. Metabolic effects of prolactin. Front. Endocrinol. 2022, 13, 1015520. [Google Scholar] [CrossRef]
- Southern, L.L.; Cincotta, A.H.; Meier, A.H.; Bidner, T.D.; Watkins, K.L. Bromocriptine-induced reduction of body fat in pigs. J. Anim. Sci. 1990, 68, 931–936. [Google Scholar] [CrossRef]
- Carre, N.; Binart, N. Prolactin and adipose tissue. Biochimie 2014, 97, 16–21. [Google Scholar] [CrossRef]
- Althaher, A.R. An Overview of Hormone-Sensitive Lipase (HSL). Sci. World J. 2022, 2022, 1964684. [Google Scholar] [CrossRef]
- Bernard, V.; Young, J.; Chanson, P.; Binart, N. New insights in prolactin: Pathological implications. Nat. Rev. Endocrinol. 2015, 11, 265–275. [Google Scholar] [CrossRef]
- Shao, S.; Yao, Z.; Lu, J.; Song, Y.; He, Z.; Yu, C.; Zhou, X.; Zhao, L.; Zhao, J.; Gao, L. Ablation of prolactin receptor increases hepatic triglyceride accumulation. Biochem. Biophys. Res. Commun. 2018, 498, 693–699. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, M.M. Subcutaneous and visceral adipose tissue: Structural and functional differences. Obes. Rev. 2010, 11, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Hugo, E.R.; Borcherding, D.C.; Gersin, K.S.; Loftus, J.; Ben-Jonathan, N. Prolactin release by adipose explants, primary adipocytes, and LS14 adipocytes. J. Clin. Endocr. Metab. 2008, 93, 4006–4012. [Google Scholar] [CrossRef] [PubMed]
- Eisemann, J.H.; Bauman, D.E.; Hogue, D.E.; Travis, H.F. Evaluation of a role for prolactin in growth and the photoperiod-induced growth response in sheep. J. Anim. Sci. 1984, 59, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Eisemann, J.H.; Bauman, D.E.; Hogue, D.E.; Travis, H.F. Influence of photoperiod and prolactin on body composition and in vitro lipid metabolism in wether lambs. J. Anim. Sci. 1984, 59, 95–104. [Google Scholar] [CrossRef][Green Version]
- Barber, M.C.; Clegg, R.A.; Finley, E.; Vernon, R.G.; Flint, D.J. The role of growth hormone, prolactin and insulin-like growth factors in the regulation of rat mammary gland and adipose tissue metabolism during lactation. J. Endocrinol. 1992, 135, 195–202. [Google Scholar] [CrossRef]
- Dou, H.X.; Wang, T.; Su, H.X.; Gao, D.D.; Xu, Y.C.; Li, Y.X.; Wang, H.Y. Exogenous FABP4 interferes with differentiation, promotes lipolysis and inflammation in adipocytes. Endocrine 2020, 67, 587–596. [Google Scholar] [CrossRef]
- Li, Y.; Wang, M.; Li, Q.; Gao, Y.; Li, Q.; Li, J.; Cao, Y. Transcriptome profiling of longissimus lumborum in Holstein bulls and steers with different beef qualities. PLoS ONE 2020, 15, e0235218. [Google Scholar] [CrossRef]
- Sollier, C.; Capel, E.; Aguilhon, C.; Smirnov, V.; Auclair, M.; Douillard, C.; Ladsous, M.; Defoort-Dhellemmes, S.; Gorwood, J.; Braud, L.; et al. LIPE—Related lipodystrophic syndrome: Clinical features and disease modeling using adipose stem cells. Eur. J. Endocrinol. 2021, 184, 155–168. [Google Scholar] [CrossRef]
- Manning, B.D.; Toker, A. AKT/PKB Signaling: Navigating the Network. Cell 2017, 169, 381–405. [Google Scholar] [CrossRef]
