Expression of Genes Related to Meat Productivity, Metabolic and Morphological Significance of Broiler Chickens with the Use of Nutritional Phytochemicals
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Characteristics of Objects and Conditions of Research
2.2. Broiler Chicken Nutrition and Phytobiotic Feed Additives
2.3. Sample Collection
2.4. Growth and Anatomical Features of Broiler Chickens
2.5. Relative Gene Expression Analysis
2.5.1. Isolation of RNA and Synthesis of cDNA
2.5.2. Quantitative Polymerase Chain Reaction, or Real-Time Polymerase Chain Reaction (qPCR)
2.6. Serum Biochemical Analysis
2.7. Statistical Analysis
3. Results
3.1. Individual Consumption of Phytochemicals by Chickens
3.2. Growth Performance of Broiler Chickens
3.3. Expression of Genes Associated with Meat Productivity
3.3.1. Expression of Genes Associated with Myocyte Growth and Development
3.3.2. Gene Expression Associated with Lipogenesis
3.4. Anatomical Features of Broiler Chickens
3.5. Biochemical Blood Parameters of Broiler Chickens
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, J.; Deng, J.; Chen, M.; Che, Y.; Li, L.; Zhu, L.; Chen, G.; Feng, T. Phytogenic feed additives as natural antibiotic alternatives in animal health and production: A review of the literature of the last decade. Anim. Nutr. 2024, 17, 244–264. [Google Scholar] [CrossRef] [PubMed]
- Aratboni, H.A.; Olvera, C.; Ayala., M. Nanoformulations for lysozyme-based additives in animal feed: An alternative to fight antibiotic resistance spread. Nanotechnol. Rev. 2024, 13, 20240015. [Google Scholar] [CrossRef]
- Kudale, A.M.; Hiralkar, S.S.; Sawant, P.A.; Hulsurkar, Y.P.; Fatate, N.R.; Waghmare, P.P.; Randive, A.P.; Phutane, M.S.; Pawar, P.; Mhase, P. Generating evidence on antibiotic use across human and animal health sectors using the World Health Organization’s Access, Watch, Reserve (AWaRe) classification: Exploratory pilot study in rural Pune, India. Int. J. One Health 2023, 9, 166–171. [Google Scholar] [CrossRef]
- Duarte, M.E.; Kim, S.W. Phytobiotics from Oregano Extracts Enhance the Intestinal Health and Growth Performance of Pigs. Antioxidants 2022, 11, 2066. [Google Scholar] [CrossRef] [PubMed]
- Pandey, S.; Kim, E.S.; Cho, J.H.; Song, M.; Doo, H.; Kim, S.; Keum, G.B.; Kwak, J.; Ryu, S.; Choi, Y.; et al. Cutting-edge knowledge on the roles of phytobiotics and their proposed modes of action in swine. Front. Vet. Sci. 2023, 10, 1265689. [Google Scholar] [CrossRef] [PubMed]
- Holanda, D.M.; Kim, Y.I.; Parnsen, W.; Kim, S.W. Phytobiotics with Adsorbent to Mitigate Toxicity of Multiple Mycotoxins on Health and Growth of Pigs. Toxins 2021, 13, 442. [Google Scholar] [CrossRef] [PubMed]
- Gheisar, M.M.; Kim, I.H. Phytobiotics in poultry and swine nutrition—A review. Ital. J. Anim. Sci. 2017, 17, 92–99. [Google Scholar] [CrossRef]
- Yesuf, Y.K.; Tamir, B.; Tesfaye, E.; Beyero, N. The synergetic effects of some phytobiotics mix on growth, hematology and microbial loads of broiler chickens. Anim. Biotechnol. 2023, 34, 3507–3513. [Google Scholar] [CrossRef]
- Bagno, O.A.; Prokhorov, O.N.; Shevchenko, S.A.; Shevchenko, A.I.; Dyadichkina, T.V. Use of phytobioticts in farm animal feeding (review). Agric. Biol. 2018, 53, 687–697. [Google Scholar] [CrossRef]
- Iwinski, H.; Chodkowska, K.A.; Drabik, K.; Batkowska, J.; Karwowska, M.; Kuropka, P.; Szumowski, A.; Szumny, A.; Rózanski, H. The Impact of a Phytobiotic Mixture on Broiler Chicken Health and Meat Safety. Animals 2023, 13, 2155. [Google Scholar] [CrossRef]
- Falowo, A.B. Beneficial effect of phytobiotic and synbiotic feed additives on growth performance, carcass characteristics and meat quality of broiler chicken. Ann. Anim. Biol. Res. 2022, 2, 61–70. [Google Scholar]
- Samantaray, L.; Nayak, Y. Influence of Phytobiotic Essential Oils on Growth Performance and Hematological Parameters of Broiler Chickens. Adv. Anim. Vet. Sci. 2022, 10, 1289–1295. [Google Scholar] [CrossRef]
- Juhász, Á.; Molnár-Nagy, V.; Bata, Z.; Tso, K.H.; Posta, K. Phytobiotic-Prebiotic Feed Additive Containing a Combination of Carob Pulp, Chicory, and Fenugreek Improve Growth Performance, Carcass Traits, and Fecal Microbiota of Fattening Pigs. Animals 2023, 13, 3621. [Google Scholar] [CrossRef] [PubMed]
- Caicedo, W.; Chinque, D.M.; Grefa, V.J. Phytobiotic additives and their effect on the productive performance of pigs. Cuba. J. Agric. Sci. 2022, 56, 89–103. [Google Scholar]
- Samolińska, W.; Grela, E.R.; Kowalczuk-Vasilev, E.; Kiczorowska, B.; Klebaniuk, R.; Hanczakowska, E. Evaluation of garlic and dandelion supplementation on the growth performance, carcass traits, and fatty acid composition of growing-finishing pigs. Anim. Feed Sci. Technol. 2020, 259, 114316. [Google Scholar] [CrossRef]
- Yildirim, E.A.; Grozina, A.A.; Vertiprakhov, V.G.; Ilyina, L.A.; Filippova, V.A.; Laptev, G.Y.; Brazhnik, E.A.; Kalitkina, K.A.; Tarlavin, N.V.; Dubrovin, A.V.; et al. Effect of T-2 toxin on expression of genes associated with immunity in tissues of the blind processes of the intestinal and pancreas of broilers (Gallus gallus L.). Agric. Biol. 2021, 56, 664–681. [Google Scholar] [CrossRef]
- Titov, V.Y.; Dolgorukova, A.M.; Kochish, I.I.; Myasnikova, O.V. Nitric oxide (NO) content and expression of genes involved in myogenesis in embryonal tissues of chickens (Gallus gallus domesticus L.). Agric. Biol. 2024, 59, 316–327. [Google Scholar] [CrossRef]
- Tyurina, D.G.; Laptev, G.Y.; Yildirim, E.A.; Ilyina, L.A.; Filippova, V.A.; Brazhnik, E.A.; Tarlavin, N.V.; Kalitkina, K.A.; Ponomareva, E.S.; Dubrovin, A.V.; et al. Influence of antibiotics, glyphosate and a Bacillus sp. strain on productivity performance and gene expression in cross Ross 308 broiler chickens (Gallus gallus L.). Agric. Biol. 2022, 57, 1147–1165. [Google Scholar] [CrossRef]