- Schoettl, T.; Fischer, I.P.; Ussar, S. Heterogeneity of adipose tissue in development and metabolic function. J. Exp. Biol. 2018, 221, jeb162958. [Google Scholar] [CrossRef] [PubMed]
- Flint, D.J.; Binart, N.; Kopchick, J.; Kelly, P. Effects of growth hormone and prolactin on adipose tissue development and function. Pituitary 2003, 6, 97–102. [Google Scholar] [CrossRef] [PubMed]
- Le, J.A.; Wilson, H.M.; Shehu, A.; Devi, Y.S.; Aguilar, T.; Gibori, G. Prolactin Activation of the Long Form of its Cognate Receptor Causes Increased Visceral Fat and Obesity in Males as Shown in Transgenic Mice Expressing only this Receptor Subtype. Horm. Metab. Res. 2011, 43, 931–937. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer 5′ to 3′ | Gene ID | |
---|---|---|---|
PRL | F | TCCTGGAGCCAAAGAGACTG | 100861193 |
R | TGACGTGCCTCTTCATCCTT | ||
LPRLR | F | CTCAGGCCTATCCCTCCAAG | 100861318 |
R | TCGGGATTCTCCAGCTTCTC | ||
SPRLR | F | GCAGTGGCTTTGAAGGGCTAT | GU075814.1 |
R | AGGCGAGAAGGCTGTGAT | ||
SREBF1 | F | GCAAAGCCATCGACTACATC | 100860908 |
R | AGGTTCTCCTGCTTGAGCTT | ||
SREBF2 | F | CATCATCGAGAAGCGGTATC | 102189018 |
R | CTCCTGGCGCAGTTTATGA | ||
FASN | F | CAGCCTCTTCCTGTTTGACG | 100861286 |
R | CATGAACTGCCGCATGAAGA | ||
ACACA | F | GCTGCCTCTGATGGTCTTTG | 100861224 |
R | GCCTGAGGAGGGATGTAGAC | ||
HMGCR | F | GGGAGCTTGCTGTGAGAATG | 102169762 |
R | TTCCATCCAAGCACAGAGGT | ||
DHCR7 | F | CTGGACCCTCATCAACCTGT | 102171848 |
R | CGTGGCAGATGTCAATGGTT | ||
PPARG | F | CATTTCCGCTCCGCACTAC | 100861309 |
R | TGGAACCCTGACGCTTTATC | ||
LIPE | F | CAACGAGACTGGCATCAGTG | 100860801 |
R | GCACCTGGATCTCGGTGATA | ||
β-actin | F | GCGGCATTCACGAAACTACC | 102179831 |
R | GCCAGGGCAGTGATCTCTTT |
Item 1 | CON | BCR | p Value |
---|---|---|---|
IW, kg | 23.86 ± 1.18 | 23.96 ± 1.20 | p = 0.952 |
FW, kg | 24.62 ± 1.26 | 24.58 ± 1.18 | p = 0.986 |
ADG, g | 25.19 ± 6.59 | 20.74 ± 7.79 | p = 0.669 |
ADFI, kg | 1.47 ± 0.02 | 1.46 ± 0.02 | p = 0.659 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Duan, C.; Yin, X.; Li, X.; Chen, M.; Chen, J.; Zhao, W.; Zhang, L.; Liu, Y.; Zhang, Y. Effects of Prolactin Inhibition on Lipid Metabolism in Goats. Animals 2024, 14, 3364. https://doi.org/10.3390/ani14233364
Liu X, Duan C, Yin X, Li X, Chen M, Chen J, Zhao W, Zhang L, Liu Y, Zhang Y. Effects of Prolactin Inhibition on Lipid Metabolism in Goats. Animals. 2024; 14(23):3364. https://doi.org/10.3390/ani14233364
Chicago/Turabian StyleLiu, Xiaona, Chunhui Duan, Xuejiao Yin, Xianglong Li, Meijing Chen, Jiaxin Chen, Wen Zhao, Lechao Zhang, Yueqin Liu, and Yingjie Zhang. 2024. "Effects of Prolactin Inhibition on Lipid Metabolism in Goats" Animals 14, no. 23: 3364. https://doi.org/10.3390/ani14233364
APA StyleLiu, X., Duan, C., Yin, X., Li, X., Chen, M., Chen, J., Zhao, W., Zhang, L., Liu, Y., & Zhang, Y. (2024). Effects of Prolactin Inhibition on Lipid Metabolism in Goats. Animals, 14(23), 3364. https://doi.org/10.3390/ani14233364