- Laptev, G.Y.; Yildirim, E.A.; Ilyina, L.A.; Filippova, V.A.; Kalitkina, K.A.; Ponomareva, E.S.; Dubrovin, A.V.; Tyurina, D.G.; Fisinin, V.I.; Egorov, I.A.; et al. Expression of genes of immune response and adaptation and cecal microbiome composition in males and females of chickens (Gallus gallus L.) in CM5 and CM9 preparental lines of Smena 9 cross. Agric. Biol. 2023, 58, 313–332. [Google Scholar] [CrossRef]
- Bogolyubova, N.V.; Nekrasov, R.V.; Nikanova, D.A.; Zelenchenkova, A.A.; Kolesnik, N.S.; Rykov, R.A.; Volkova, N.A.; Vetokh, A.N.; Ilina, L.A. Biochemical and molecular genetic indicators of antioxidant protection and immunity in male chicks (Gallus gallus domesticus) of different genotypes. Agric. Biol. 2023, 58, 669–684. [Google Scholar] [CrossRef]
- Tufarelli, V.; Ghavami, N.; Nosrati, M.; Rasouli, B.; Kadim, I.T.; Ramírez, L.S.; Gorlov, I.; Slozhenkina, M.; Mosolov, A.; Seidavi, A.; et al. The effects of peppermint (Mentha piperita L.) and chicory (Cichorium intybus L.) in comparison with a prebiotic on productive performance, blood constituents, immunity and intestinal microflora in broiler chickens. Anim. Biotechnol. 2022, 34, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Shang, R.; He, C.; Chen, J.; Pu, X.; Liu, Y.; Hua, L.; Wang, L.; Liang, J. Hypericum perforatum extract therapy for chickens experimentally infected with infectious bursal disease virus and its influence on immunity. Can. J. Vet. Res. 2012, 76, 180–185. [Google Scholar] [PubMed]
- Erimbetov, K.T.; Obvintseva, O.V.; Solov’eva, A.G.; Mikhailov, V.V. Effects of low protein diets enriched with essential amino acids and Leuzea extract in the growing pigs. Probl. Product. Anim. Biol. 2019, 4, 73–80. [Google Scholar] [CrossRef]
- Ebrahimi, A.; Shahir, M.H.; Kheiry, A. Effects of thyme, garlic, echinacea and galbanum on performance, cecal microbiota and immune function of native ducks. J. Anim. Sci. 2022, 2, 119–130. [Google Scholar] [CrossRef]
- Efimov, D.N.; Egorova, A.V.; Emanuylova, J.V.; Ivanov, A.V.; Konopleva, A.P.; Zotov, A.A.; Lukashenko, V.S.; Komarov, A.A.; Egorov, I.A.; Egorova, T.A.; et al. Manual on Work with Poultry of Meat cross ‘Smena-9’ with Autosex Maternal Parental form: (Breeding Work; Egg Incubation; Technology of Growing, Housing; Feeding; Health and Biosecurity); VNITIP: Sergiev Posad, Russia, 2021. [Google Scholar]
- Vertiprakhov, V.G.; Ksenofontov, D.A.; Kolesnik, E.A.; Ovchinnikova, N.V. Morpho-Biochemical Studies of Blood in Farm Poultry; Vertiprakhov, V.G., Ed.; Russian State Agrarian University—Moscow Timiryazev Agricultural Academy: Moscow, Russia, 2022. [Google Scholar]
- Egorov, I.A.; Manukyan, V.A.; Lenkova, T.N.; Okolelova, T.M.; Lukashenko, V.S.; Shevyakov, A.N.; Ignatova, G.V.; Egorova, T.V.; Andrianova, E.N.; Rozanov, B.L.; et al. Methods of scientific and production research on feeding of agricultural poultry. In Molecular-Genetic Methods of Determination of Intestinal Microflora; VNITIP: Sergiev Posad, Russia, 2013. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Dou, T.; Li, Z.; Wang, K.; Liu, L.; Rong, H.; Xu, Z.; Huang, Y.; Gu, D.; Chen, X.; Hu, W.; et al. Regulation of myostatin expression is associated with growth and muscle development in commercial broiler and DMC muscle. Mol. Biol. Rep. 2018, 45, 511–522. [Google Scholar] [CrossRef]
- Kishawy, A.T.Y.; Al-Khalaifah, H.S.; Nada, H.S.; Roushdy, E.M.; Zaglool, A.W.; Ismail, T.A.; Ibrahim, S.M.; Ibrahim, D. Black Pepper or Radish Seed Oils in a New Combination of Essential Oils Modulated Broiler Chickens’ Performance and Expression of Digestive Enzymes, Lipogenesis, Immunity, and Autophagy-Related Genes. Vet. Sci. 2022, 9, 43. [Google Scholar] [CrossRef]
- Przybylska, P.; Kuczaj, M. Relationship between Selected SNPs (g.16024A/G, g.16039T/C and g.16060A/C) of the FASN Gene and the Fat Content and Fatty Acid Profile in the Milk of Three Breeds of Cows. Animals 2024, 14, 1934. [Google Scholar] [CrossRef]
- Tursunov, D.K.; Sabirova, R.A.; Kulmanova, M.U.; Yusupkhodzhaeva, K.S.; Kaligin, M.S.; Abdrakhmanova, A.I.; Oslopova, J.V.; Garipova, R.V. The Efect of Ecdystene on the Activity of Matrix Metalloproteinases in Experimental Alloxan Diabetes in Rats. BioNanoScience 2021, 11, 923–928. [Google Scholar] [CrossRef]
- Timofeev, N.P. Experience of Rhaponticum carthamoides (Willd.) Iliin cultivation as a natural source of ecdysterone under the conditions of the Arkhangelsk region. Agric. Biol. 2023, 58, 114–141. [Google Scholar] [CrossRef]
- Xia, Y.; Kong, J.; Zhang, G.; Zhang, X.; Seviour, R.; Kong, Y. Effects of dietary inulin supplementation on the composition and dynamics of cecal microbiota and growth-related parameters in broiler chickens. Poult. Sci. 2019, 98, 6942–6953. [Google Scholar] [CrossRef] [PubMed]
- Jalil, B.; Pischel, I.; Feistel, B.; Suarez, C.; Blainski, A.; Spreemann, R.; Roth-Ehrang, R.; Heinrich, M. Wild thyme (Thymus serpyllum L.): A review of the current evidence of nutritional and preventive health benefits. Front. Nutr. 2024, 11, 1380962. [Google Scholar] [CrossRef]
- Badi, H.N.; Amin, G.; Maki, Z.M.; Ziai, S.A. St. John’s wort (Hypericum perforatum L.): A review. J. Med. Plants 2005, 4, 1–14. [Google Scholar]
- Safaei, S.M.H.; Dadpasand, M.; Mohammadabadi, M.; Atashi, H.; Stavetska, R.; Klopenko, N.; Kalashnyk, O. An Origanum majorana Leaf Diet Influences Myogenin Gene Expression, Performance, and Carcass Characteristics in Lambs. Animals 2022, 13, 14. [Google Scholar] [CrossRef]
- Sizova, E.A.; Lutkovskaya, Y.V. Expression of genes associated with economic traits of broiler chickens (Gallus gallus domesticus), as influenced by various paratypical factors (review). Agric. Biol. 2023, 58, 581–597. [Google Scholar] [CrossRef]
- Pira, E.; Vacca, G.M.; Dettori, M.L.; Piras, G.; Moro, M.; Paschino, P.; Pazzola, M. Polymorphisms at Myostatin Gene (MSTN) and the Associations with Sport Performances in Anglo-Arabian Racehorses. Animals 2021, 11, 964. [Google Scholar] [CrossRef] [PubMed]
- Konovalova, E.N.; Selionova, M.I.; Gladyr, E.A.; Romanenkova, O.S.; Evstafeva, L.V. DNA analysis of myostatin, leptin and calpain 1 gene polymorphism in Russian cattle population of Aberdeen Angus breed. Agric. Biol. 2023, 58, 622–637. [Google Scholar] [CrossRef]
- Thepa, T.L.P.; Tyasi, T.L. A Systematic Review of Myostatin Gene Variations and their Association with Growth Traits in Sheep. Adv. Anim. Vet. Sci. 2024, 12, 1199–1205. [Google Scholar] [CrossRef]
- Volkova, N.A.; Vetokh, A.N.; Zinovieva, N.A. Genome editing: Current state and prospects for use in poultry (review). Agric. Biol. 2021, 56, 1015–1030. [Google Scholar] [CrossRef]
- Pisarenko, N.B. Candidate genes promising for marker-assisted selection in aquaculture (review). Agric. Biol. 2023, 58, 953–973. [Google Scholar] [CrossRef]
- Naji, T.A.; Amadou, I.; Zhao, R.-Y.; Tang, X.; Shi, Y.H.; Le, G.-W. Effects of Phytosterol in Feed on Growth and Related Gene Expression in Muscles of Broiler Chickens. Trop. J. Pharm. Res. 2014, 13, 9–16. [Google Scholar] [CrossRef]
- Deng, J.; Zhang, J.; Jin, Y.; Chang, Y.; Shi, M.; Miao, Z. Effects of Chinese yam Polysaccharides on the Muscle Tissues Development-Related Genes Expression in Breast and Thigh Muscle of Broilers. Genes 2023, 14, 6. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Wang, Y.; Amevor, F.K.; Ning, Z.; Deng, X.; Wu, Y.; Wei, S.; Cao, X.; Xu, D.; Tian, Y.; et al. Effect of High Energy Low Protein Diet on Lipid Metabolism and Inflammation in the Liver and Abdominal Adipose Tissue of Laying Hens. Animals 2024, 14, 1199. [Google Scholar] [CrossRef] [PubMed]
- Cherian, G.; Fraz, A.; Bionaz, M. Evaluating the impact of organic chromium on hepatic phospholipid fatty acid molecular species, transcription of genes associated with lipid metabolism and oxidative status in broiler chickens fed flaxseed. Poult. Sci. 2023, 102, 102976. [Google Scholar] [CrossRef]
- Yin, H.; Zhang, Z.; Lan, X.; Zhao, X.; Wang, Y.; Zhu, Q. Association of MyF5, MyF6 and MyOG Gene Polymorphisms with Carcass Traits in Chinese Meat Type Quality Chicken Populations. J. Anim. Vet. Adv. 2011, 10, 704–708. [Google Scholar] [CrossRef]
- Wei, Y.; Zhang, G.X.; Zhang, T.; Wang, J.Y.; Fan, Q.C.; Tang, Y.; Ding, F.X.; Zhang, L. Myf5 and MyoG gene SNPs associated with Bian chicken growth trait. Genet. Mol. Res. 2016, 15, gmr.15037043. [Google Scholar] [CrossRef]
- Gaweł, A.; Madej, J.P.; Kozak, B.; Bobrek, K. Early Post-Hatch Nutrition Influences Performance and Muscle Growth in Broiler Chickens. Animals 2022, 12, 3281. [Google Scholar] [CrossRef]
- Yousefi, K.; Allymehr, M.; Talebi, A.; Tukmechi, A. A comparative study on the expression of myogenic genes, and their effects on performance and meat quality in broiler chicken strains. Vet. Res. Forum 2024, 15, 243–250. [Google Scholar] [CrossRef]
Groups | Poultry Number (n) | Broiler Chicken Feeding Program |
---|---|---|
CON | 36 | Basic diet (BD) without phytochemicals |
CCE | 36 | BD + CCE 450 g/t in Starter and Grower, 560 g/t Finisher |
SJWE | 36 | BD + SJWE 350 g/t in Starter and Grower, 430 g/t Finisher |
MRE | 36 | BD + MRE 170 g/t in Starter and Grower, 210 g/t Finisher |
TCE | 36 | BD + TCE 200 g/t in Starter and Grower, 250 g/t Finisher |
Nutrients | Age of Poultry (Days) | ||
---|---|---|---|
0–10 (Starter) | 11–22 (Grower) | 23–35 (Finisher) | |
Nutritional Value (%) | |||
Metabolic energy (ME) (kcal/100 g) | 305.00 | 299.00 | 303.00 |
Crude protein | 23.00 | 21.50 | 18.50 |
Assimilable lysine | 1.44 | 1.33 | 1.20 |
Assimilable methionine | 0.67 | 0.67 | 0.63 |
Assimilable methionine + cystine | 1.04 | 1.03 | 0.94 |
Assimilable threonine | 0.97 | 0.91 | 0.81 |
Assimilable tryptophan | 0.26 | 0.22 | 0.21 |
Crude fiber | 3.69 | 4.75 | 5.00 |
Essential extract | 3.73 | 5.38 | 5.50 |
Linoleic acid | 1.74 | 2.63 | 2.81 |
Calcium | 1.10 | 0.87 | 0.78 |
Total phosphorus | 0.69 | 0.67 | 0.61 |
Assimilable phosphorus | 0.58 | 0.42 | 0.51 |
Sodium | 0.17 | 0.17 | 0.18 |
Chlorine | 0.17 | 0.19 | 0.20 |
Vitamin B4 (mg/kg) | 1568.00 | 1568.00 | 1540.00 |
Gene | Primers | Author |
---|---|---|
ACTB (β-actin) | F: CTGTGCCCATCTATGAAGGCTA R: ATTTCTCTCTCGGCTGTGGTG | Laptev G.Yu. et al., 2023 [19] |
MYOG (myogenin) | F: GGAGAAGCGGAGGCTGAAG R: GCAGAGTGCTGCGTTTCAGA | Laptev G.Yu. et al., 2022 [18] |
MSTN (myostatin) | F: GCTTTTGATGAGACTGGACGAG R: AGCGGGTAGCGACAACATC | Dou T. et al., 2018 [29] |
FASN (fatty acid synthase) | F: GCAGCTTCGGTGCCTGTGGTT R: GCTGCTTGGCCCACACCTCC | Kishawy A.T.Y. et al., 2022 [30] |
Age of Poultry | CON | Group | p-Value | |||
---|---|---|---|---|---|---|
CCE | SJWE | MRE | TCE | |||
1 day (initial) | 42.1 ± 0.50 | 42.1 ± 0.48 | 41.7 ± 0.49 | 41.9 ± 0.49 | 42.3 ± 0.56 | 0.956 |
7 days | 188.0 ± 3.93 a | 200.6 ± 5.27 ab | 200.2 ± 4.14 ab | 214.1 ± 3.32 b | 200.8 ± 3.85 ab | 0.001 |
14 days | 513.0 ± 10.87 a | 536.8 ± 12.41 ab | 540.1 ± 11.18 ab | 561.1 ± 7.88 b | 542.0 ± 8.48 ab | 0.031 |
21 days | 1091.5 ± 22.64 | 1088.5 ± 22.15 | 1083.3 ± 20.76 | 1109.0 ± 18.51 | 1089.2 ± 16.51 | 0.910 |
28 days | 1581.7 ± 35.92 | 1655.0 ± 36.10 | 1634.8 ± 38.36 | 1655.6 ± 40.45 | 1645.8 ± 30.79 | 0.612 |
35 days (final) | 2061.9 ± 51.62 | 2204.6 ± 50.38 | 2167.3 ± 55.63 | 2216.1 ± 48.91 | 2146.8 ± 44.50 | 0.233 |
Parameters | CON | Groups | p-Value | |||
---|---|---|---|---|---|---|
CCE | SJWE | MRE | TCE | |||
Carcass components | ||||||
Total sample (n = 6) | ||||||
Skeletal muscles (g) | 853.0 ± 15.33 | 925.3 ± 48.16 | 936.7 ± 25.51 | 965.2 ± 34.62 | 961.3 ± 33.44 | 0.149 |
Skin with fat * (g) | 168.2 ± 7.22 a | 176.2 ± 5.45 ab | 205.4 ± 4.90 b | 199.0 ± 12.99 ab | 200.8 ± 6.13 ab | 0.008 |
Bones (g) | 372.7 ± 37.15 | 412.0 ± 27.12 | 357.7 ± 22.47 | 360.3 ± 18.26 | 370.2 ± 43.23 | 0.739 |
♂ (n = 3) | ||||||
Skeletal muscles (g) | 881.7 ± 10.14 | 1011.0 ± 57.86 | 982.3 ± 17.89 | 1023.8 ± 34.79 | 1030.8 ± 25.00 | 0.056 |
Skin with fat * (g) | 177.6 ± 7.55 | 182.9 ± 5.47 | 205.2 ± 10.41 | 220.0 ± 17.95 | 201.3 ± 11.10 | 0.127 |
Bones (g) | 431.9 ± 48.41 | 451.4 ± 24.43 | 399.3 ± 23.91 | 384.9 ± 12.23 | 442.8 ± 61.17 | 0.700 |
♀ (n = 3) | ||||||
Skeletal muscles (g) | 824.2 ± 15.65 | 839.5 ± 29.91 | 891.03 ± 29.16 | 906.6 ± 36.69 | 891.8 ± 11.65 | 0.187 |
Skin with fat * (g) | 158.9 ± 10.80 a | 169.4 ± 8.53 ac | 205.6 ± 3.40 bc | 178.0 ± 8.89 ac | 200.3 ± 8.03 bc | 0.011 |
Bones (g) | 313.6 ± 32.54 | 372.6 ± 39.08 | 316.1 ± 14.91 | 335.8 ± 30.22 | 297.5 ± 18.02 | 0.440 |
Gastrointestinal tract | ||||||
Total sample (n = 6) | ||||||
Esophagus and crop (g) | 14.5 ± 1.29 | 26.1 ± 7.29 | 13.5 ± 1.98 | 15.7 ± 1.85 | 14.6 ± 1.51 | 0.112 |
Glandular stomach (g) | 11.7 ± 1.74 | 11.2 ± 1.70 | 9.5 ± 1.52 | 10.4 ± 1.55 | 8.9 ± 0.82 | 0.662 |
Muscular stomach (g) | 19.6 ± 2.23 | 21.9 ± 1.58 | 16.2 ± 0.61 | 19.2 ± 2.36 | 15.1 ± 1.32 | 0.069 |
Gizzard lining (g) | 3.3 ± 0.49 a | 4.8 ± 0.33 b | 3.7 ± 0.36 ab | 3.5 ± 0.31 ab | 2.7 ± 0.30 a | 0.007 |
Liver (g) | 39.3 ± 2.08 | 41.6 ± 1.92 | 43.7 ± 2.75 | 41.1 ± 2.15 | 42.0 ± 1.54 | 0.686 |
Gallbladder (g) | 1.5 ± 0.15 | 1.3 ± 0.18 | 2.2 ± 0.50 | 2.0 ± 0.23 | 2.0 ± 0.15 | 0.124 |
Pancreas (g) | 4.0 ± 0.32 | 4.1 ± 0.24 | 3.9 ± 0.22 | 4.1 ± 0.12 | 4.7 ± 0.33 | 0.277 |
Intestines (g) | 72.4 ± 6.64 ab | 78.7 ± 2.57 ab | 58.4 ± 3.51 a | 66.4 ± 4.23 ab | 82.9 ± 9.40 b | 0.048 |
♂ (n = 3) | ||||||
Esophagus and crop (g) | 15.7 ± 2.63 | 37.4 ± 11.48 | 17.6 ± 1.72 | 14.9 ± 2.36 | 16.7 ± 2.40 | 0.074 |
Glandular stomach (g) | 15.5 ± 1.09 | 13.6 ± 2.89 | 11.3 ± 2.77 | 13.1 ± 2.19 | 9.3 ± 1.62 | 0.404 |
Muscular stomach (g) | 23.7 ± 1.68 | 23.7 ± 2.75 | 16.4 ± 1.30 | 17.1 ± 2.13 | 16.7 ± 2.39 | 0.058 |
Gizzard lining (g) | 4.1 ± 0.65 | 4.9 ± 0.54 | 4.3 ± 0.48 | 3.4 ± 0.66 | 2.7 ± 0.37 | 0.117 |
Liver (g) | 40.8 ± 3.50 | 44.0 ± 2.67 | 48.7 ± 1.90 | 45.2 ± 2.43 | 43.9 ± 2.38 | 0.384 |
Gallbladder (g) | 1.3 ± 0.18 | 1.4 ± 0.20 | 2.7 ± 0.93 | 2.2 ± 0.37 | 2.1 ± 0.29 | 0.267 |
Pancreas (g) | 4.2 ± 0.54 | 4.3 ± 0.37 | 4.0 ± 0.25 | 4.0 ± 0.23 | 4.2 ± 0.33 | 0.971 |
Intestines (g) | 81.1 ± 11.40 | 79.3 ± 5.03 | 65.0 ± 3.80 | 75.4 ± 3.04 | 78.2 ± 0.94 | 0.391 |
♀ (n = 3) | ||||||
Esophagus and crop (g) | 13.4 ± 0.32 | 14.8 ± 2.32 | 9.5 ± 0.63 | 16.5 ± 3.32 | 12.6 ± 1.15 | 0.195 |
Glandular stomach (g) | 8.0 ± 0.17 | 8.7 ± 0.20 | 7.6 ± 0.71 | 7.7 ± 0.25 | 8.4 ± 0.75 | 0.485 |
Muscular stomach (g) | 15.5 ± 2.28 | 20.1 ± 1.33 | 15.9 ± 0.36 | 21.2 ± 4.39 | 13.6 ± 0.78 | 0.176 |
Gizzard lining (g) | 2.4 ± 0.23 a | 4.7 ± 0.52 b | 3.0 ± 0.09 ab | 3.5 ± 0.42 ab | 2.7 ± 0.56 a | 0.011 |
Liver (g) | 37.7 ± 2.63 | 39.2 ± 2.33 | 38.8 ± 3.11 | 37.1 ± 0.69 | 40.0 ± 1.56 | 0.885 |
Gallbladder (g) | 1.7 ± 0.19 | 1.2 ± 0.34 | 1.7 ± 0.34 | 1.9 ± 0.32 | 1.9 ± 0.17 | 0.444 |
Pancreas (g) | 3.8 ± 0.45 | 4.0 ± 0.36 | 3.8 ± 0.39 | 4.2 ± 0.09 | 5.2 ± 0.43 | 0.115 |
Intestines (g) | 63.7 ± 3.88 | 78.1 ± 2.69 | 51.9 ± 2.08 | 57.4 ± 0.28 | 87.6 ± 20.48 | 0.114 |
Parameters | CON | Groups | p-Value | |||
---|---|---|---|---|---|---|
CCE | SJWE | MRE | TCE | |||
Total protein, g/L | 35.0 ± 0.21 | 25.6 ± 8.50 | 34.6 ± 0.79 | 34.2 ± 0.52 | 36.2 ± 0.92 | 0.374 |
Uric acid, mmol/L | 359.9 ± 15.06 a | 140.4 ± 52.98 b | 74.3 ± 8.04 b | 66.5 ± 14.84 b | 102.7 ± 3.84 b | 0.000 |
Triglycerides, mmol/L | 0.40 ± 0.043 | 0.34 ± 0.108 | 0.36 ± 0.012 | 0.28 ± 0.076 | 0.39 ± 0.033 | 0.704 |
Calcium, mmol/L | 3.79 ± 0.132 | 3.47 ± 0.169 | 3.69 ± 0.097 | 3.39 ± 0.114 | 3.86 ± 0.092 | 0.056 |
Phosphorus, mmol/L | 2.47 ± 0.063 a | 2.33 ± 0.107 ab | 2.14 ± 0.023 b | 2.34 ± 0.032 ab | 2.29 ± 0.034 ab | 0.010 |
Serum blood enzymatic activity | ||||||
Trypsin, U/L | 63.8 ± 5.73 | 77.4 ± 5.36 | 86.4 ± 9.48 | 77.6 ± 3.37 | 62.7 ± 6.52 | 0.069 |
AST, U/L | 238.1 ± 14.27 | 254.5 ± 9.13 | 202.3 ± 29.07 | 225.7 ± 12.90 | 229.4 ± 19.22 | 0.384 |
ALT, U/L | 16.2 ± 1.25 | 13.2 ± 0.73 | 15.4 ± 1.87 | 16.8 ± 1.78 | 18.0 ± 2.17 | 0.340 |
Lipase, U/L | 68.5 ± 0.57 | 73.4 ± 1.68 | 73.3 ± 1.38 | 73.1 ± 3.28 | 68.2 ± 1.25 | 0.117 |
Amylase, U/L | 413.3 ± 20.95 | 345.0 ± 111.62 | 516.5 ± 22.50 | 617.5 ± 118.50 | 415.0 ± 19.36 | 0.222 |
Alkaline phosphatase, U/L | 965.5 ± 19.04 | 451.8 ± 247.43 | 455.3 ± 246.62 | 260.7 ± 162.03 | 467.8 ± 86.35 | 0.133 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Selionova, M.I.; Trukhachev, V.I.; Zagarin, A.Y.; Kulikov, E.I.; Dmitrenko, D.M.; Martynova, V.N.; Kravchenko, A.K.; Vertiprakhov, V.G. Expression of Genes Related to Meat Productivity, Metabolic and Morphological Significance of Broiler Chickens with the Use of Nutritional Phytochemicals. Animals 2024, 14, 2958. https://doi.org/10.3390/ani14202958
Selionova MI, Trukhachev VI, Zagarin AY, Kulikov EI, Dmitrenko DM, Martynova VN, Kravchenko AK, Vertiprakhov VG. Expression of Genes Related to Meat Productivity, Metabolic and Morphological Significance of Broiler Chickens with the Use of Nutritional Phytochemicals. Animals. 2024; 14(20):2958. https://doi.org/10.3390/ani14202958
Chicago/Turabian StyleSelionova, Marina I., Vladimir I. Trukhachev, Artem Yu. Zagarin, Egor I. Kulikov, Dmitry M. Dmitrenko, Vera N. Martynova, Arina K. Kravchenko, and Vladimir G. Vertiprakhov. 2024. "Expression of Genes Related to Meat Productivity, Metabolic and Morphological Significance of Broiler Chickens with the Use of Nutritional Phytochemicals" Animals 14, no. 20: 2958. https://doi.org/10.3390/ani14202958
APA StyleSelionova, M. I., Trukhachev, V. I., Zagarin, A. Y., Kulikov, E. I., Dmitrenko, D. M., Martynova, V. N., Kravchenko, A. K., & Vertiprakhov, V. G. (2024). Expression of Genes Related to Meat Productivity, Metabolic and Morphological Significance of Broiler Chickens with the Use of Nutritional Phytochemicals. Animals, 14(20), 2958. https://doi.org/10.3390/ani14202958